The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029883	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268186 chromosome, complete genome	4807681	929899	937211	4807681	integrase,protease	Dickeya_phage(16.67%)	6	931150:931164	942329:942343
AYS81849.1|929899_931018_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYS81850.1|931014_932961_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931150:931164	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYS81851.1|933090_933312_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYS81852.1|933635_933956_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYS81853.1|933986_936263_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYS81854.1|936833_937211_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942329:942343	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029883	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268186 chromosome, complete genome	4807681	1008124	1085436	4807681	integrase,tail,terminase,protease,transposase	Salmonella_phage(73.33%)	93	990190:990209	1060797:1060816
990190:990209	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS81904.1|1008124_1009465_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYS81905.1|1009461_1009710_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYS81906.1|1009750_1009996_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS81907.1|1009995_1010877_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYS81908.1|1010873_1011938_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYS81909.1|1012015_1012696_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYS81910.1|1012692_1013478_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYS81911.1|1013483_1013780_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYS81912.1|1013870_1014071_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYS81913.1|1014359_1014764_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYS81914.1|1015095_1015470_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYS81915.1|1015554_1016538_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYS81916.1|1016540_1017290_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYS81917.1|1017300_1017648_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYS81918.1|1017644_1018169_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYS81919.1|1018168_1018642_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYS81920.1|1018645_1019218_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYS81921.1|1019311_1019578_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS81922.1|1019659_1019821_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS81923.1|1020253_1020751_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS81924.1|1020935_1021175_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYS81925.1|1021164_1021470_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYS81926.1|1021509_1022112_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYS81927.1|1022320_1022932_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYS81928.1|1023064_1023862_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS81929.1|1024260_1024386_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS81930.1|1024521_1024971_-	lipoprotein	NA	NA	NA	NA	NA
AYS81931.1|1025187_1025577_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYS81932.1|1025563_1025845_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYS81933.1|1025844_1026459_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYS81934.1|1026677_1026932_+	hypothetical protein	NA	NA	NA	NA	NA
AYS81935.1|1027036_1027414_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYS81936.1|1027477_1027738_+	hypothetical protein	NA	NA	NA	NA	NA
AYS81937.1|1027827_1028580_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYS81938.1|1028545_1029949_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYS81939.1|1029948_1031418_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYS81940.1|1031509_1032040_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYS81941.1|1032054_1033287_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYS81942.1|1033291_1033789_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYS81943.1|1033800_1034742_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYS81944.1|1034783_1035152_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYS81945.1|1035117_1035525_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYS81946.1|1035521_1036076_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYS81947.1|1036062_1036452_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYS81948.1|1036426_1036990_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYS81949.1|1036993_1038139_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYS81950.1|1038150_1038591_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYS81951.1|1038594_1039047_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYS81952.1|1039224_1041177_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYS81953.1|1041176_1041827_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYS81954.1|1041830_1042133_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYS81955.1|1042135_1043167_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYS81956.1|1043163_1043499_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYS81957.1|1043693_1044425_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS81958.1|1044424_1044853_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS81959.1|1044911_1045667_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYS81960.1|1045754_1045892_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYS81961.1|1045907_1046261_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYS81962.1|1046261_1047461_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYS81963.1|1047457_1048138_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYS81964.1|1048137_1049649_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYS81965.1|1049663_1050182_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYS81966.1|1051103_1051805_-	hypothetical protein	NA	NA	NA	NA	NA
AYS81967.1|1052117_1052396_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYS81968.1|1052821_1055434_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYS81969.1|1055641_1056652_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYS81970.1|1056814_1057360_+	hypothetical protein	NA	NA	NA	NA	NA
AYS81971.1|1057356_1058466_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYS81972.1|1058564_1060673_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYS81973.1|1060685_1062593_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1060797:1060816	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS81974.1|1062607_1063861_+	inner membrane protein	NA	NA	NA	NA	NA
AYS81975.1|1063865_1065506_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYS81976.1|1065502_1066066_+	lipoprotein	NA	NA	NA	NA	NA
AYS81977.1|1066319_1066487_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYS81978.1|1066586_1067105_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYS81979.1|1067173_1068934_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYS81980.1|1069119_1069572_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYS81981.1|1069643_1070696_-	outer membrane protein A	NA	NA	NA	NA	NA
AYS81982.1|1071050_1071560_-	cell division inhibitor	NA	NA	NA	NA	NA
AYS81983.1|1071776_1072382_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYS81984.1|1072368_1074522_-	inner membrane protein	NA	NA	NA	NA	NA
AYS81985.1|1074540_1074987_-	hypothetical protein	NA	NA	NA	NA	NA
AYS81986.1|1075110_1077165_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYS81987.1|1077200_1077659_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYS81988.1|1077753_1078416_-	hypothetical protein	NA	NA	NA	NA	NA
AYS81989.1|1078586_1079003_+	hypothetical protein	NA	NA	NA	NA	NA
AYS81990.1|1079047_1079365_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYS81991.1|1079422_1080634_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYS81992.1|1081765_1082224_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS81993.1|1082960_1083242_+	acylphosphatase	NA	NA	NA	NA	NA
AYS81994.1|1083238_1083568_-	sulfite reductase	NA	NA	NA	NA	NA
AYS81995.1|1083654_1084314_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYS81996.1|1084977_1085436_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029883	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268186 chromosome, complete genome	4807681	1528254	1601824	4807681	tail,tRNA,plate,head,protease,transposase	Burkholderia_virus(42.11%)	81	NA	NA
AYS82396.1|1528254_1528713_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS82397.1|1529215_1529497_+	stress response protein	NA	NA	NA	NA	NA
AYS82398.1|1529765_1530587_+|protease	serine protease	protease	NA	NA	NA	NA
AYS82399.1|1530621_1530951_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYS82400.1|1530937_1531300_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYS82401.1|1531411_1531582_-	hypothetical protein	NA	NA	NA	NA	NA
AYS82402.1|1531716_1532751_+	hypothetical protein	NA	NA	NA	NA	NA
AYS82403.1|1532925_1534314_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYS82404.1|1534324_1535854_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYS82405.1|1536380_1537325_+	hypothetical protein	NA	NA	NA	NA	NA
AYS82406.1|1537506_1537896_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYS82407.1|1537867_1538320_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYS82408.1|1538514_1538745_-	hypothetical protein	NA	NA	NA	NA	NA
AYS82409.1|1538741_1539425_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYS82410.1|1539421_1539637_-	hypothetical protein	NA	NA	NA	NA	NA
AYS82411.1|1539629_1540013_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYS82412.1|1540009_1540312_-	hypothetical protein	NA	NA	NA	NA	NA
AYS82413.1|1540321_1540594_-	hypothetical protein	NA	NA	NA	NA	NA
AYS82414.1|1540882_1541413_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYS82415.1|1541440_1541710_-	hypothetical protein	NA	NA	NA	NA	NA
AYS82416.1|1541712_1542879_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYS82417.1|1542889_1544659_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYS82418.1|1544836_1545268_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYS82419.1|1545263_1545860_+	hypothetical protein	NA	NA	NA	NA	NA
AYS82420.1|1546103_1546454_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYS82421.1|1547168_1547819_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYS82422.1|1547815_1548142_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYS82423.1|1548141_1548453_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYS82424.1|1548452_1548998_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYS82425.1|1548994_1550590_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYS82426.1|1550589_1552086_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYS82427.1|1552066_1552888_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYS82428.1|1552890_1553349_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYS82429.1|1553563_1554679_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYS82430.1|1554693_1555647_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYS82431.1|1555656_1555995_+	hypothetical protein	NA	NA	NA	NA	NA
AYS82432.1|1555996_1556443_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYS82433.1|1556442_1556907_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYS82434.1|1556903_1557158_+	hypothetical protein	NA	NA	NA	NA	NA
AYS82435.1|1557147_1558575_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYS82436.1|1558574_1559096_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYS82437.1|1559098_1559380_+	hypothetical protein	NA	NA	NA	NA	NA
AYS82438.1|1559477_1559813_+	hypothetical protein	NA	NA	NA	NA	NA
AYS82439.1|1559988_1562454_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYS82440.1|1562453_1563338_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYS82441.1|1563334_1563550_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYS82442.1|1563537_1564692_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYS82443.1|1564688_1565216_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYS82444.1|1565272_1565620_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYS82445.1|1565610_1566714_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYS82446.1|1566706_1567285_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYS82447.1|1567287_1568313_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYS82448.1|1568826_1569444_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYS82449.1|1569937_1570330_-	hypothetical protein	NA	Q9MCR6	Enterobacteria_phage	51.1	6.8e-19
AYS82450.1|1570926_1571499_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYS82451.1|1571779_1573162_+	amino acid permease	NA	NA	NA	NA	NA
AYS82452.1|1573223_1573559_-	hypothetical protein	NA	NA	NA	NA	NA
AYS82453.1|1573685_1574417_+	two-component response regulator	NA	NA	NA	NA	NA
AYS82454.1|1574897_1576049_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYS82455.1|1576201_1577908_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYS82456.1|1578015_1579320_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYS82457.1|1579395_1580325_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYS82458.1|1580321_1581725_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYS82459.1|1581892_1583539_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYS82460.1|1583738_1584914_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYS82461.1|1585016_1586525_+	hypothetical protein	NA	NA	NA	NA	NA
AYS82462.1|1587230_1588232_+	adenosine deaminase	NA	NA	NA	NA	NA
AYS82463.1|1588305_1589421_-	oxidoreductase	NA	NA	NA	NA	NA
AYS82464.1|1589523_1589679_+	hypothetical protein	NA	NA	NA	NA	NA
AYS82465.1|1589977_1590193_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYS82466.1|1590281_1590722_+	hypothetical protein	NA	NA	NA	NA	NA
AYS82467.1|1590798_1591380_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYS82468.1|1591379_1591958_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYS82469.1|1591950_1593972_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYS82470.1|1593972_1595031_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYS82471.1|1595034_1595655_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYS82472.1|1595657_1596350_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYS82473.1|1596349_1596985_+	endonuclease III	NA	NA	NA	NA	NA
AYS82474.1|1597585_1599091_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYS82475.1|1599195_1599801_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYS82476.1|1600549_1601824_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029883	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268186 chromosome, complete genome	4807681	1782861	1787273	4807681		Escherichia_phage(50.0%)	6	NA	NA
AYS82660.1|1782861_1783101_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYS82661.1|1783973_1784783_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYS82662.1|1784855_1785233_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYS82663.1|1785380_1785923_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYS82664.1|1786114_1786843_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYS82665.1|1786859_1787273_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029883	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268186 chromosome, complete genome	4807681	1991126	1998360	4807681		Morganella_phage(33.33%)	7	NA	NA
AYS82855.1|1991126_1992557_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYS82856.1|1992630_1993326_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYS82857.1|1993405_1993717_-	hypothetical protein	NA	NA	NA	NA	NA
AYS82858.1|1994367_1995552_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYS82859.1|1996011_1996224_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYS82860.1|1996669_1997938_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYS82861.1|1997940_1998360_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029883	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268186 chromosome, complete genome	4807681	2104660	2115167	4807681		Enterobacteria_phage(37.5%)	10	NA	NA
AYS82958.1|2104660_2105974_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYS82959.1|2106000_2107080_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYS82960.1|2107084_2107858_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYS82961.1|2107873_2108848_-	reductase RfbI	NA	NA	NA	NA	NA
AYS82962.1|2108853_2109405_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYS82963.1|2109405_2110284_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYS82964.1|2110331_2111231_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYS82965.1|2111230_2112316_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYS82966.1|2112692_2113586_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYS82967.1|2113763_2115167_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029883	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268186 chromosome, complete genome	4807681	2191058	2200229	4807681	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYS83026.1|2191058_2193092_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYS83027.1|2193332_2193791_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYS83028.1|2193962_2194493_+	lipoprotein	NA	NA	NA	NA	NA
AYS83029.1|2194549_2195017_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYS83030.1|2195063_2195783_-	two-component system response regulator	NA	NA	NA	NA	NA
AYS83031.1|2195779_2197465_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYS83032.1|2197687_2198419_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYS83033.1|2198478_2198586_+	hypothetical protein	NA	NA	NA	NA	NA
AYS83034.1|2198566_2199298_-	ABC transporter permease	NA	NA	NA	NA	NA
AYS83035.1|2199281_2200229_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029883	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268186 chromosome, complete genome	4807681	2735681	2749073	4807681	tail	Salmonella_phage(70.0%)	11	NA	NA
AYS83464.1|2735681_2735900_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYS83465.1|2735990_2737091_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS83466.1|2737087_2737573_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS83467.1|2737569_2740647_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS83468.1|2740639_2740759_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS83469.1|2740773_2741076_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS83470.1|2741130_2741646_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS83471.1|2741655_2742828_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS83472.1|2742970_2743543_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS83473.1|2744220_2745336_+	glycosyltransferase	NA	NA	NA	NA	NA
AYS83474.1|2745416_2749073_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029883	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268186 chromosome, complete genome	4807681	3066506	3110209	4807681	tRNA,protease,transposase,bacteriocin	Bacillus_virus(33.33%)	44	NA	NA
AYS83761.1|3066506_3066965_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS83762.1|3067154_3068234_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYS83763.1|3068335_3069499_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYS83764.1|3069520_3070567_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYS83765.1|3070940_3071366_+	hypothetical protein	NA	NA	NA	NA	NA
AYS83766.1|3071391_3071970_+	hypothetical protein	NA	NA	NA	NA	NA
AYS83767.1|3072003_3072678_+	hypothetical protein	NA	NA	NA	NA	NA
AYS83768.1|3072659_3073343_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYS83769.1|3073336_3073993_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYS83770.1|3074097_3074556_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS83771.1|3074744_3076736_-	transketolase	NA	NA	NA	NA	NA
AYS83772.1|3077011_3077770_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYS83773.1|3077870_3078791_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYS83774.1|3079018_3080995_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYS83775.1|3081003_3081135_-	hypothetical protein	NA	NA	NA	NA	NA
AYS83776.1|3081429_3081729_-	membrane protein	NA	NA	NA	NA	NA
AYS83777.1|3081784_3082939_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYS83778.1|3083431_3084826_+	galactose-proton symport	NA	NA	NA	NA	NA
AYS83779.1|3084904_3085402_+	hypothetical protein	NA	NA	NA	NA	NA
AYS83780.1|3085497_3086205_+	endonuclease I	NA	NA	NA	NA	NA
AYS83781.1|3086281_3087013_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYS83782.1|3087032_3087980_+	glutathione synthetase	NA	NA	NA	NA	NA
AYS83783.1|3088195_3088759_+	hypothetical protein	NA	NA	NA	NA	NA
AYS83784.1|3088758_3089175_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYS83785.1|3089221_3089908_-	global regulatory protein	NA	NA	NA	NA	NA
AYS83786.1|3090037_3091018_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYS83787.1|3091035_3091740_+	hypothetical protein	NA	NA	NA	NA	NA
AYS83788.1|3091758_3092325_+	hypothetical protein	NA	NA	NA	NA	NA
AYS83789.1|3092321_3092612_+	hypothetical protein	NA	NA	NA	NA	NA
AYS83790.1|3092619_3093213_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYS83791.1|3093205_3094342_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYS83792.1|3094432_3095440_-	hypothetical protein	NA	NA	NA	NA	NA
AYS83793.1|3095572_3096619_-	L-asparaginase	NA	NA	NA	NA	NA
AYS83794.1|3096937_3097396_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS83795.1|3097518_3098238_-	hypothetical protein	NA	NA	NA	NA	NA
AYS83796.1|3098287_3098614_-	hypothetical protein	NA	NA	NA	NA	NA
AYS83797.1|3098613_3099333_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYS83798.1|3099487_3100540_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYS83799.1|3100567_3100843_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYS83800.1|3100955_3102041_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYS83801.1|3102257_3103514_+	nucleoside permease	NA	NA	NA	NA	NA
AYS83802.1|3106124_3106832_+	hypothetical protein	NA	NA	NA	NA	NA
AYS83803.1|3109421_3109688_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYS83804.1|3109930_3110209_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029883	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268186 chromosome, complete genome	4807681	3488304	3526362	4807681	integrase,capsid,tail,plate,portal,terminase,transposase	Salmonella_phage(82.05%)	46	3483268:3483282	3495434:3495448
3483268:3483282	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYS84133.1|3488304_3489951_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYS84134.1|3490090_3490189_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYS84135.1|3490444_3490774_+	hypothetical protein	NA	NA	NA	NA	NA
AYS84136.1|3490814_3491867_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYS84137.1|3492262_3492832_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYS84138.1|3492957_3493179_+	hypothetical protein	NA	NA	NA	NA	NA
AYS84139.1|3493211_3493721_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYS84140.1|3493895_3494120_+	hypothetical protein	NA	NA	NA	NA	NA
AYS84141.1|3494142_3494484_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYS84142.1|3494551_3494785_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYS84143.1|3494784_3495012_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYS84144.1|3495008_3495866_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3495434:3495448	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYS84145.1|3495862_3498277_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYS84146.1|3498430_3498619_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYS84147.1|3500586_3501501_+	hypothetical protein	NA	NA	NA	NA	NA
AYS84148.1|3501497_3502238_+	hypothetical protein	NA	NA	NA	NA	NA
AYS84149.1|3502272_3503310_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYS84150.1|3503309_3505076_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYS84151.1|3505218_3506052_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYS84152.1|3506068_3507127_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYS84153.1|3507130_3507781_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYS84154.1|3507813_3508341_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYS84155.1|3508340_3508544_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYS84156.1|3508547_3508763_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYS84157.1|3508782_3509256_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYS84158.1|3509257_3509635_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYS84159.1|3509631_3510060_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYS84160.1|3510155_3510587_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYS84161.1|3510579_3511026_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYS84162.1|3511094_3511673_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYS84163.1|3511669_3512029_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYS84164.1|3512015_3512924_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYS84165.1|3512916_3513522_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS84166.1|3513518_3515033_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYS84167.1|3515032_3515626_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYS84168.1|3515597_3516038_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYS84169.1|3516460_3517033_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS84170.1|3517175_3518348_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS84171.1|3518357_3518873_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS84172.1|3518927_3519230_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS84173.1|3519244_3519364_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS84174.1|3519356_3522434_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS84175.1|3522430_3522916_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS84176.1|3522912_3524013_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS84177.1|3524103_3524322_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYS84178.1|3525903_3526362_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029883	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268186 chromosome, complete genome	4807681	3793274	3810683	4807681	integrase,transposase	Escherichia_phage(30.0%)	17	3790980:3791039	3815480:3816247
3790980:3791039	attL	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
AYS84397.1|3793274_3796241_-|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYS84398.1|3796243_3796804_-	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYS84399.1|3796929_3797493_-	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYS84400.1|3797482_3798496_-|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYS84401.1|3798527_3799127_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	31.4	3.1e-15
AYS84402.1|3799323_3799704_+	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYS84403.1|3799610_3800537_+	sulfonamide-resistant dihydropteroate synthase sul1	NA	NA	NA	NA	NA
AYS84404.1|3800770_3801493_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS84405.1|3801525_3801792_+	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
AYS84406.1|3801974_3802835_+	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AYS84407.1|3803414_3804137_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS84408.1|3804197_3805034_-	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYS84409.1|3805033_3805837_-	streptomycin phosphotransferase	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
AYS84410.1|3805897_3806713_-	dihydropteroate synthase	NA	NA	NA	NA	NA
AYS84411.1|3807020_3807872_-	replication protein	NA	NA	NA	NA	NA
AYS84412.1|3808627_3809350_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS84413.1|3809378_3810683_-|integrase	integrase	integrase	NA	NA	NA	NA
3815480:3816247	attR	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACGTATCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAATGGCGGAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCGGTTGCCCGGCATCCAACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCAGTTGCCATGTTTTACGGCAGTGAGAGCAGAGATAGCGCTGATGTCCGGCGGTGCTTTTGCCGTTACGCACCACCCCGTCAGTAGCTGAACAGGAGGGACAGCTGATAGAAACAGAAGCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACC	NA	NA	NA	NA
>prophage 12
CP029883	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268186 chromosome, complete genome	4807681	4467334	4541591	4807681	tail,capsid,integrase,plate,portal,terminase	Salmonella_phage(82.98%)	76	4528835:4528851	4541750:4541766
AYS84977.1|4467334_4469284_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYS84978.1|4469355_4470264_+	hypothetical protein	NA	NA	NA	NA	NA
AYS84979.1|4470337_4471237_+	hypothetical protein	NA	NA	NA	NA	NA
AYS84980.1|4471278_4471638_+	hypothetical protein	NA	NA	NA	NA	NA
AYS84981.1|4471737_4472007_-	hypothetical protein	NA	NA	NA	NA	NA
AYS84982.1|4472138_4473413_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYS84983.1|4473632_4474010_+	hypothetical protein	NA	NA	NA	NA	NA
AYS84984.1|4474096_4474315_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYS84985.1|4474382_4475483_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYS84986.1|4475479_4475965_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYS84987.1|4475964_4478745_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYS84988.1|4478737_4478857_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYS84989.1|4478871_4479174_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYS84990.1|4479228_4479744_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYS84991.1|4479753_4480926_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYS84992.1|4481460_4482183_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYS84993.1|4482380_4482788_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYS84994.1|4482794_4484414_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYS84995.1|4484410_4485016_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS84996.1|4485008_4485917_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYS84997.1|4485903_4486263_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYS84998.1|4486259_4486838_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYS84999.1|4486906_4487353_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYS85000.1|4487345_4487777_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYS85001.1|4487872_4488298_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYS85002.1|4488297_4488675_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYS85003.1|4488679_4489150_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYS85004.1|4489169_4489385_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYS85005.1|4489388_4489592_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYS85006.1|4489591_4490056_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYS85007.1|4490149_4490800_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYS85008.1|4490803_4491868_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYS85009.1|4491884_4492718_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYS85010.1|4492860_4494627_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYS85011.1|4494623_4495670_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYS85012.1|4495718_4496414_-	hypothetical protein	NA	NA	NA	NA	NA
AYS85013.1|4496433_4497498_-	hypothetical protein	NA	NA	NA	NA	NA
AYS85014.1|4497494_4498559_-	hypothetical protein	NA	NA	NA	NA	NA
AYS85015.1|4499483_4499813_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYS85016.1|4499809_4501879_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYS85017.1|4501869_4502730_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYS85018.1|4502726_4503311_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYS85019.1|4503307_4503535_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYS85020.1|4503534_4503768_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYS85021.1|4503835_4504177_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYS85022.1|4504140_4504341_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYS85023.1|4504348_4504858_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYS85024.1|4504890_4505133_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYS85025.1|4505249_4505882_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYS85026.1|4505885_4506911_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYS85027.1|4507017_4507371_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYS85028.1|4507987_4508275_+	hypothetical protein	NA	NA	NA	NA	NA
AYS85029.1|4508285_4509176_+	methyltransferase	NA	NA	NA	NA	NA
AYS85030.1|4509175_4509922_+	hypothetical protein	NA	NA	NA	NA	NA
AYS85031.1|4510223_4512194_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS85032.1|4512213_4513518_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS85033.1|4513540_4514236_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYS85034.1|4514261_4515056_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS85035.1|4515065_4516133_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS85036.1|4516177_4517914_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYS85037.1|4517913_4520409_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS85038.1|4520432_4521479_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYS85039.1|4521481_4522759_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYS85040.1|4523003_4523543_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS85041.1|4524396_4525908_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYS85042.1|4525891_4527481_+	hypothetical protein	NA	NA	NA	NA	NA
AYS85043.1|4527644_4528658_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4528835:4528851	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYS85044.1|4529084_4529378_+	hypothetical protein	NA	NA	NA	NA	NA
AYS85045.1|4529374_4529863_+	hypothetical protein	NA	NA	NA	NA	NA
AYS85046.1|4530042_4530495_-	hypothetical protein	NA	NA	NA	NA	NA
AYS85047.1|4535717_4536179_+	hypothetical protein	NA	NA	NA	NA	NA
AYS85048.1|4536175_4536397_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYS85049.1|4537253_4538036_+	hypothetical protein	NA	NA	NA	NA	NA
AYS85050.1|4538662_4538887_-	hypothetical protein	NA	NA	NA	NA	NA
AYS85051.1|4539016_4540021_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYS85052.1|4540331_4541591_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4541750:4541766	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 13
CP029883	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268186 chromosome, complete genome	4807681	4683843	4694102	4807681	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYS85189.1|4683843_4684920_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYS85190.1|4684916_4685990_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYS85191.1|4685964_4687128_-	hypothetical protein	NA	NA	NA	NA	NA
AYS85192.1|4687403_4687970_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYS85193.1|4687985_4688225_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYS85194.1|4688228_4689089_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYS85195.1|4689511_4689835_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYS85196.1|4689818_4690319_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYS85197.1|4690315_4690543_+	hypothetical protein	NA	NA	NA	NA	NA
AYS85198.1|4690539_4690860_+	P4 phage protein	NA	NA	NA	NA	NA
AYS85199.1|4690874_4691549_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYS85200.1|4691545_4693207_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYS85201.1|4693943_4694102_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029884	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268186 plasmid pHCM2, complete sequence	106706	431	57867	106706		Salmonella_phage(97.01%)	70	NA	NA
AYS85292.1|431_1100_-	hypothetical protein	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
AYS85293.1|1099_1780_-	hypothetical protein	NA	J9Q756	Salmonella_phage	99.6	7.4e-122
AYS85294.1|1862_3422_+	putative helicase	NA	J9Q7I4	Salmonella_phage	99.4	5.7e-295
AYS85295.1|3424_3703_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
AYS85296.1|3762_4185_+	putative lipoprotein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
AYS85297.1|4189_4717_+	putative transcriptional regulator	NA	J9Q6L0	Salmonella_phage	96.6	4.1e-80
AYS85298.1|5351_6002_+	hypothetical protein	NA	J9Q754	Salmonella_phage	100.0	1.4e-114
AYS85299.1|6086_6314_+	hypothetical protein	NA	NA	NA	NA	NA
AYS85300.1|6945_7428_-	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	5.5e-87
AYS85301.1|7633_7921_-	hypothetical protein	NA	J9Q753	Salmonella_phage	94.6	1.5e-47
AYS85302.1|8041_8434_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	65.4	1.7e-41
AYS85303.1|8562_8874_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	92.2	1.1e-45
AYS85304.1|8950_9265_-	hypothetical protein	NA	NA	NA	NA	NA
AYS85305.1|9359_9578_-	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
AYS85306.1|9588_9804_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	95.8	4.5e-33
AYS85307.1|9946_10192_+	hypothetical protein	NA	J9Q751	Salmonella_phage	92.5	5.8e-37
AYS85308.1|11628_12819_-	hypothetical protein	NA	J9Q803	Salmonella_phage	54.6	5.4e-120
AYS85309.1|12828_13146_-	hypothetical protein	NA	J9Q750	Salmonella_phage	80.0	8.1e-47
AYS85310.1|13230_13512_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.6	3.2e-31
AYS85311.1|13685_13889_+	hypothetical protein	NA	J9Q802	Salmonella_phage	95.5	1.5e-30
AYS85312.1|13949_14237_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	58.8	9.9e-28
AYS85313.1|14233_14542_-	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	56.9	3.0e-14
AYS85314.1|14553_15096_-	hypothetical protein	NA	J9Q748	Salmonella_phage	93.1	2.6e-93
AYS85315.1|15092_15734_-	hypothetical protein	NA	J9Q7H7	Salmonella_phage	100.0	9.7e-116
AYS85316.1|15825_16197_-	hypothetical protein	NA	J9Q7T4	Salmonella_phage	100.0	3.2e-63
AYS85317.1|16307_16481_-	hypothetical protein	NA	J9Q801	Salmonella_phage	98.2	9.5e-26
AYS85318.1|16477_17167_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	98.3	6.1e-124
AYS85319.1|17225_18929_-	putative DNA modification methylase	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
AYS85320.1|19052_19625_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	8.2e-98
AYS85321.1|19733_20576_-	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
AYS85322.1|20684_20873_-	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
AYS85323.1|20882_21377_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	96.3	1.9e-79
AYS85324.1|21519_22128_-	putative ribonuclease H	NA	J9Q745	Salmonella_phage	99.5	2.2e-117
AYS85325.1|22713_22944_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
AYS85326.1|23146_23740_-	hypothetical protein	NA	J9Q7T2	Salmonella_phage	99.5	4.6e-112
AYS85327.1|23925_24852_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	85.4	4.1e-107
AYS85328.1|24896_25454_-	hypothetical protein	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
AYS85329.1|25463_25883_-	hypothetical protein	NA	J9Q743	Salmonella_phage	98.6	2.9e-68
AYS85330.1|25946_26591_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
AYS85331.1|26590_27067_-	hypothetical protein	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
AYS85332.1|27063_27477_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
AYS85333.1|27478_28594_-	putative thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.1	7.6e-217
AYS85334.1|28709_29639_-	hypothetical protein	NA	J9Q742	Salmonella_phage	99.0	3.8e-161
AYS85335.1|29721_30864_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.5	2.4e-218
AYS85336.1|30971_33287_-	ribonucleotide-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
AYS85337.1|33364_33934_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	1.7e-103
AYS85338.1|33946_34693_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.0	4.4e-136
AYS85339.1|34682_36599_-	exonuclease	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
AYS85340.1|36595_36832_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
AYS85341.1|36828_37914_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.9	2.7e-206
AYS85342.1|38340_38646_+	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	97.0	2.0e-50
AYS85343.1|38677_39172_-	hypothetical protein	NA	J9Q6J3	Salmonella_phage	97.6	2.3e-88
AYS85344.1|39247_39892_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	2.4e-122
AYS85345.1|40636_41692_+	putative replication protein A	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
AYS85346.1|42220_42424_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	4.0e-31
AYS85347.1|42423_42729_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	90.8	4.9e-33
AYS85348.1|42769_43045_-	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.9e-46
AYS85349.1|43113_43524_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.1	1.4e-75
AYS85350.1|43507_43879_-	hypothetical protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
AYS85351.1|44041_44884_-	putative lipoprotein	NA	J9Q7Z4	Salmonella_phage	97.1	2.3e-125
AYS85352.1|45179_46256_-	putative recombinase	NA	J9Q736	Salmonella_phage	99.7	5.5e-204
AYS85353.1|46258_46525_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AYS85354.1|46524_47469_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.4	6.8e-182
AYS85355.1|47529_48558_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.8	1.1e-164
AYS85356.1|48677_49109_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	100.0	4.0e-73
AYS85357.1|49354_49945_+	hypothetical protein	NA	NA	NA	NA	NA
AYS85358.1|50038_50482_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	97.9	3.0e-71
AYS85359.1|50478_53997_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.1	0.0e+00
AYS85360.1|54177_55413_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	99.5	1.8e-238
AYS85361.1|55509_57867_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	90.7	0.0e+00
>prophage 2
CP029884	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268186 plasmid pHCM2, complete sequence	106706	66357	106510	106706	tail	Salmonella_phage(92.86%)	42	NA	NA
AYS85375.1|66357_66663_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
AYS85376.1|66659_66812_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	96.0	7.6e-19
AYS85377.1|66811_67018_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	8.1e-32
AYS85378.1|67183_68506_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.4	5.8e-256
AYS85379.1|68540_68798_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	92.9	4.9e-34
AYS85380.1|69098_69893_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.2	4.9e-141
AYS85381.1|70076_71129_+	hypothetical protein	NA	J9Q6F5	Salmonella_phage	56.7	1.9e-92
AYS85382.1|71130_72342_-	hypothetical protein	NA	J9Q720	Salmonella_phage	96.5	6.6e-214
AYS85383.1|72404_73745_-	putative DNA helicase	NA	J9Q7G4	Salmonella_phage	99.6	3.8e-247
AYS85384.1|73805_74531_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.3	2.4e-139
AYS85385.1|74808_75864_+	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	42.6	5.1e-61
AYS85386.1|75933_76689_-	hypothetical protein	NA	J9Q7Y9	Salmonella_phage	43.0	3.2e-57
AYS85387.1|76737_77097_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
AYS85388.1|77096_77762_-	hypothetical protein	NA	J9Q7R7	Salmonella_phage	95.0	8.0e-113
AYS85389.1|78092_78644_+	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	39.8	7.8e-29
AYS85390.1|78694_79039_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	83.6	5.9e-27
AYS85391.1|79107_79827_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	95.7	1.5e-125
AYS85392.1|79813_80137_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	2.7e-50
AYS85393.1|80251_82804_-	hypothetical protein	NA	A0A0A0YQM3	Citrobacter_virus	52.5	1.4e-152
AYS85394.1|82886_87275_-|tail	putative phage tail protein	tail	J9Q713	Salmonella_phage	86.7	0.0e+00
AYS85395.1|87289_87877_-|tail	putative phage tail protein	tail	J9Q7F8	Salmonella_phage	92.3	1.1e-102
AYS85396.1|87864_88662_-	hypothetical protein	NA	J9Q7R4	Salmonella_phage	95.8	1.2e-155
AYS85397.1|88654_89386_-|tail	putative phage tail protein	tail	J9Q7Y5	Salmonella_phage	99.1	3.3e-136
AYS85398.1|89442_89778_-	hypothetical protein	NA	J9Q6E1	Salmonella_phage	97.3	5.7e-59
AYS85399.1|89819_94403_-	hypothetical protein	NA	J9Q712	Salmonella_phage	92.9	0.0e+00
AYS85400.1|94410_94680_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AYS85401.1|94760_95078_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
AYS85402.1|95137_95884_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	96.8	7.8e-125
AYS85403.1|95958_96342_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
AYS85404.1|96343_96817_-	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
AYS85405.1|96807_97152_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
AYS85406.1|97249_98083_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	100.0	2.6e-153
AYS85407.1|98082_98517_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
AYS85408.1|98560_99484_-	hypothetical protein	NA	J9Q6D6	Salmonella_phage	100.0	3.3e-157
AYS85409.1|99558_100434_-	hypothetical protein	NA	J9Q710	Salmonella_phage	100.0	3.8e-163
AYS85410.1|100460_101357_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.6	5.7e-146
AYS85411.1|101379_102954_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	3.2e-301
AYS85412.1|102987_104244_-	hypothetical protein	NA	J9Q7Y2	Salmonella_phage	99.8	5.3e-251
AYS85413.1|104246_104888_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	99.5	1.8e-109
AYS85414.1|105083_105350_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
AYS85415.1|105359_106259_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	4.0e-168
AYS85416.1|106255_106510_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
