The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029875	Salmonella enterica subsp. enterica serovar Typhi strain 343076_227128 chromosome, complete genome	4800199	930277	937589	4800199	integrase,protease	Dickeya_phage(16.67%)	6	931528:931542	942707:942721
AYT07799.1|930277_931396_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYT07800.1|931392_933339_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931528:931542	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYT07801.1|933468_933690_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYT07802.1|934013_934334_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYT07803.1|934364_936641_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYT07804.1|937211_937589_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942707:942721	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029875	Salmonella enterica subsp. enterica serovar Typhi strain 343076_227128 chromosome, complete genome	4800199	1008688	1086000	4800199	transposase,protease,integrase,terminase,tail	Salmonella_phage(73.33%)	93	990754:990773	1061361:1061380
990754:990773	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYT07854.1|1008688_1010029_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYT07855.1|1010025_1010274_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYT07856.1|1010314_1010560_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYT07857.1|1010559_1011441_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYT07858.1|1011437_1012502_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYT07859.1|1012579_1013260_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYT07860.1|1013256_1014042_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYT07861.1|1014047_1014344_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYT07862.1|1014434_1014635_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYT07863.1|1014923_1015328_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYT07864.1|1015659_1016034_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYT07865.1|1016118_1017102_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYT07866.1|1017104_1017854_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYT07867.1|1017864_1018212_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYT07868.1|1018208_1018733_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYT07869.1|1018732_1019206_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYT07870.1|1019209_1019782_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYT07871.1|1019875_1020142_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYT07872.1|1020223_1020385_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT07873.1|1020817_1021315_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT07874.1|1021499_1021739_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYT07875.1|1021728_1022034_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYT07876.1|1022073_1022676_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYT07877.1|1022884_1023496_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYT07878.1|1023628_1024426_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYT07879.1|1024824_1024950_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT07880.1|1025085_1025535_-	lipoprotein	NA	NA	NA	NA	NA
AYT07881.1|1025751_1026141_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYT07882.1|1026127_1026409_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYT07883.1|1026408_1027023_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYT07884.1|1027241_1027496_+	hypothetical protein	NA	NA	NA	NA	NA
AYT07885.1|1027600_1027978_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYT07886.1|1028041_1028302_+	hypothetical protein	NA	NA	NA	NA	NA
AYT07887.1|1028391_1029144_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYT07888.1|1029109_1030513_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYT07889.1|1030512_1031982_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYT07890.1|1032073_1032604_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYT07891.1|1032618_1033851_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYT07892.1|1033855_1034353_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYT07893.1|1034364_1035306_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYT07894.1|1035347_1035716_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYT07895.1|1035681_1036089_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYT07896.1|1036085_1036640_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYT07897.1|1036626_1037016_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYT07898.1|1036990_1037554_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYT07899.1|1037557_1038703_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYT07900.1|1038714_1039155_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYT07901.1|1039158_1039611_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYT07902.1|1039788_1041741_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYT07903.1|1041740_1042391_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYT07904.1|1042394_1042697_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYT07905.1|1042699_1043731_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYT07906.1|1043727_1044063_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYT07907.1|1044257_1044989_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT07908.1|1044988_1045417_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT07909.1|1045475_1046231_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYT07910.1|1046318_1046456_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYT07911.1|1046471_1046825_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYT07912.1|1046825_1048025_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYT07913.1|1048021_1048702_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYT07914.1|1048701_1050213_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYT07915.1|1050227_1050746_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYT07916.1|1051667_1052369_-	hypothetical protein	NA	NA	NA	NA	NA
AYT07917.1|1052681_1052960_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYT07918.1|1053385_1055998_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYT07919.1|1056205_1057216_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYT07920.1|1057378_1057924_+	hypothetical protein	NA	NA	NA	NA	NA
AYT07921.1|1057920_1059030_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYT07922.1|1059128_1061237_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYT07923.1|1061249_1063157_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061361:1061380	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYT07924.1|1063171_1064425_+	inner membrane protein	NA	NA	NA	NA	NA
AYT07925.1|1064429_1066070_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYT07926.1|1066066_1066630_+	lipoprotein	NA	NA	NA	NA	NA
AYT07927.1|1066883_1067051_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYT07928.1|1067150_1067669_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYT07929.1|1067737_1069498_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYT07930.1|1069683_1070136_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYT07931.1|1070207_1071260_-	outer membrane protein A	NA	NA	NA	NA	NA
AYT07932.1|1071614_1072124_-	cell division inhibitor	NA	NA	NA	NA	NA
AYT07933.1|1072340_1072946_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYT07934.1|1072932_1075086_-	inner membrane protein	NA	NA	NA	NA	NA
AYT07935.1|1075104_1075551_-	hypothetical protein	NA	NA	NA	NA	NA
AYT07936.1|1075674_1077729_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYT07937.1|1077764_1078223_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYT07938.1|1078317_1078980_-	hypothetical protein	NA	NA	NA	NA	NA
AYT07939.1|1079150_1079567_+	hypothetical protein	NA	NA	NA	NA	NA
AYT07940.1|1079611_1079929_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYT07941.1|1079986_1081198_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYT07942.1|1082329_1082788_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT07943.1|1083524_1083806_+	acylphosphatase	NA	NA	NA	NA	NA
AYT07944.1|1083802_1084132_-	sulfite reductase	NA	NA	NA	NA	NA
AYT07945.1|1084218_1084878_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYT07946.1|1085541_1086000_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029875	Salmonella enterica subsp. enterica serovar Typhi strain 343076_227128 chromosome, complete genome	4800199	1528818	1602416	4800199	tRNA,transposase,protease,head,plate,tail	Burkholderia_virus(44.12%)	72	NA	NA
AYT08346.1|1528818_1529277_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT08347.1|1529779_1530061_+	stress response protein	NA	NA	NA	NA	NA
AYT08348.1|1530329_1531151_+|protease	serine protease	protease	NA	NA	NA	NA
AYT08349.1|1531185_1531515_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYT08350.1|1531501_1531864_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYT08351.1|1531975_1532146_-	hypothetical protein	NA	NA	NA	NA	NA
AYT08352.1|1532280_1533315_+	hypothetical protein	NA	NA	NA	NA	NA
AYT08353.1|1533489_1534878_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYT08354.1|1534888_1536418_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYT08355.1|1536944_1537889_+	hypothetical protein	NA	NA	NA	NA	NA
AYT08356.1|1538070_1538460_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYT08357.1|1538431_1538884_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYT08358.1|1539078_1539309_-	hypothetical protein	NA	NA	NA	NA	NA
AYT08359.1|1539305_1539989_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYT08360.1|1540573_1540876_-	hypothetical protein	NA	NA	NA	NA	NA
AYT08361.1|1541446_1541977_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYT08362.1|1542276_1543443_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYT08363.1|1543453_1545223_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYT08364.1|1546667_1547018_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYT08365.1|1547732_1548383_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYT08366.1|1548705_1549017_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYT08367.1|1549016_1549562_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYT08368.1|1549558_1551154_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYT08369.1|1551153_1552650_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYT08370.1|1552630_1553452_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYT08371.1|1553454_1553913_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYT08372.1|1554127_1555243_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYT08373.1|1555257_1556211_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYT08374.1|1556220_1556559_+	hypothetical protein	NA	NA	NA	NA	NA
AYT08375.1|1556560_1557007_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYT08376.1|1557006_1557471_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYT08377.1|1557711_1559139_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYT08378.1|1559138_1559660_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYT08379.1|1559662_1559944_+	hypothetical protein	NA	NA	NA	NA	NA
AYT08380.1|1560041_1560377_+	hypothetical protein	NA	NA	NA	NA	NA
AYT08381.1|1560552_1563018_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYT08382.1|1563017_1563902_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYT08383.1|1563898_1564114_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYT08384.1|1564101_1565256_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYT08385.1|1565252_1565780_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYT08386.1|1565836_1566184_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYT08387.1|1566174_1567278_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYT08388.1|1567270_1567849_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYT08389.1|1567851_1568877_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYT08390.1|1569390_1570008_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYT08391.1|1571518_1572091_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYT08392.1|1572371_1573754_+	amino acid permease	NA	NA	NA	NA	NA
AYT08393.1|1573815_1574151_-	hypothetical protein	NA	NA	NA	NA	NA
AYT08394.1|1574277_1575009_+	two-component response regulator	NA	NA	NA	NA	NA
AYT08395.1|1575489_1576641_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYT08396.1|1576793_1578500_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYT08397.1|1578607_1579912_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYT08398.1|1579987_1580917_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYT08399.1|1580913_1582317_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYT08400.1|1582484_1584131_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYT08401.1|1584330_1585506_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYT08402.1|1585608_1587117_+	hypothetical protein	NA	NA	NA	NA	NA
AYT08403.1|1587822_1588824_+	adenosine deaminase	NA	NA	NA	NA	NA
AYT08404.1|1588897_1590013_-	oxidoreductase	NA	NA	NA	NA	NA
AYT08405.1|1590115_1590271_+	hypothetical protein	NA	NA	NA	NA	NA
AYT08406.1|1590569_1590785_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYT08407.1|1590873_1591314_+	hypothetical protein	NA	NA	NA	NA	NA
AYT08408.1|1591390_1591972_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYT08409.1|1591971_1592550_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYT08410.1|1592542_1594564_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYT08411.1|1594564_1595623_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYT08412.1|1595626_1596247_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYT08413.1|1596249_1596942_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYT08414.1|1596941_1597577_+	endonuclease III	NA	NA	NA	NA	NA
AYT08415.1|1598177_1599683_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYT08416.1|1599787_1600393_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYT08417.1|1601141_1602416_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029875	Salmonella enterica subsp. enterica serovar Typhi strain 343076_227128 chromosome, complete genome	4800199	1783453	1787865	4800199		Escherichia_phage(50.0%)	6	NA	NA
AYT08601.1|1783453_1783693_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYT08602.1|1784565_1785375_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYT08603.1|1785447_1785825_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYT08604.1|1785972_1786515_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYT08605.1|1786706_1787435_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYT08606.1|1787451_1787865_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029875	Salmonella enterica subsp. enterica serovar Typhi strain 343076_227128 chromosome, complete genome	4800199	1991719	1998953	4800199		Morganella_phage(33.33%)	7	NA	NA
AYT08797.1|1991719_1993150_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYT08798.1|1993223_1993919_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYT08799.1|1993998_1994310_-	hypothetical protein	NA	NA	NA	NA	NA
AYT08800.1|1994960_1996145_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYT08801.1|1996604_1996817_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYT08802.1|1997262_1998531_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYT08803.1|1998533_1998953_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029875	Salmonella enterica subsp. enterica serovar Typhi strain 343076_227128 chromosome, complete genome	4800199	2105253	2115760	4800199		Enterobacteria_phage(37.5%)	10	NA	NA
AYT08900.1|2105253_2106567_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYT08901.1|2106593_2107673_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYT08902.1|2107677_2108451_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYT08903.1|2108466_2109441_-	reductase RfbI	NA	NA	NA	NA	NA
AYT08904.1|2109446_2109998_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYT08905.1|2109998_2110877_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYT08906.1|2110924_2111824_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYT08907.1|2111823_2112909_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYT08908.1|2113285_2114179_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYT08909.1|2114356_2115760_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029875	Salmonella enterica subsp. enterica serovar Typhi strain 343076_227128 chromosome, complete genome	4800199	2191651	2200822	4800199	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYT08968.1|2191651_2193685_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYT08969.1|2193925_2194384_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYT08970.1|2194555_2195086_+	lipoprotein	NA	NA	NA	NA	NA
AYT08971.1|2195142_2195610_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYT08972.1|2195656_2196376_-	two-component system response regulator	NA	NA	NA	NA	NA
AYT08973.1|2196372_2198058_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYT08974.1|2198280_2199012_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYT08975.1|2199071_2199179_+	hypothetical protein	NA	NA	NA	NA	NA
AYT08976.1|2199159_2199891_-	ABC transporter permease	NA	NA	NA	NA	NA
AYT08977.1|2199874_2200822_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029875	Salmonella enterica subsp. enterica serovar Typhi strain 343076_227128 chromosome, complete genome	4800199	2736036	2749428	4800199	tail	Salmonella_phage(70.0%)	11	NA	NA
AYT09406.1|2736036_2736255_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYT09407.1|2736345_2737446_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYT09408.1|2737442_2737928_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYT09409.1|2737924_2741002_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYT09410.1|2740994_2741114_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYT09411.1|2741128_2741431_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYT09412.1|2741485_2742001_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYT09413.1|2742010_2743183_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYT09414.1|2743325_2743898_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYT09415.1|2744575_2745691_+	glycosyltransferase	NA	NA	NA	NA	NA
AYT09416.1|2745771_2749428_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029875	Salmonella enterica subsp. enterica serovar Typhi strain 343076_227128 chromosome, complete genome	4800199	3066915	3110618	4800199	tRNA,transposase,protease,bacteriocin	Bacillus_virus(33.33%)	44	NA	NA
AYT09703.1|3066915_3067374_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT09704.1|3067563_3068643_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYT09705.1|3068744_3069908_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYT09706.1|3069929_3070976_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYT09707.1|3071349_3071775_+	hypothetical protein	NA	NA	NA	NA	NA
AYT09708.1|3071800_3072379_+	hypothetical protein	NA	NA	NA	NA	NA
AYT09709.1|3072412_3073087_+	hypothetical protein	NA	NA	NA	NA	NA
AYT09710.1|3073068_3073752_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYT09711.1|3073745_3074402_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYT09712.1|3074506_3074965_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT09713.1|3075153_3077145_-	transketolase	NA	NA	NA	NA	NA
AYT09714.1|3077420_3078179_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYT09715.1|3078279_3079200_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYT09716.1|3079427_3081404_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYT09717.1|3081412_3081544_-	hypothetical protein	NA	NA	NA	NA	NA
AYT09718.1|3081838_3082138_-	membrane protein	NA	NA	NA	NA	NA
AYT09719.1|3082193_3083348_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYT09720.1|3083840_3085235_+	galactose-proton symport	NA	NA	NA	NA	NA
AYT09721.1|3085313_3085811_+	hypothetical protein	NA	NA	NA	NA	NA
AYT09722.1|3085906_3086614_+	endonuclease I	NA	NA	NA	NA	NA
AYT09723.1|3086690_3087422_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYT09724.1|3087441_3088389_+	glutathione synthetase	NA	NA	NA	NA	NA
AYT09725.1|3088604_3089168_+	hypothetical protein	NA	NA	NA	NA	NA
AYT09726.1|3089167_3089584_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYT09727.1|3089630_3090317_-	global regulatory protein	NA	NA	NA	NA	NA
AYT09728.1|3090446_3091427_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYT09729.1|3091444_3092149_+	hypothetical protein	NA	NA	NA	NA	NA
AYT09730.1|3092167_3092734_+	hypothetical protein	NA	NA	NA	NA	NA
AYT09731.1|3092730_3093021_+	hypothetical protein	NA	NA	NA	NA	NA
AYT09732.1|3093028_3093622_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYT09733.1|3093614_3094751_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYT09734.1|3094841_3095849_-	hypothetical protein	NA	NA	NA	NA	NA
AYT09735.1|3095981_3097028_-	L-asparaginase	NA	NA	NA	NA	NA
AYT09736.1|3097346_3097805_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT09737.1|3097927_3098647_-	hypothetical protein	NA	NA	NA	NA	NA
AYT09738.1|3098696_3099023_-	hypothetical protein	NA	NA	NA	NA	NA
AYT09739.1|3099022_3099742_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYT09740.1|3099896_3100949_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYT09741.1|3100976_3101252_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYT09742.1|3101364_3102450_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYT09743.1|3102666_3103923_+	nucleoside permease	NA	NA	NA	NA	NA
AYT09744.1|3106533_3107241_+	hypothetical protein	NA	NA	NA	NA	NA
AYT09745.1|3109830_3110097_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYT09746.1|3110339_3110618_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029875	Salmonella enterica subsp. enterica serovar Typhi strain 343076_227128 chromosome, complete genome	4800199	3488933	3526991	4800199	transposase,capsid,portal,integrase,terminase,plate,tail	Salmonella_phage(82.05%)	46	3483897:3483911	3496063:3496077
3483897:3483911	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYT10075.1|3488933_3490580_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYT10076.1|3490719_3490818_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYT10077.1|3491073_3491403_+	hypothetical protein	NA	NA	NA	NA	NA
AYT10078.1|3491443_3492496_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYT10079.1|3492891_3493461_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYT10080.1|3493586_3493808_+	hypothetical protein	NA	NA	NA	NA	NA
AYT10081.1|3493840_3494350_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYT10082.1|3494524_3494749_+	hypothetical protein	NA	NA	NA	NA	NA
AYT10083.1|3494771_3495113_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYT10084.1|3495180_3495414_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYT10085.1|3495413_3495641_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYT10086.1|3495637_3496495_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3496063:3496077	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYT10087.1|3496491_3498906_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYT10088.1|3499059_3499248_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYT10089.1|3501215_3502130_+	hypothetical protein	NA	NA	NA	NA	NA
AYT10090.1|3502126_3502867_+	hypothetical protein	NA	NA	NA	NA	NA
AYT10091.1|3502901_3503939_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYT10092.1|3503938_3505705_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYT10093.1|3505847_3506681_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYT10094.1|3506697_3507756_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYT10095.1|3507759_3508410_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYT10096.1|3508442_3508970_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYT10097.1|3508969_3509173_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYT10098.1|3509176_3509392_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYT10099.1|3509411_3509885_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYT10100.1|3509886_3510264_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYT10101.1|3510260_3510689_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYT10102.1|3510784_3511216_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYT10103.1|3511208_3511655_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYT10104.1|3511723_3512302_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYT10105.1|3512298_3512658_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYT10106.1|3512644_3513553_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYT10107.1|3513545_3514151_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYT10108.1|3514147_3515662_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYT10109.1|3515661_3516255_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYT10110.1|3516226_3516667_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYT10111.1|3517089_3517662_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYT10112.1|3517804_3518977_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYT10113.1|3518986_3519502_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYT10114.1|3519556_3519859_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYT10115.1|3519873_3519993_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYT10116.1|3519985_3523063_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYT10117.1|3523059_3523545_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYT10118.1|3523541_3524642_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYT10119.1|3524732_3524951_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYT10120.1|3526532_3526991_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029875	Salmonella enterica subsp. enterica serovar Typhi strain 343076_227128 chromosome, complete genome	4800199	4459945	4534109	4800199	capsid,portal,integrase,tail,plate,terminase	Salmonella_phage(82.98%)	76	4521446:4521462	4534268:4534284
AYT10911.1|4459945_4461895_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYT10912.1|4461966_4462875_+	hypothetical protein	NA	NA	NA	NA	NA
AYT10913.1|4462948_4463848_+	hypothetical protein	NA	NA	NA	NA	NA
AYT10914.1|4463889_4464249_+	hypothetical protein	NA	NA	NA	NA	NA
AYT10915.1|4464348_4464618_-	hypothetical protein	NA	NA	NA	NA	NA
AYT10916.1|4464749_4466024_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYT10917.1|4466243_4466621_+	hypothetical protein	NA	NA	NA	NA	NA
AYT10918.1|4466707_4466926_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYT10919.1|4466993_4468094_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYT10920.1|4468090_4468576_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYT10921.1|4468575_4471356_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYT10922.1|4471348_4471468_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYT10923.1|4471482_4471785_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYT10924.1|4471839_4472355_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYT10925.1|4472364_4473537_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYT10926.1|4474071_4474794_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYT10927.1|4474991_4475399_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYT10928.1|4475405_4477025_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYT10929.1|4477021_4477627_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYT10930.1|4477619_4478528_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYT10931.1|4478514_4478874_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYT10932.1|4478870_4479449_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYT10933.1|4479517_4479964_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYT10934.1|4479956_4480388_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYT10935.1|4480483_4480909_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYT10936.1|4480908_4481286_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYT10937.1|4481290_4481761_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYT10938.1|4481780_4481996_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYT10939.1|4481999_4482203_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYT10940.1|4482202_4482667_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYT10941.1|4482760_4483411_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYT10942.1|4483414_4484479_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYT10943.1|4484495_4485329_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYT10944.1|4485471_4487238_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYT10945.1|4487234_4488281_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYT10946.1|4488329_4489025_-	hypothetical protein	NA	NA	NA	NA	NA
AYT10947.1|4489044_4490109_-	hypothetical protein	NA	NA	NA	NA	NA
AYT10948.1|4490105_4491170_-	hypothetical protein	NA	NA	NA	NA	NA
AYT10949.1|4492094_4492424_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYT10950.1|4492420_4494490_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYT10951.1|4494480_4495341_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYT10952.1|4495337_4495922_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYT10953.1|4495918_4496146_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYT10954.1|4496145_4496379_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYT10955.1|4496446_4496788_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYT10956.1|4496751_4496952_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYT10957.1|4496959_4497469_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYT10958.1|4497501_4497744_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYT10959.1|4497860_4498493_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYT10960.1|4498496_4499522_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYT10961.1|4499628_4499982_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYT10962.1|4500598_4500886_+	hypothetical protein	NA	NA	NA	NA	NA
AYT10963.1|4500896_4501787_+	methyltransferase	NA	NA	NA	NA	NA
AYT10964.1|4501786_4502533_+	hypothetical protein	NA	NA	NA	NA	NA
AYT10965.1|4502834_4504805_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYT10966.1|4504824_4506129_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYT10967.1|4506151_4506847_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYT10968.1|4506872_4507667_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYT10969.1|4507676_4508744_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYT10970.1|4508788_4510525_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYT10971.1|4510524_4513020_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYT10972.1|4513043_4514090_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYT10973.1|4514092_4515370_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYT10974.1|4515614_4516154_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYT10975.1|4517007_4518519_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYT10976.1|4518502_4520092_+	hypothetical protein	NA	NA	NA	NA	NA
AYT10977.1|4520255_4521269_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4521446:4521462	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYT10978.1|4521695_4521989_+	hypothetical protein	NA	NA	NA	NA	NA
AYT10979.1|4521985_4522474_+	hypothetical protein	NA	NA	NA	NA	NA
AYT10980.1|4522653_4523106_-	hypothetical protein	NA	NA	NA	NA	NA
AYT10981.1|4528328_4528790_+	hypothetical protein	NA	NA	NA	NA	NA
AYT10982.1|4528786_4529008_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYT10983.1|4529864_4530647_+	hypothetical protein	NA	NA	NA	NA	NA
AYT10984.1|4531273_4531498_-	hypothetical protein	NA	NA	NA	NA	NA
AYT10985.1|4531627_4532539_-	hypothetical protein	NA	NA	NA	NA	NA
AYT10986.1|4532849_4534109_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4534268:4534284	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029875	Salmonella enterica subsp. enterica serovar Typhi strain 343076_227128 chromosome, complete genome	4800199	4676361	4686620	4800199	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYT11123.1|4676361_4677438_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYT11124.1|4677434_4678508_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYT11125.1|4678482_4679646_-	hypothetical protein	NA	NA	NA	NA	NA
AYT11126.1|4679921_4680488_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYT11127.1|4680503_4680743_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYT11128.1|4680746_4681607_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYT11129.1|4682029_4682353_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYT11130.1|4682336_4682837_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYT11131.1|4682833_4683061_+	hypothetical protein	NA	NA	NA	NA	NA
AYT11132.1|4683057_4683378_+	P4 phage protein	NA	NA	NA	NA	NA
AYT11133.1|4683392_4684067_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYT11134.1|4684063_4685725_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYT11135.1|4686461_4686620_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029876	Salmonella enterica subsp. enterica serovar Typhi strain 343076_227128 plasmid pHCM2, complete sequence	106706	4078	74241	106706		Salmonella_phage(97.65%)	88	NA	NA
AYT11226.1|4078_4348_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AYT11227.1|4428_4746_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
AYT11228.1|4805_5552_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	96.8	7.8e-125
AYT11229.1|5626_6010_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
AYT11230.1|6011_6485_-	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
AYT11231.1|6475_6820_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
AYT11232.1|6917_7751_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	100.0	2.6e-153
AYT11233.1|7750_8185_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
AYT11234.1|8228_9152_-	hypothetical protein	NA	J9Q6D6	Salmonella_phage	100.0	3.3e-157
AYT11235.1|9226_10102_-	hypothetical protein	NA	J9Q710	Salmonella_phage	100.0	3.8e-163
AYT11236.1|10128_11025_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.6	5.7e-146
AYT11237.1|11047_12622_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	3.2e-301
AYT11238.1|12655_13912_-	hypothetical protein	NA	J9Q7Y2	Salmonella_phage	99.8	5.3e-251
AYT11239.1|13914_14556_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	99.5	1.8e-109
AYT11240.1|14751_15018_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
AYT11241.1|15027_15927_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	4.0e-168
AYT11242.1|15923_16178_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AYT11243.1|16170_16809_-	putative ABC transporter ATP-binding protein	NA	J9Q807	Salmonella_phage	99.1	5.5e-111
AYT11244.1|16805_17474_-	hypothetical protein	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
AYT11245.1|17473_18154_-	hypothetical protein	NA	J9Q756	Salmonella_phage	99.6	7.4e-122
AYT11246.1|18236_19796_+	putative helicase	NA	J9Q7I4	Salmonella_phage	99.4	5.7e-295
AYT11247.1|19798_20077_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
AYT11248.1|20136_20559_+	putative lipoprotein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
AYT11249.1|20563_21091_+	putative transcriptional regulator	NA	J9Q6L0	Salmonella_phage	96.6	4.1e-80
AYT11250.1|21725_22376_+	hypothetical protein	NA	J9Q754	Salmonella_phage	100.0	1.4e-114
AYT11251.1|22460_22688_+	hypothetical protein	NA	NA	NA	NA	NA
AYT11252.1|23319_23802_-	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	5.5e-87
AYT11253.1|24007_24295_-	hypothetical protein	NA	J9Q753	Salmonella_phage	94.6	1.5e-47
AYT11254.1|24415_24808_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	65.4	1.7e-41
AYT11255.1|24936_25248_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	92.2	1.1e-45
AYT11256.1|25324_25639_-	hypothetical protein	NA	NA	NA	NA	NA
AYT11257.1|25733_25952_-	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
AYT11258.1|25962_26178_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	95.8	4.5e-33
AYT11259.1|26320_26566_+	hypothetical protein	NA	J9Q751	Salmonella_phage	92.5	5.8e-37
AYT11260.1|28002_29193_-	hypothetical protein	NA	J9Q803	Salmonella_phage	54.6	5.4e-120
AYT11261.1|29202_29520_-	hypothetical protein	NA	J9Q750	Salmonella_phage	80.0	8.1e-47
AYT11262.1|29604_29886_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.6	3.2e-31
AYT11263.1|30059_30263_+	hypothetical protein	NA	J9Q802	Salmonella_phage	95.5	1.5e-30
AYT11264.1|30323_30611_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	58.8	9.9e-28
AYT11265.1|30607_30916_-	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	56.9	3.0e-14
AYT11266.1|30927_31470_-	hypothetical protein	NA	J9Q748	Salmonella_phage	93.1	2.6e-93
AYT11267.1|31466_32108_-	hypothetical protein	NA	J9Q7H7	Salmonella_phage	100.0	9.7e-116
AYT11268.1|32199_32571_-	hypothetical protein	NA	J9Q7T4	Salmonella_phage	100.0	3.2e-63
AYT11269.1|32681_32855_-	hypothetical protein	NA	J9Q801	Salmonella_phage	98.2	9.5e-26
AYT11270.1|32851_33541_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	98.3	6.1e-124
AYT11271.1|33599_35303_-	putative DNA modification methylase	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
AYT11272.1|35426_35999_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	8.2e-98
AYT11273.1|36107_36950_-	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
AYT11274.1|37058_37247_-	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
AYT11275.1|37256_37751_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	96.3	1.9e-79
AYT11276.1|37893_38502_-	putative ribonuclease H	NA	J9Q745	Salmonella_phage	99.5	2.2e-117
AYT11277.1|39087_39318_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
AYT11278.1|39520_40114_-	hypothetical protein	NA	J9Q7T2	Salmonella_phage	99.5	4.6e-112
AYT11279.1|40299_41226_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	85.4	4.1e-107
AYT11280.1|41270_41828_-	hypothetical protein	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
AYT11281.1|41837_42257_-	hypothetical protein	NA	J9Q743	Salmonella_phage	98.6	2.9e-68
AYT11282.1|42320_42965_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
AYT11283.1|42964_43441_-	hypothetical protein	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
AYT11284.1|43437_43851_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
AYT11285.1|43852_44968_-	putative thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.1	7.6e-217
AYT11286.1|45083_46013_-	hypothetical protein	NA	J9Q742	Salmonella_phage	99.0	3.8e-161
AYT11287.1|46095_47238_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.5	2.4e-218
AYT11288.1|47345_49661_-	ribonucleotide-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
AYT11289.1|49738_50308_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	1.7e-103
AYT11290.1|50320_51067_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.0	4.4e-136
AYT11291.1|51056_52973_-	exonuclease	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
AYT11292.1|52969_53206_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
AYT11293.1|53202_54288_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.9	2.7e-206
AYT11294.1|54714_55020_+	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	97.0	2.0e-50
AYT11295.1|55051_55546_-	hypothetical protein	NA	J9Q6J3	Salmonella_phage	97.6	2.3e-88
AYT11296.1|55621_56266_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	2.4e-122
AYT11297.1|57010_58066_+	putative replication protein A	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
AYT11298.1|58594_58798_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	4.0e-31
AYT11299.1|58797_59103_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	90.8	4.9e-33
AYT11300.1|59143_59419_-	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.9e-46
AYT11301.1|59487_59898_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.1	1.4e-75
AYT11302.1|59881_60253_-	hypothetical protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
AYT11303.1|60415_61258_-	putative lipoprotein	NA	J9Q7Z4	Salmonella_phage	97.1	2.3e-125
AYT11304.1|61553_62630_-	putative recombinase	NA	J9Q736	Salmonella_phage	99.7	5.5e-204
AYT11305.1|62632_62899_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AYT11306.1|62898_63843_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.4	6.8e-182
AYT11307.1|63903_64932_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.8	1.1e-164
AYT11308.1|65051_65483_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	100.0	4.0e-73
AYT11309.1|65728_66319_+	hypothetical protein	NA	NA	NA	NA	NA
AYT11310.1|66412_66856_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	97.9	3.0e-71
AYT11311.1|66852_70371_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.1	0.0e+00
AYT11312.1|70551_71787_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	99.5	1.8e-238
AYT11313.1|71883_74241_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	90.7	0.0e+00
>prophage 2
CP029876	Salmonella enterica subsp. enterica serovar Typhi strain 343076_227128 plasmid pHCM2, complete sequence	106706	82731	106535	106706	tail	Salmonella_phage(88.0%)	25	NA	NA
AYT11326.1|82731_83037_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
AYT11327.1|83033_83186_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	96.0	7.6e-19
AYT11328.1|83185_83392_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	8.1e-32
AYT11329.1|83557_84880_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.4	5.8e-256
AYT11330.1|84914_85172_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	92.9	4.9e-34
AYT11331.1|85472_86267_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.2	4.9e-141
AYT11332.1|86450_87503_+	hypothetical protein	NA	J9Q6F5	Salmonella_phage	56.7	1.9e-92
AYT11333.1|87504_88716_-	hypothetical protein	NA	J9Q720	Salmonella_phage	96.5	6.6e-214
AYT11334.1|88778_90119_-	putative DNA helicase	NA	J9Q7G4	Salmonella_phage	99.6	3.8e-247
AYT11335.1|90179_90905_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.3	2.4e-139
AYT11336.1|91182_92238_+	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	42.6	5.1e-61
AYT11337.1|92307_93063_-	hypothetical protein	NA	J9Q7Y9	Salmonella_phage	43.0	3.2e-57
AYT11338.1|93111_93471_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
AYT11339.1|93470_94136_-	hypothetical protein	NA	J9Q7R7	Salmonella_phage	95.0	8.0e-113
AYT11340.1|94466_95018_+	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	39.8	7.8e-29
AYT11341.1|95068_95413_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	83.6	5.9e-27
AYT11342.1|95481_96201_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	95.7	1.5e-125
AYT11343.1|96187_96511_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	2.7e-50
AYT11344.1|96625_99178_-	hypothetical protein	NA	A0A0A0YQM3	Citrobacter_virus	52.5	1.4e-152
AYT11345.1|99260_103649_-|tail	putative phage tail protein	tail	J9Q713	Salmonella_phage	86.7	0.0e+00
AYT11346.1|103663_104251_-|tail	putative phage tail protein	tail	J9Q7F8	Salmonella_phage	92.3	1.1e-102
AYT11347.1|104238_105036_-	hypothetical protein	NA	J9Q7R4	Salmonella_phage	95.8	1.2e-155
AYT11348.1|105028_105760_-|tail	putative phage tail protein	tail	J9Q7Y5	Salmonella_phage	99.1	3.3e-136
AYT11349.1|105816_106152_-	hypothetical protein	NA	J9Q6E1	Salmonella_phage	97.3	5.7e-59
AYT11350.1|106193_106535_-	hypothetical protein	NA	J9Q712	Salmonella_phage	90.3	1.7e-50
