The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029920	Salmonella enterica subsp. enterica serovar Typhi strain 311189_282186 chromosome, complete genome	4799956	930359	937671	4799956	integrase,protease	Dickeya_phage(16.67%)	6	931610:931624	942789:942803
AYS90644.1|930359_931478_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYS90645.1|931474_933421_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931610:931624	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYS90646.1|933550_933772_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYS90647.1|934095_934416_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYS90648.1|934446_936723_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYS90649.1|937293_937671_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942789:942803	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029920	Salmonella enterica subsp. enterica serovar Typhi strain 311189_282186 chromosome, complete genome	4799956	1008584	1085896	4799956	protease,transposase,tail,terminase,integrase	Salmonella_phage(73.33%)	93	990650:990669	1061257:1061276
990650:990669	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS90699.1|1008584_1009925_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYS90700.1|1009921_1010170_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYS90701.1|1010210_1010456_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS90702.1|1010455_1011337_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYS90703.1|1011333_1012398_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYS90704.1|1012475_1013156_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYS90705.1|1013152_1013938_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYS90706.1|1013943_1014240_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYS90707.1|1014330_1014531_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYS90708.1|1014819_1015224_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYS90709.1|1015555_1015930_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYS90710.1|1016014_1016998_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYS90711.1|1017000_1017750_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYS90712.1|1017760_1018108_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYS90713.1|1018104_1018629_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYS90714.1|1018628_1019102_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYS90715.1|1019105_1019678_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYS90716.1|1019771_1020038_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS90717.1|1020119_1020281_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS90718.1|1020713_1021211_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS90719.1|1021395_1021635_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYS90720.1|1021624_1021930_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYS90721.1|1021969_1022572_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYS90722.1|1022780_1023392_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYS90723.1|1023524_1024322_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS90724.1|1024720_1024846_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS90725.1|1024981_1025431_-	lipoprotein	NA	NA	NA	NA	NA
AYS90726.1|1025647_1026037_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYS90727.1|1026023_1026305_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYS90728.1|1026304_1026919_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYS90729.1|1027137_1027392_+	hypothetical protein	NA	NA	NA	NA	NA
AYS90730.1|1027496_1027874_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYS90731.1|1027937_1028198_+	hypothetical protein	NA	NA	NA	NA	NA
AYS90732.1|1028287_1029040_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYS90733.1|1029005_1030409_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYS90734.1|1030408_1031878_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYS90735.1|1031969_1032500_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYS90736.1|1032514_1033747_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYS90737.1|1033751_1034249_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYS90738.1|1034260_1035202_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYS90739.1|1035243_1035612_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYS90740.1|1035577_1035985_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYS90741.1|1035981_1036536_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYS90742.1|1036522_1036912_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYS90743.1|1036886_1037450_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYS90744.1|1037453_1038599_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYS90745.1|1038610_1039051_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYS90746.1|1039054_1039507_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYS90747.1|1039684_1041637_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYS90748.1|1041636_1042287_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYS90749.1|1042290_1042593_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYS90750.1|1042595_1043627_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYS90751.1|1043623_1043959_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYS90752.1|1044153_1044885_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS90753.1|1044884_1045313_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS90754.1|1045371_1046127_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYS90755.1|1046214_1046352_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYS90756.1|1046367_1046721_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYS90757.1|1046721_1047921_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYS90758.1|1047917_1048598_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYS90759.1|1048597_1050109_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYS90760.1|1050123_1050642_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYS90761.1|1051563_1052265_-	hypothetical protein	NA	NA	NA	NA	NA
AYS90762.1|1052577_1052856_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYS90763.1|1053281_1055894_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYS90764.1|1056101_1057112_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYS90765.1|1057274_1057820_+	hypothetical protein	NA	NA	NA	NA	NA
AYS90766.1|1057816_1058926_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYS90767.1|1059024_1061133_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYS90768.1|1061145_1063053_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061257:1061276	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS90769.1|1063067_1064321_+	inner membrane protein	NA	NA	NA	NA	NA
AYS90770.1|1064325_1065966_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYS90771.1|1065962_1066526_+	lipoprotein	NA	NA	NA	NA	NA
AYS90772.1|1066779_1066947_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYS90773.1|1067046_1067565_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYS90774.1|1067633_1069394_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYS90775.1|1069579_1070032_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYS90776.1|1070103_1071156_-	outer membrane protein A	NA	NA	NA	NA	NA
AYS90777.1|1071510_1072020_-	cell division inhibitor	NA	NA	NA	NA	NA
AYS90778.1|1072236_1072842_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYS90779.1|1072828_1074982_-	inner membrane protein	NA	NA	NA	NA	NA
AYS90780.1|1075000_1075447_-	hypothetical protein	NA	NA	NA	NA	NA
AYS90781.1|1075570_1077625_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYS90782.1|1077660_1078119_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYS90783.1|1078213_1078876_-	hypothetical protein	NA	NA	NA	NA	NA
AYS90784.1|1079046_1079463_+	hypothetical protein	NA	NA	NA	NA	NA
AYS90785.1|1079507_1079825_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYS90786.1|1079882_1081094_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYS90787.1|1082225_1082684_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS90788.1|1083420_1083702_+	acylphosphatase	NA	NA	NA	NA	NA
AYS90789.1|1083698_1084028_-	sulfite reductase	NA	NA	NA	NA	NA
AYS90790.1|1084114_1084774_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYS90791.1|1085437_1085896_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029920	Salmonella enterica subsp. enterica serovar Typhi strain 311189_282186 chromosome, complete genome	4799956	1528714	1602312	4799956	protease,head,transposase,tRNA,plate,tail	Burkholderia_virus(44.12%)	72	NA	NA
AYS91191.1|1528714_1529173_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS91192.1|1529675_1529957_+	stress response protein	NA	NA	NA	NA	NA
AYS91193.1|1530225_1531047_+|protease	serine protease	protease	NA	NA	NA	NA
AYS91194.1|1531081_1531411_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYS91195.1|1531397_1531760_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYS91196.1|1531871_1532042_-	hypothetical protein	NA	NA	NA	NA	NA
AYS91197.1|1532176_1533211_+	hypothetical protein	NA	NA	NA	NA	NA
AYS91198.1|1533385_1534774_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYS91199.1|1534784_1536314_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYS91200.1|1536840_1537785_+	hypothetical protein	NA	NA	NA	NA	NA
AYS91201.1|1537966_1538356_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYS91202.1|1538327_1538780_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYS91203.1|1538974_1539205_-	hypothetical protein	NA	NA	NA	NA	NA
AYS91204.1|1539201_1539885_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYS91205.1|1540469_1540772_-	hypothetical protein	NA	NA	NA	NA	NA
AYS91206.1|1541342_1541873_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYS91207.1|1542172_1543339_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYS91208.1|1543349_1545119_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYS91209.1|1546563_1546914_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYS91210.1|1547628_1548279_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYS91211.1|1548601_1548913_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYS91212.1|1548912_1549458_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYS91213.1|1549454_1551050_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYS91214.1|1551049_1552546_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYS91215.1|1552526_1553348_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYS91216.1|1553350_1553809_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYS91217.1|1554023_1555139_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYS91218.1|1555153_1556107_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYS91219.1|1556116_1556455_+	hypothetical protein	NA	NA	NA	NA	NA
AYS91220.1|1556456_1556903_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYS91221.1|1556902_1557367_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYS91222.1|1557607_1559035_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYS91223.1|1559034_1559556_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYS91224.1|1559558_1559840_+	hypothetical protein	NA	NA	NA	NA	NA
AYS91225.1|1559937_1560273_+	hypothetical protein	NA	NA	NA	NA	NA
AYS91226.1|1560448_1562914_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYS91227.1|1562913_1563798_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYS91228.1|1563794_1564010_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYS91229.1|1563997_1565152_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYS91230.1|1565148_1565676_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYS91231.1|1565732_1566080_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYS91232.1|1566070_1567174_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYS91233.1|1567166_1567745_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYS91234.1|1567747_1568773_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYS91235.1|1569286_1569904_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYS91236.1|1571414_1571987_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYS91237.1|1572267_1573650_+	amino acid permease	NA	NA	NA	NA	NA
AYS91238.1|1573711_1574047_-	hypothetical protein	NA	NA	NA	NA	NA
AYS91239.1|1574173_1574905_+	two-component response regulator	NA	NA	NA	NA	NA
AYS91240.1|1575385_1576537_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYS91241.1|1576689_1578396_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYS91242.1|1578503_1579808_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYS91243.1|1579883_1580813_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYS91244.1|1580809_1582213_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYS91245.1|1582380_1584027_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYS91246.1|1584226_1585402_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYS91247.1|1585504_1587013_+	hypothetical protein	NA	NA	NA	NA	NA
AYS91248.1|1587718_1588720_+	adenosine deaminase	NA	NA	NA	NA	NA
AYS91249.1|1588793_1589909_-	oxidoreductase	NA	NA	NA	NA	NA
AYS91250.1|1590011_1590167_+	hypothetical protein	NA	NA	NA	NA	NA
AYS91251.1|1590465_1590681_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYS91252.1|1590769_1591210_+	hypothetical protein	NA	NA	NA	NA	NA
AYS91253.1|1591286_1591868_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYS91254.1|1591867_1592446_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYS91255.1|1592438_1594460_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYS91256.1|1594460_1595519_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYS91257.1|1595522_1596143_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYS91258.1|1596145_1596838_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYS91259.1|1596837_1597473_+	endonuclease III	NA	NA	NA	NA	NA
AYS91260.1|1598073_1599579_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYS91261.1|1599683_1600289_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYS91262.1|1601037_1602312_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029920	Salmonella enterica subsp. enterica serovar Typhi strain 311189_282186 chromosome, complete genome	4799956	1783349	1787761	4799956		Escherichia_phage(50.0%)	6	NA	NA
AYS91446.1|1783349_1783589_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYS91447.1|1784461_1785271_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYS91448.1|1785343_1785721_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYS91449.1|1785868_1786411_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYS91450.1|1786602_1787331_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYS91451.1|1787347_1787761_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029920	Salmonella enterica subsp. enterica serovar Typhi strain 311189_282186 chromosome, complete genome	4799956	1991615	1998849	4799956		Morganella_phage(33.33%)	7	NA	NA
AYS91642.1|1991615_1993046_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYS91643.1|1993119_1993815_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYS91644.1|1993894_1994206_-	hypothetical protein	NA	NA	NA	NA	NA
AYS91645.1|1994856_1996041_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYS91646.1|1996500_1996713_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYS91647.1|1997158_1998427_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYS91648.1|1998429_1998849_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029920	Salmonella enterica subsp. enterica serovar Typhi strain 311189_282186 chromosome, complete genome	4799956	2105149	2115656	4799956		Enterobacteria_phage(37.5%)	10	NA	NA
AYS91745.1|2105149_2106463_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYS91746.1|2106489_2107569_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYS91747.1|2107573_2108347_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYS91748.1|2108362_2109337_-	reductase RfbI	NA	NA	NA	NA	NA
AYS91749.1|2109342_2109894_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYS91750.1|2109894_2110773_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYS91751.1|2110820_2111720_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYS91752.1|2111719_2112805_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYS91753.1|2113181_2114075_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYS91754.1|2114252_2115656_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029920	Salmonella enterica subsp. enterica serovar Typhi strain 311189_282186 chromosome, complete genome	4799956	2191547	2200718	4799956	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYS91813.1|2191547_2193581_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYS91814.1|2193821_2194280_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYS91815.1|2194451_2194982_+	lipoprotein	NA	NA	NA	NA	NA
AYS91816.1|2195038_2195506_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYS91817.1|2195552_2196272_-	two-component system response regulator	NA	NA	NA	NA	NA
AYS91818.1|2196268_2197954_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYS91819.1|2198176_2198908_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYS91820.1|2198967_2199075_+	hypothetical protein	NA	NA	NA	NA	NA
AYS91821.1|2199055_2199787_-	ABC transporter permease	NA	NA	NA	NA	NA
AYS91822.1|2199770_2200718_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029920	Salmonella enterica subsp. enterica serovar Typhi strain 311189_282186 chromosome, complete genome	4799956	2736202	2749594	4799956	tail	Salmonella_phage(70.0%)	11	NA	NA
AYS92251.1|2736202_2736421_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYS92252.1|2736511_2737612_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS92253.1|2737608_2738094_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS92254.1|2738090_2741168_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS92255.1|2741160_2741280_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS92256.1|2741294_2741597_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS92257.1|2741651_2742167_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS92258.1|2742176_2743349_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS92259.1|2743491_2744064_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS92260.1|2744741_2745857_+	glycosyltransferase	NA	NA	NA	NA	NA
AYS92261.1|2745937_2749594_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029920	Salmonella enterica subsp. enterica serovar Typhi strain 311189_282186 chromosome, complete genome	4799956	3066749	3110452	4799956	transposase,bacteriocin,tRNA,protease	Bacillus_virus(33.33%)	44	NA	NA
AYS92548.1|3066749_3067208_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS92549.1|3067397_3068477_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYS92550.1|3068578_3069742_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYS92551.1|3069763_3070810_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYS92552.1|3071183_3071609_+	hypothetical protein	NA	NA	NA	NA	NA
AYS92553.1|3071634_3072213_+	hypothetical protein	NA	NA	NA	NA	NA
AYS92554.1|3072246_3072921_+	hypothetical protein	NA	NA	NA	NA	NA
AYS92555.1|3072902_3073586_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYS92556.1|3073579_3074236_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYS92557.1|3074340_3074799_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS92558.1|3074987_3076979_-	transketolase	NA	NA	NA	NA	NA
AYS92559.1|3077254_3078013_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYS92560.1|3078113_3079034_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYS92561.1|3079261_3081238_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYS92562.1|3081246_3081378_-	hypothetical protein	NA	NA	NA	NA	NA
AYS92563.1|3081672_3081972_-	membrane protein	NA	NA	NA	NA	NA
AYS92564.1|3082027_3083182_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYS92565.1|3083674_3085069_+	galactose-proton symport	NA	NA	NA	NA	NA
AYS92566.1|3085147_3085645_+	hypothetical protein	NA	NA	NA	NA	NA
AYS92567.1|3085740_3086448_+	endonuclease I	NA	NA	NA	NA	NA
AYS92568.1|3086524_3087256_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYS92569.1|3087275_3088223_+	glutathione synthetase	NA	NA	NA	NA	NA
AYS92570.1|3088438_3089002_+	hypothetical protein	NA	NA	NA	NA	NA
AYS92571.1|3089001_3089418_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYS92572.1|3089464_3090151_-	global regulatory protein	NA	NA	NA	NA	NA
AYS92573.1|3090280_3091261_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYS92574.1|3091278_3091983_+	hypothetical protein	NA	NA	NA	NA	NA
AYS92575.1|3092001_3092568_+	hypothetical protein	NA	NA	NA	NA	NA
AYS92576.1|3092564_3092855_+	hypothetical protein	NA	NA	NA	NA	NA
AYS92577.1|3092862_3093456_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYS92578.1|3093448_3094585_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYS92579.1|3094675_3095683_-	hypothetical protein	NA	NA	NA	NA	NA
AYS92580.1|3095815_3096862_-	L-asparaginase	NA	NA	NA	NA	NA
AYS92581.1|3097180_3097639_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS92582.1|3097761_3098481_-	hypothetical protein	NA	NA	NA	NA	NA
AYS92583.1|3098530_3098857_-	hypothetical protein	NA	NA	NA	NA	NA
AYS92584.1|3098856_3099576_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYS92585.1|3099730_3100783_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYS92586.1|3100810_3101086_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYS92587.1|3101198_3102284_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYS92588.1|3102500_3103757_+	nucleoside permease	NA	NA	NA	NA	NA
AYS92589.1|3106367_3107075_+	hypothetical protein	NA	NA	NA	NA	NA
AYS92590.1|3109664_3109931_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYS92591.1|3110173_3110452_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029920	Salmonella enterica subsp. enterica serovar Typhi strain 311189_282186 chromosome, complete genome	4799956	3488547	3526605	4799956	transposase,portal,tail,terminase,plate,integrase,capsid	Salmonella_phage(82.05%)	46	3483511:3483525	3495677:3495691
3483511:3483525	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYS92920.1|3488547_3490194_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYS92921.1|3490333_3490432_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYS92922.1|3490687_3491017_+	hypothetical protein	NA	NA	NA	NA	NA
AYS92923.1|3491057_3492110_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYS92924.1|3492505_3493075_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYS92925.1|3493200_3493422_+	hypothetical protein	NA	NA	NA	NA	NA
AYS92926.1|3493454_3493964_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYS92927.1|3494138_3494363_+	hypothetical protein	NA	NA	NA	NA	NA
AYS92928.1|3494385_3494727_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYS92929.1|3494794_3495028_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYS92930.1|3495027_3495255_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYS92931.1|3495251_3496109_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3495677:3495691	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYS92932.1|3496105_3498520_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYS92933.1|3498673_3498862_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYS92934.1|3500829_3501744_+	hypothetical protein	NA	NA	NA	NA	NA
AYS92935.1|3501740_3502481_+	hypothetical protein	NA	NA	NA	NA	NA
AYS92936.1|3502515_3503553_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYS92937.1|3503552_3505319_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYS92938.1|3505461_3506295_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYS92939.1|3506311_3507370_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYS92940.1|3507373_3508024_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYS92941.1|3508056_3508584_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYS92942.1|3508583_3508787_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYS92943.1|3508790_3509006_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYS92944.1|3509025_3509499_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYS92945.1|3509500_3509878_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYS92946.1|3509874_3510303_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYS92947.1|3510398_3510830_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYS92948.1|3510822_3511269_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYS92949.1|3511337_3511916_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYS92950.1|3511912_3512272_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYS92951.1|3512258_3513167_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYS92952.1|3513159_3513765_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS92953.1|3513761_3515276_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYS92954.1|3515275_3515869_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYS92955.1|3515840_3516281_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYS92956.1|3516703_3517276_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS92957.1|3517418_3518591_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS92958.1|3518600_3519116_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS92959.1|3519170_3519473_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS92960.1|3519487_3519607_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS92961.1|3519599_3522677_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS92962.1|3522673_3523159_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS92963.1|3523155_3524256_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS92964.1|3524346_3524565_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYS92965.1|3526146_3526605_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029920	Salmonella enterica subsp. enterica serovar Typhi strain 311189_282186 chromosome, complete genome	4799956	4459720	4533884	4799956	portal,terminase,integrase,plate,tail,capsid	Salmonella_phage(82.98%)	76	4521221:4521237	4534043:4534059
AYS93756.1|4459720_4461670_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYS93757.1|4461741_4462650_+	hypothetical protein	NA	NA	NA	NA	NA
AYS93758.1|4462723_4463623_+	hypothetical protein	NA	NA	NA	NA	NA
AYS93759.1|4463664_4464024_+	hypothetical protein	NA	NA	NA	NA	NA
AYS93760.1|4464123_4464393_-	hypothetical protein	NA	NA	NA	NA	NA
AYS93761.1|4464524_4465799_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYS93762.1|4466018_4466396_+	hypothetical protein	NA	NA	NA	NA	NA
AYS93763.1|4466482_4466701_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYS93764.1|4466768_4467869_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYS93765.1|4467865_4468351_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYS93766.1|4468350_4471131_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYS93767.1|4471123_4471243_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYS93768.1|4471257_4471560_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYS93769.1|4471614_4472130_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYS93770.1|4472139_4473312_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYS93771.1|4473846_4474569_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYS93772.1|4474766_4475174_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYS93773.1|4475180_4476800_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYS93774.1|4476796_4477402_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS93775.1|4477394_4478303_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYS93776.1|4478289_4478649_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYS93777.1|4478645_4479224_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYS93778.1|4479292_4479739_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYS93779.1|4479731_4480163_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYS93780.1|4480258_4480684_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYS93781.1|4480683_4481061_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYS93782.1|4481065_4481536_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYS93783.1|4481555_4481771_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYS93784.1|4481774_4481978_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYS93785.1|4481977_4482442_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYS93786.1|4482535_4483186_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYS93787.1|4483189_4484254_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYS93788.1|4484270_4485104_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYS93789.1|4485246_4487013_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYS93790.1|4487009_4488056_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYS93791.1|4488104_4488800_-	hypothetical protein	NA	NA	NA	NA	NA
AYS93792.1|4488819_4489884_-	hypothetical protein	NA	NA	NA	NA	NA
AYS93793.1|4489880_4490945_-	hypothetical protein	NA	NA	NA	NA	NA
AYS93794.1|4491869_4492199_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYS93795.1|4492195_4494265_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYS93796.1|4494255_4495116_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYS93797.1|4495112_4495697_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYS93798.1|4495693_4495921_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYS93799.1|4495920_4496154_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYS93800.1|4496221_4496563_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYS93801.1|4496526_4496727_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYS93802.1|4496734_4497244_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYS93803.1|4497276_4497519_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYS93804.1|4497635_4498268_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYS93805.1|4498271_4499297_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYS93806.1|4499403_4499757_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYS93807.1|4500373_4500661_+	hypothetical protein	NA	NA	NA	NA	NA
AYS93808.1|4500671_4501562_+	methyltransferase	NA	NA	NA	NA	NA
AYS93809.1|4501561_4502308_+	hypothetical protein	NA	NA	NA	NA	NA
AYS93810.1|4502609_4504580_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS93811.1|4504599_4505904_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS93812.1|4505926_4506622_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYS93813.1|4506647_4507442_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS93814.1|4507451_4508519_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS93815.1|4508563_4510300_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYS93816.1|4510299_4512795_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS93817.1|4512818_4513865_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYS93818.1|4513867_4515145_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYS93819.1|4515389_4515929_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS93820.1|4516782_4518294_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYS93821.1|4518277_4519867_+	hypothetical protein	NA	NA	NA	NA	NA
AYS93822.1|4520030_4521044_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4521221:4521237	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYS93823.1|4521470_4521764_+	hypothetical protein	NA	NA	NA	NA	NA
AYS93824.1|4521760_4522249_+	hypothetical protein	NA	NA	NA	NA	NA
AYS93825.1|4522428_4522881_-	hypothetical protein	NA	NA	NA	NA	NA
AYS93826.1|4528103_4528565_+	hypothetical protein	NA	NA	NA	NA	NA
AYS93827.1|4528561_4528783_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYS93828.1|4529639_4530422_+	hypothetical protein	NA	NA	NA	NA	NA
AYS93829.1|4531048_4531273_-	hypothetical protein	NA	NA	NA	NA	NA
AYS93830.1|4531402_4532314_-	hypothetical protein	NA	NA	NA	NA	NA
AYS93831.1|4532624_4533884_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4534043:4534059	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029920	Salmonella enterica subsp. enterica serovar Typhi strain 311189_282186 chromosome, complete genome	4799956	4676136	4686395	4799956	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYS93968.1|4676136_4677213_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYS93969.1|4677209_4678283_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYS93970.1|4678257_4679421_-	hypothetical protein	NA	NA	NA	NA	NA
AYS93971.1|4679696_4680263_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYS93972.1|4680278_4680518_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYS93973.1|4680521_4681382_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYS93974.1|4681804_4682128_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYS93975.1|4682111_4682612_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYS93976.1|4682608_4682836_+	hypothetical protein	NA	NA	NA	NA	NA
AYS93977.1|4682832_4683153_+	P4 phage protein	NA	NA	NA	NA	NA
AYS93978.1|4683167_4683842_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYS93979.1|4683838_4685500_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYS93980.1|4686236_4686395_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029921	Salmonella enterica subsp. enterica serovar Typhi strain 311189_282186 plasmid pHCM2, complete sequence	106706	1139	46178	106706		Salmonella_phage(96.15%)	53	NA	NA
AYS94071.1|1139_1457_-	hypothetical protein	NA	J9Q750	Salmonella_phage	80.0	8.1e-47
AYS94072.1|1541_1823_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.6	3.2e-31
AYS94073.1|1996_2200_+	hypothetical protein	NA	J9Q802	Salmonella_phage	95.5	1.5e-30
AYS94074.1|2260_2548_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	58.8	9.9e-28
AYS94075.1|2544_2853_-	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	56.9	3.0e-14
AYS94076.1|2864_3407_-	hypothetical protein	NA	J9Q748	Salmonella_phage	93.1	2.6e-93
AYS94077.1|3403_4045_-	hypothetical protein	NA	J9Q7H7	Salmonella_phage	100.0	9.7e-116
AYS94078.1|4136_4508_-	hypothetical protein	NA	J9Q7T4	Salmonella_phage	100.0	3.2e-63
AYS94079.1|4618_4792_-	hypothetical protein	NA	J9Q801	Salmonella_phage	98.2	9.5e-26
AYS94080.1|4788_5478_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	98.3	6.1e-124
AYS94081.1|5536_7240_-	putative DNA modification methylase	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
AYS94082.1|7363_7936_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	8.2e-98
AYS94083.1|8044_8887_-	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
AYS94084.1|8995_9184_-	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
AYS94085.1|9193_9688_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	96.3	1.9e-79
AYS94086.1|9830_10439_-	putative ribonuclease H	NA	J9Q745	Salmonella_phage	99.5	2.2e-117
AYS94087.1|11024_11255_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
AYS94088.1|11457_12051_-	hypothetical protein	NA	J9Q7T2	Salmonella_phage	99.5	4.6e-112
AYS94089.1|12236_13163_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	85.4	4.1e-107
AYS94090.1|13207_13765_-	hypothetical protein	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
AYS94091.1|13774_14194_-	hypothetical protein	NA	J9Q743	Salmonella_phage	98.6	2.9e-68
AYS94092.1|14257_14902_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
AYS94093.1|14901_15378_-	hypothetical protein	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
AYS94094.1|15374_15788_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
AYS94095.1|15789_16905_-	putative thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.1	7.6e-217
AYS94096.1|17020_17950_-	hypothetical protein	NA	J9Q742	Salmonella_phage	99.0	3.8e-161
AYS94097.1|18032_19175_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.5	2.4e-218
AYS94098.1|19282_21598_-	ribonucleotide-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
AYS94099.1|21675_22245_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	1.7e-103
AYS94100.1|22257_23004_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.0	4.4e-136
AYS94101.1|22993_24910_-	exonuclease	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
AYS94102.1|24906_25143_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
AYS94103.1|25139_26225_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.9	2.7e-206
AYS94104.1|26651_26957_+	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	97.0	2.0e-50
AYS94105.1|26988_27483_-	hypothetical protein	NA	J9Q6J3	Salmonella_phage	97.6	2.3e-88
AYS94106.1|27558_28203_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	2.4e-122
AYS94107.1|28947_30003_+	putative replication protein A	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
AYS94108.1|30531_30735_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	4.0e-31
AYS94109.1|30734_31040_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	90.8	4.9e-33
AYS94110.1|31080_31356_-	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.9e-46
AYS94111.1|31424_31835_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.1	1.4e-75
AYS94112.1|31818_32190_-	hypothetical protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
AYS94113.1|32352_33195_-	putative lipoprotein	NA	J9Q7Z4	Salmonella_phage	97.1	2.3e-125
AYS94114.1|33490_34567_-	putative recombinase	NA	J9Q736	Salmonella_phage	99.7	5.5e-204
AYS94115.1|34569_34836_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AYS94116.1|34835_35780_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.4	6.8e-182
AYS94117.1|35840_36869_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.8	1.1e-164
AYS94118.1|36988_37420_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	100.0	4.0e-73
AYS94119.1|37665_38256_+	hypothetical protein	NA	NA	NA	NA	NA
AYS94120.1|38349_38793_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	97.9	3.0e-71
AYS94121.1|38789_42308_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.1	0.0e+00
AYS94122.1|42488_43724_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	99.5	1.8e-238
AYS94123.1|43820_46178_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	90.7	0.0e+00
>prophage 2
CP029921	Salmonella enterica subsp. enterica serovar Typhi strain 311189_282186 plasmid pHCM2, complete sequence	106706	54668	105209	106706	tail	Salmonella_phage(94.74%)	59	NA	NA
AYS94136.1|54668_54974_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
AYS94137.1|54970_55123_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	96.0	7.6e-19
AYS94138.1|55122_55329_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	8.1e-32
AYS94139.1|55494_56817_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.4	5.8e-256
AYS94140.1|56851_57109_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	92.9	4.9e-34
AYS94141.1|57409_58204_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.2	4.9e-141
AYS94142.1|58387_59440_+	hypothetical protein	NA	J9Q6F5	Salmonella_phage	56.7	1.9e-92
AYS94143.1|59441_60653_-	hypothetical protein	NA	J9Q720	Salmonella_phage	96.5	6.6e-214
AYS94144.1|60715_62056_-	putative DNA helicase	NA	J9Q7G4	Salmonella_phage	99.6	3.8e-247
AYS94145.1|62116_62842_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.3	2.4e-139
AYS94146.1|63119_64175_+	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	42.6	5.1e-61
AYS94147.1|64244_65000_-	hypothetical protein	NA	J9Q7Y9	Salmonella_phage	43.0	3.2e-57
AYS94148.1|65048_65408_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
AYS94149.1|65407_66073_-	hypothetical protein	NA	J9Q7R7	Salmonella_phage	95.0	8.0e-113
AYS94150.1|66403_66955_+	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	39.8	7.8e-29
AYS94151.1|67005_67350_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	83.6	5.9e-27
AYS94152.1|67418_68138_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	95.7	1.5e-125
AYS94153.1|68124_68448_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	2.7e-50
AYS94154.1|68562_71115_-	hypothetical protein	NA	A0A0A0YQM3	Citrobacter_virus	52.5	1.4e-152
AYS94155.1|71197_75586_-|tail	putative phage tail protein	tail	J9Q713	Salmonella_phage	86.7	0.0e+00
AYS94156.1|75600_76188_-|tail	putative phage tail protein	tail	J9Q7F8	Salmonella_phage	92.3	1.1e-102
AYS94157.1|76175_76973_-	hypothetical protein	NA	J9Q7R4	Salmonella_phage	95.8	1.2e-155
AYS94158.1|76965_77697_-|tail	putative phage tail protein	tail	J9Q7Y5	Salmonella_phage	99.1	3.3e-136
AYS94159.1|77753_78089_-	hypothetical protein	NA	J9Q6E1	Salmonella_phage	97.3	5.7e-59
AYS94160.1|78130_82714_-	hypothetical protein	NA	J9Q712	Salmonella_phage	92.9	0.0e+00
AYS94161.1|82721_82991_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AYS94162.1|83071_83389_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
AYS94163.1|83448_84195_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	96.8	7.8e-125
AYS94164.1|84269_84653_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
AYS94165.1|84654_85128_-	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
AYS94166.1|85118_85463_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
AYS94167.1|85560_86394_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	100.0	2.6e-153
AYS94168.1|86393_86828_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
AYS94169.1|86871_87795_-	hypothetical protein	NA	J9Q6D6	Salmonella_phage	100.0	3.3e-157
AYS94170.1|87869_88745_-	hypothetical protein	NA	J9Q710	Salmonella_phage	100.0	3.8e-163
AYS94171.1|88771_89668_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.6	5.7e-146
AYS94172.1|89690_91265_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	3.2e-301
AYS94173.1|91298_92555_-	hypothetical protein	NA	J9Q7Y2	Salmonella_phage	99.8	5.3e-251
AYS94174.1|92557_93199_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	99.5	1.8e-109
AYS94175.1|93394_93661_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
AYS94176.1|93670_94570_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	4.0e-168
AYS94177.1|94566_94821_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AYS94178.1|94813_95452_-	putative ABC transporter ATP-binding protein	NA	J9Q807	Salmonella_phage	99.1	5.5e-111
AYS94179.1|95448_96117_-	hypothetical protein	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
AYS94180.1|96116_96797_-	hypothetical protein	NA	J9Q756	Salmonella_phage	99.6	7.4e-122
AYS94181.1|96879_98439_+	putative helicase	NA	J9Q7I4	Salmonella_phage	99.4	5.7e-295
AYS94182.1|98441_98720_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
AYS94183.1|98779_99202_+	putative lipoprotein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
AYS94184.1|99206_99734_+	putative transcriptional regulator	NA	J9Q6L0	Salmonella_phage	96.6	4.1e-80
AYS94185.1|100368_101019_+	hypothetical protein	NA	J9Q754	Salmonella_phage	100.0	1.4e-114
AYS94186.1|101103_101331_+	hypothetical protein	NA	NA	NA	NA	NA
AYS94187.1|101962_102445_-	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	5.5e-87
AYS94188.1|102650_102938_-	hypothetical protein	NA	J9Q753	Salmonella_phage	94.6	1.5e-47
AYS94189.1|103058_103451_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	65.4	1.7e-41
AYS94190.1|103579_103891_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	92.2	1.1e-45
AYS94191.1|103967_104282_-	hypothetical protein	NA	NA	NA	NA	NA
AYS94192.1|104376_104595_-	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
AYS94193.1|104605_104821_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	95.8	4.5e-33
AYS94194.1|104963_105209_+	hypothetical protein	NA	J9Q751	Salmonella_phage	92.5	5.8e-37
