The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029894	Salmonella enterica subsp. enterica serovar Typhi strain 311189_291186 chromosome, complete genome	4806999	930142	937454	4806999	integrase,protease	Dickeya_phage(16.67%)	6	931393:931407	942572:942586
AYS94992.1|930142_931261_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYS94993.1|931257_933204_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931393:931407	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYS94994.1|933333_933555_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYS94995.1|933878_934199_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYS94996.1|934229_936506_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYS94997.1|937076_937454_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942572:942586	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029894	Salmonella enterica subsp. enterica serovar Typhi strain 311189_291186 chromosome, complete genome	4806999	1008397	1085709	4806999	tail,terminase,transposase,integrase,protease	Salmonella_phage(73.33%)	93	990463:990482	1061070:1061089
990463:990482	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS95047.1|1008397_1009738_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYS95048.1|1009734_1009983_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYS95049.1|1010023_1010269_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS95050.1|1010268_1011150_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYS95051.1|1011146_1012211_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYS95052.1|1012288_1012969_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYS95053.1|1012965_1013751_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYS95054.1|1013756_1014053_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYS95055.1|1014143_1014344_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYS95056.1|1014632_1015037_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYS95057.1|1015368_1015743_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYS95058.1|1015827_1016811_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYS95059.1|1016813_1017563_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYS95060.1|1017573_1017921_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYS95061.1|1017917_1018442_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYS95062.1|1018441_1018915_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYS95063.1|1018918_1019491_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYS95064.1|1019584_1019851_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS95065.1|1019932_1020094_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS95066.1|1020526_1021024_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS95067.1|1021208_1021448_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYS95068.1|1021437_1021743_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYS95069.1|1021782_1022385_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYS95070.1|1022593_1023205_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYS95071.1|1023337_1024135_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS95072.1|1024533_1024659_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS95073.1|1024794_1025244_-	lipoprotein	NA	NA	NA	NA	NA
AYS95074.1|1025460_1025850_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYS95075.1|1025836_1026118_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYS95076.1|1026117_1026732_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYS95077.1|1026950_1027205_+	hypothetical protein	NA	NA	NA	NA	NA
AYS95078.1|1027309_1027687_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYS95079.1|1027750_1028011_+	hypothetical protein	NA	NA	NA	NA	NA
AYS95080.1|1028100_1028853_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYS95081.1|1028818_1030222_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYS95082.1|1030221_1031691_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYS95083.1|1031782_1032313_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYS95084.1|1032327_1033560_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYS95085.1|1033564_1034062_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYS95086.1|1034073_1035015_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYS95087.1|1035056_1035425_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYS95088.1|1035390_1035798_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYS95089.1|1035794_1036349_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYS95090.1|1036335_1036725_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYS95091.1|1036699_1037263_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYS95092.1|1037266_1038412_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYS95093.1|1038423_1038864_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYS95094.1|1038867_1039320_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYS95095.1|1039497_1041450_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYS95096.1|1041449_1042100_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYS95097.1|1042103_1042406_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYS95098.1|1042408_1043440_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYS95099.1|1043436_1043772_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYS95100.1|1043966_1044698_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS95101.1|1044697_1045126_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS95102.1|1045184_1045940_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYS95103.1|1046027_1046165_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYS95104.1|1046180_1046534_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYS95105.1|1046534_1047734_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYS95106.1|1047730_1048411_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYS95107.1|1048410_1049922_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYS95108.1|1049936_1050455_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYS95109.1|1051376_1052078_-	hypothetical protein	NA	NA	NA	NA	NA
AYS95110.1|1052390_1052669_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYS95111.1|1053094_1055707_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYS95112.1|1055914_1056925_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYS95113.1|1057087_1057633_+	hypothetical protein	NA	NA	NA	NA	NA
AYS95114.1|1057629_1058739_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYS95115.1|1058837_1060946_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYS95116.1|1060958_1062866_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061070:1061089	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS95117.1|1062880_1064134_+	inner membrane protein	NA	NA	NA	NA	NA
AYS95118.1|1064138_1065779_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYS95119.1|1065775_1066339_+	lipoprotein	NA	NA	NA	NA	NA
AYS95120.1|1066592_1066760_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYS95121.1|1066859_1067378_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYS95122.1|1067446_1069207_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYS95123.1|1069392_1069845_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYS95124.1|1069916_1070969_-	outer membrane protein A	NA	NA	NA	NA	NA
AYS95125.1|1071323_1071833_-	cell division inhibitor	NA	NA	NA	NA	NA
AYS95126.1|1072049_1072655_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYS95127.1|1072641_1074795_-	inner membrane protein	NA	NA	NA	NA	NA
AYS95128.1|1074813_1075260_-	hypothetical protein	NA	NA	NA	NA	NA
AYS95129.1|1075383_1077438_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYS95130.1|1077473_1077932_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYS95131.1|1078026_1078689_-	hypothetical protein	NA	NA	NA	NA	NA
AYS95132.1|1078859_1079276_+	hypothetical protein	NA	NA	NA	NA	NA
AYS95133.1|1079320_1079638_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYS95134.1|1079695_1080907_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYS95135.1|1082038_1082497_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS95136.1|1083233_1083515_+	acylphosphatase	NA	NA	NA	NA	NA
AYS95137.1|1083511_1083841_-	sulfite reductase	NA	NA	NA	NA	NA
AYS95138.1|1083927_1084587_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYS95139.1|1085250_1085709_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029894	Salmonella enterica subsp. enterica serovar Typhi strain 311189_291186 chromosome, complete genome	4806999	1528527	1602097	4806999	tail,plate,tRNA,head,transposase,protease	Burkholderia_virus(42.11%)	81	NA	NA
AYS95538.1|1528527_1528986_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS95539.1|1529488_1529770_+	stress response protein	NA	NA	NA	NA	NA
AYS95540.1|1530038_1530860_+|protease	serine protease	protease	NA	NA	NA	NA
AYS95541.1|1530894_1531224_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYS95542.1|1531210_1531573_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYS95543.1|1531684_1531855_-	hypothetical protein	NA	NA	NA	NA	NA
AYS95544.1|1531989_1533024_+	hypothetical protein	NA	NA	NA	NA	NA
AYS95545.1|1533198_1534587_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYS95546.1|1534597_1536127_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYS95547.1|1536653_1537598_+	hypothetical protein	NA	NA	NA	NA	NA
AYS95548.1|1537779_1538169_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYS95549.1|1538140_1538593_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYS95550.1|1538787_1539018_-	hypothetical protein	NA	NA	NA	NA	NA
AYS95551.1|1539014_1539698_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYS95552.1|1539694_1539910_-	hypothetical protein	NA	NA	NA	NA	NA
AYS95553.1|1539902_1540286_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYS95554.1|1540282_1540585_-	hypothetical protein	NA	NA	NA	NA	NA
AYS95555.1|1540594_1540867_-	hypothetical protein	NA	NA	NA	NA	NA
AYS95556.1|1541155_1541686_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYS95557.1|1541713_1541983_-	hypothetical protein	NA	NA	NA	NA	NA
AYS95558.1|1541985_1543152_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYS95559.1|1543162_1544932_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYS95560.1|1545109_1545541_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYS95561.1|1545536_1546133_+	hypothetical protein	NA	NA	NA	NA	NA
AYS95562.1|1546376_1546727_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYS95563.1|1547441_1548092_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYS95564.1|1548088_1548415_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYS95565.1|1548414_1548726_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYS95566.1|1548725_1549271_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYS95567.1|1549267_1550863_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYS95568.1|1550862_1552359_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYS95569.1|1552339_1553161_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYS95570.1|1553163_1553622_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYS95571.1|1553836_1554952_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYS95572.1|1554966_1555920_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYS95573.1|1555929_1556268_+	hypothetical protein	NA	NA	NA	NA	NA
AYS95574.1|1556269_1556716_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYS95575.1|1556715_1557180_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYS95576.1|1557176_1557431_+	hypothetical protein	NA	NA	NA	NA	NA
AYS95577.1|1557420_1558848_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYS95578.1|1558847_1559369_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYS95579.1|1559371_1559653_+	hypothetical protein	NA	NA	NA	NA	NA
AYS95580.1|1559750_1560086_+	hypothetical protein	NA	NA	NA	NA	NA
AYS95581.1|1560261_1562727_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYS95582.1|1562726_1563611_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYS95583.1|1563607_1563823_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYS95584.1|1563810_1564965_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYS95585.1|1564961_1565489_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYS95586.1|1565545_1565893_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYS95587.1|1565883_1566987_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYS95588.1|1566979_1567558_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYS95589.1|1567560_1568586_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYS95590.1|1569099_1569717_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYS95591.1|1570210_1570603_-	hypothetical protein	NA	Q9MCR6	Enterobacteria_phage	51.9	1.2e-18
AYS95592.1|1571199_1571772_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYS95593.1|1572052_1573435_+	amino acid permease	NA	NA	NA	NA	NA
AYS95594.1|1573496_1573832_-	hypothetical protein	NA	NA	NA	NA	NA
AYS95595.1|1573958_1574690_+	two-component response regulator	NA	NA	NA	NA	NA
AYS95596.1|1575170_1576322_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYS95597.1|1576474_1578181_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYS95598.1|1578288_1579593_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYS95599.1|1579668_1580598_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYS95600.1|1580594_1581998_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYS95601.1|1582165_1583812_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYS95602.1|1584011_1585187_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYS95603.1|1585289_1586798_+	hypothetical protein	NA	NA	NA	NA	NA
AYS95604.1|1587503_1588505_+	adenosine deaminase	NA	NA	NA	NA	NA
AYS95605.1|1588578_1589694_-	oxidoreductase	NA	NA	NA	NA	NA
AYS95606.1|1589796_1589952_+	hypothetical protein	NA	NA	NA	NA	NA
AYS95607.1|1590250_1590466_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYS95608.1|1590554_1590995_+	hypothetical protein	NA	NA	NA	NA	NA
AYS95609.1|1591071_1591653_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYS95610.1|1591652_1592231_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYS95611.1|1592223_1594245_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYS95612.1|1594245_1595304_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYS95613.1|1595307_1595928_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYS95614.1|1595930_1596623_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYS95615.1|1596622_1597258_+	endonuclease III	NA	NA	NA	NA	NA
AYS95616.1|1597858_1599364_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYS95617.1|1599468_1600074_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYS95618.1|1600822_1602097_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029894	Salmonella enterica subsp. enterica serovar Typhi strain 311189_291186 chromosome, complete genome	4806999	1783134	1787546	4806999		Escherichia_phage(50.0%)	6	NA	NA
AYS95802.1|1783134_1783374_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYS95803.1|1784246_1785056_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYS95804.1|1785128_1785506_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYS95805.1|1785653_1786196_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYS95806.1|1786387_1787116_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYS95807.1|1787132_1787546_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029894	Salmonella enterica subsp. enterica serovar Typhi strain 311189_291186 chromosome, complete genome	4806999	1991400	1998634	4806999		Morganella_phage(33.33%)	7	NA	NA
AYS95998.1|1991400_1992831_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYS95999.1|1992904_1993600_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYS96000.1|1993679_1993991_-	hypothetical protein	NA	NA	NA	NA	NA
AYS96001.1|1994641_1995826_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYS96002.1|1996285_1996498_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYS96003.1|1996943_1998212_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYS96004.1|1998214_1998634_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029894	Salmonella enterica subsp. enterica serovar Typhi strain 311189_291186 chromosome, complete genome	4806999	2104934	2115441	4806999		Enterobacteria_phage(37.5%)	10	NA	NA
AYS96101.1|2104934_2106248_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYS96102.1|2106274_2107354_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYS96103.1|2107358_2108132_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYS96104.1|2108147_2109122_-	reductase RfbI	NA	NA	NA	NA	NA
AYS96105.1|2109127_2109679_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYS96106.1|2109679_2110558_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYS96107.1|2110605_2111505_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYS96108.1|2111504_2112590_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYS96109.1|2112966_2113860_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYS96110.1|2114037_2115441_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029894	Salmonella enterica subsp. enterica serovar Typhi strain 311189_291186 chromosome, complete genome	4806999	2191332	2200503	4806999	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYS96169.1|2191332_2193366_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYS96170.1|2193606_2194065_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYS96171.1|2194236_2194767_+	lipoprotein	NA	NA	NA	NA	NA
AYS96172.1|2194823_2195291_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYS96173.1|2195337_2196057_-	two-component system response regulator	NA	NA	NA	NA	NA
AYS96174.1|2196053_2197739_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYS96175.1|2197961_2198693_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYS96176.1|2198752_2198860_+	hypothetical protein	NA	NA	NA	NA	NA
AYS96177.1|2198840_2199572_-	ABC transporter permease	NA	NA	NA	NA	NA
AYS96178.1|2199555_2200503_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029894	Salmonella enterica subsp. enterica serovar Typhi strain 311189_291186 chromosome, complete genome	4806999	2735971	2749363	4806999	tail	Salmonella_phage(70.0%)	11	NA	NA
AYS96607.1|2735971_2736190_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYS96608.1|2736280_2737381_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS96609.1|2737377_2737863_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS96610.1|2737859_2740937_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS96611.1|2740929_2741049_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS96612.1|2741063_2741366_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS96613.1|2741420_2741936_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS96614.1|2741945_2743118_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS96615.1|2743260_2743833_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS96616.1|2744510_2745626_+	glycosyltransferase	NA	NA	NA	NA	NA
AYS96617.1|2745706_2749363_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029894	Salmonella enterica subsp. enterica serovar Typhi strain 311189_291186 chromosome, complete genome	4806999	3066245	3109948	4806999	tRNA,bacteriocin,protease,transposase	Bacillus_virus(33.33%)	44	NA	NA
AYS96904.1|3066245_3066704_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS96905.1|3066893_3067973_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYS96906.1|3068074_3069238_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYS96907.1|3069259_3070306_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYS96908.1|3070679_3071105_+	hypothetical protein	NA	NA	NA	NA	NA
AYS96909.1|3071130_3071709_+	hypothetical protein	NA	NA	NA	NA	NA
AYS96910.1|3071742_3072417_+	hypothetical protein	NA	NA	NA	NA	NA
AYS96911.1|3072398_3073082_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYS96912.1|3073075_3073732_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYS96913.1|3073836_3074295_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS96914.1|3074483_3076475_-	transketolase	NA	NA	NA	NA	NA
AYS96915.1|3076750_3077509_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYS96916.1|3077609_3078530_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYS96917.1|3078757_3080734_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYS96918.1|3080742_3080874_-	hypothetical protein	NA	NA	NA	NA	NA
AYS96919.1|3081168_3081468_-	membrane protein	NA	NA	NA	NA	NA
AYS96920.1|3081523_3082678_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYS96921.1|3083170_3084565_+	galactose-proton symport	NA	NA	NA	NA	NA
AYS96922.1|3084643_3085141_+	hypothetical protein	NA	NA	NA	NA	NA
AYS96923.1|3085236_3085944_+	endonuclease I	NA	NA	NA	NA	NA
AYS96924.1|3086020_3086752_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYS96925.1|3086771_3087719_+	glutathione synthetase	NA	NA	NA	NA	NA
AYS96926.1|3087934_3088498_+	hypothetical protein	NA	NA	NA	NA	NA
AYS96927.1|3088497_3088914_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYS96928.1|3088960_3089647_-	global regulatory protein	NA	NA	NA	NA	NA
AYS96929.1|3089776_3090757_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYS96930.1|3090774_3091479_+	hypothetical protein	NA	NA	NA	NA	NA
AYS96931.1|3091497_3092064_+	hypothetical protein	NA	NA	NA	NA	NA
AYS96932.1|3092060_3092351_+	hypothetical protein	NA	NA	NA	NA	NA
AYS96933.1|3092358_3092952_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYS96934.1|3092944_3094081_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYS96935.1|3094171_3095179_-	hypothetical protein	NA	NA	NA	NA	NA
AYS96936.1|3095311_3096358_-	L-asparaginase	NA	NA	NA	NA	NA
AYS96937.1|3096676_3097135_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS96938.1|3097257_3097977_-	hypothetical protein	NA	NA	NA	NA	NA
AYS96939.1|3098026_3098353_-	hypothetical protein	NA	NA	NA	NA	NA
AYS96940.1|3098352_3099072_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYS96941.1|3099226_3100279_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYS96942.1|3100306_3100582_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYS96943.1|3100694_3101780_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYS96944.1|3101996_3103253_+	nucleoside permease	NA	NA	NA	NA	NA
AYS96945.1|3105863_3106571_+	hypothetical protein	NA	NA	NA	NA	NA
AYS96946.1|3109160_3109427_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYS96947.1|3109669_3109948_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029894	Salmonella enterica subsp. enterica serovar Typhi strain 311189_291186 chromosome, complete genome	4806999	3487882	3525940	4806999	portal,tail,plate,terminase,capsid,transposase,integrase	Salmonella_phage(82.05%)	46	3482846:3482860	3495012:3495026
3482846:3482860	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYS97276.1|3487882_3489529_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYS97277.1|3489668_3489767_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYS97278.1|3490022_3490352_+	hypothetical protein	NA	NA	NA	NA	NA
AYS97279.1|3490392_3491445_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYS97280.1|3491840_3492410_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYS97281.1|3492535_3492757_+	hypothetical protein	NA	NA	NA	NA	NA
AYS97282.1|3492789_3493299_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYS97283.1|3493473_3493698_+	hypothetical protein	NA	NA	NA	NA	NA
AYS97284.1|3493720_3494062_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYS97285.1|3494129_3494363_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYS97286.1|3494362_3494590_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYS97287.1|3494586_3495444_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3495012:3495026	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYS97288.1|3495440_3497855_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYS97289.1|3498008_3498197_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYS97290.1|3500164_3501079_+	hypothetical protein	NA	NA	NA	NA	NA
AYS97291.1|3501075_3501816_+	hypothetical protein	NA	NA	NA	NA	NA
AYS97292.1|3501850_3502888_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYS97293.1|3502887_3504654_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYS97294.1|3504796_3505630_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYS97295.1|3505646_3506705_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYS97296.1|3506708_3507359_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYS97297.1|3507391_3507919_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYS97298.1|3507918_3508122_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYS97299.1|3508125_3508341_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYS97300.1|3508360_3508834_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYS97301.1|3508835_3509213_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYS97302.1|3509209_3509638_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYS97303.1|3509733_3510165_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYS97304.1|3510157_3510604_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYS97305.1|3510672_3511251_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYS97306.1|3511247_3511607_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYS97307.1|3511593_3512502_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYS97308.1|3512494_3513100_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS97309.1|3513096_3514611_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYS97310.1|3514610_3515204_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYS97311.1|3515175_3515616_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYS97312.1|3516038_3516611_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS97313.1|3516753_3517926_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS97314.1|3517935_3518451_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS97315.1|3518505_3518808_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS97316.1|3518822_3518942_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS97317.1|3518934_3522012_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS97318.1|3522008_3522494_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS97319.1|3522490_3523591_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS97320.1|3523681_3523900_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYS97321.1|3525481_3525940_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029894	Salmonella enterica subsp. enterica serovar Typhi strain 311189_291186 chromosome, complete genome	4806999	3792691	3810100	4806999	integrase,transposase	Escherichia_phage(30.0%)	17	3790397:3790456	3814897:3815664
3790397:3790456	attL	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
AYS97540.1|3792691_3795658_-|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYS97541.1|3795660_3796221_-	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYS97542.1|3796346_3796910_-	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYS97543.1|3796899_3797913_-|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYS97544.1|3797944_3798544_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	31.4	3.1e-15
AYS97545.1|3798740_3799121_+	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYS97546.1|3799027_3799954_+	sulfonamide-resistant dihydropteroate synthase sul1	NA	NA	NA	NA	NA
AYS97547.1|3800187_3800910_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS97548.1|3800942_3801209_+	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
AYS97549.1|3801391_3802252_+	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AYS97550.1|3802831_3803554_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS97551.1|3803614_3804451_-	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYS97552.1|3804450_3805254_-	streptomycin phosphotransferase	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
AYS97553.1|3805314_3806130_-	dihydropteroate synthase	NA	NA	NA	NA	NA
AYS97554.1|3806437_3807289_-	replication protein	NA	NA	NA	NA	NA
AYS97555.1|3808044_3808767_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS97556.1|3808795_3810100_-|integrase	integrase	integrase	NA	NA	NA	NA
3814897:3815664	attR	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACGTATCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAATGGCGGAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCGGTTGCCCGGCATCCAACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCAGTTGCCATGTTTTACGGCAGTGAGAGCAGAGATAGCGCTGATGTCCGGCGGTGCTTTTGCCGTTACGCACCACCCCGTCAGTAGCTGAACAGGAGGGACAGCTGATAGAAACAGAAGCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACC	NA	NA	NA	NA
>prophage 12
CP029894	Salmonella enterica subsp. enterica serovar Typhi strain 311189_291186 chromosome, complete genome	4806999	4466751	4540915	4806999	portal,tail,plate,integrase,capsid,terminase	Salmonella_phage(82.98%)	76	4528252:4528268	4541074:4541090
AYS98120.1|4466751_4468701_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYS98121.1|4468772_4469681_+	hypothetical protein	NA	NA	NA	NA	NA
AYS98122.1|4469754_4470654_+	hypothetical protein	NA	NA	NA	NA	NA
AYS98123.1|4470695_4471055_+	hypothetical protein	NA	NA	NA	NA	NA
AYS98124.1|4471154_4471424_-	hypothetical protein	NA	NA	NA	NA	NA
AYS98125.1|4471555_4472830_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYS98126.1|4473049_4473427_+	hypothetical protein	NA	NA	NA	NA	NA
AYS98127.1|4473513_4473732_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYS98128.1|4473799_4474900_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYS98129.1|4474896_4475382_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYS98130.1|4475381_4478162_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYS98131.1|4478154_4478274_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYS98132.1|4478288_4478591_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYS98133.1|4478645_4479161_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYS98134.1|4479170_4480343_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYS98135.1|4480877_4481600_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYS98136.1|4481797_4482205_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYS98137.1|4482211_4483831_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYS98138.1|4483827_4484433_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS98139.1|4484425_4485334_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYS98140.1|4485320_4485680_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYS98141.1|4485676_4486255_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYS98142.1|4486323_4486770_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYS98143.1|4486762_4487194_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYS98144.1|4487289_4487715_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYS98145.1|4487714_4488092_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYS98146.1|4488096_4488567_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYS98147.1|4488586_4488802_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYS98148.1|4488805_4489009_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYS98149.1|4489008_4489473_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYS98150.1|4489566_4490217_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYS98151.1|4490220_4491285_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYS98152.1|4491301_4492135_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYS98153.1|4492277_4494044_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYS98154.1|4494040_4495087_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYS98155.1|4495135_4495831_-	hypothetical protein	NA	NA	NA	NA	NA
AYS98156.1|4495850_4496915_-	hypothetical protein	NA	NA	NA	NA	NA
AYS98157.1|4496911_4497976_-	hypothetical protein	NA	NA	NA	NA	NA
AYS98158.1|4498900_4499230_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYS98159.1|4499226_4501296_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYS98160.1|4501286_4502147_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYS98161.1|4502143_4502728_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYS98162.1|4502724_4502952_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYS98163.1|4502951_4503185_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYS98164.1|4503252_4503594_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYS98165.1|4503557_4503758_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYS98166.1|4503765_4504275_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYS98167.1|4504307_4504550_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYS98168.1|4504666_4505299_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYS98169.1|4505302_4506328_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYS98170.1|4506434_4506788_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYS98171.1|4507404_4507692_+	hypothetical protein	NA	NA	NA	NA	NA
AYS98172.1|4507702_4508593_+	methyltransferase	NA	NA	NA	NA	NA
AYS98173.1|4508592_4509339_+	hypothetical protein	NA	NA	NA	NA	NA
AYS98174.1|4509640_4511611_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS98175.1|4511630_4512935_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS98176.1|4512957_4513653_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYS98177.1|4513678_4514473_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS98178.1|4514482_4515550_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS98179.1|4515594_4517331_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYS98180.1|4517330_4519826_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS98181.1|4519849_4520896_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYS98182.1|4520898_4522176_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYS98183.1|4522420_4522960_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS98184.1|4523813_4525325_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYS98185.1|4525308_4526898_+	hypothetical protein	NA	NA	NA	NA	NA
AYS98186.1|4527061_4528075_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4528252:4528268	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYS98187.1|4528501_4528795_+	hypothetical protein	NA	NA	NA	NA	NA
AYS98188.1|4528791_4529280_+	hypothetical protein	NA	NA	NA	NA	NA
AYS98189.1|4529459_4529912_-	hypothetical protein	NA	NA	NA	NA	NA
AYS98190.1|4535134_4535596_+	hypothetical protein	NA	NA	NA	NA	NA
AYS98191.1|4535592_4535814_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYS98192.1|4536670_4537453_+	hypothetical protein	NA	NA	NA	NA	NA
AYS98193.1|4538079_4538304_-	hypothetical protein	NA	NA	NA	NA	NA
AYS98194.1|4538433_4539345_-	hypothetical protein	NA	NA	NA	NA	NA
AYS98195.1|4539655_4540915_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4541074:4541090	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 13
CP029894	Salmonella enterica subsp. enterica serovar Typhi strain 311189_291186 chromosome, complete genome	4806999	4683167	4693426	4806999	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYS98332.1|4683167_4684244_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYS98333.1|4684240_4685314_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYS98334.1|4685288_4686452_-	hypothetical protein	NA	NA	NA	NA	NA
AYS98335.1|4686727_4687294_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYS98336.1|4687309_4687549_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYS98337.1|4687552_4688413_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYS98338.1|4688835_4689159_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYS98339.1|4689142_4689643_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYS98340.1|4689639_4689867_+	hypothetical protein	NA	NA	NA	NA	NA
AYS98341.1|4689863_4690184_+	P4 phage protein	NA	NA	NA	NA	NA
AYS98342.1|4690198_4690873_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYS98343.1|4690869_4692531_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYS98344.1|4693267_4693426_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
