The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029892	Salmonella enterica subsp. enterica serovar Typhi strain 343076_252143 chromosome, complete genome	4808285	930325	937637	4808285	protease,integrase	Dickeya_phage(16.67%)	6	931576:931590	942755:942769
AYT29235.1|930325_931444_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYT29236.1|931440_933387_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931576:931590	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYT29237.1|933516_933738_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYT29238.1|934061_934382_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYT29239.1|934412_936689_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYT29240.1|937259_937637_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942755:942769	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029892	Salmonella enterica subsp. enterica serovar Typhi strain 343076_252143 chromosome, complete genome	4808285	1008775	1086087	4808285	transposase,integrase,terminase,protease,tail	Salmonella_phage(73.33%)	93	990841:990860	1061448:1061467
990841:990860	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYT29290.1|1008775_1010116_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYT29291.1|1010112_1010361_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYT29292.1|1010401_1010647_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYT29293.1|1010646_1011528_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYT29294.1|1011524_1012589_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYT29295.1|1012666_1013347_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYT29296.1|1013343_1014129_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYT29297.1|1014134_1014431_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYT29298.1|1014521_1014722_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYT29299.1|1015010_1015415_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYT29300.1|1015746_1016121_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYT29301.1|1016205_1017189_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYT29302.1|1017191_1017941_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYT29303.1|1017951_1018299_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYT29304.1|1018295_1018820_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYT29305.1|1018819_1019293_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYT29306.1|1019296_1019869_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYT29307.1|1019962_1020229_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYT29308.1|1020310_1020472_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT29309.1|1020904_1021402_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT29310.1|1021586_1021826_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYT29311.1|1021815_1022121_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYT29312.1|1022160_1022763_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYT29313.1|1022971_1023583_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYT29314.1|1023715_1024513_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYT29315.1|1024911_1025037_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT29316.1|1025172_1025622_-	lipoprotein	NA	NA	NA	NA	NA
AYT29317.1|1025838_1026228_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYT29318.1|1026214_1026496_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYT29319.1|1026495_1027110_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYT29320.1|1027328_1027583_+	hypothetical protein	NA	NA	NA	NA	NA
AYT29321.1|1027687_1028065_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYT29322.1|1028128_1028389_+	hypothetical protein	NA	NA	NA	NA	NA
AYT29323.1|1028478_1029231_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYT29324.1|1029196_1030600_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYT29325.1|1030599_1032069_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYT29326.1|1032160_1032691_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYT29327.1|1032705_1033938_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYT29328.1|1033942_1034440_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYT29329.1|1034451_1035393_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYT29330.1|1035434_1035803_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYT29331.1|1035768_1036176_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYT29332.1|1036172_1036727_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYT29333.1|1036713_1037103_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYT29334.1|1037077_1037641_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYT29335.1|1037644_1038790_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYT29336.1|1038801_1039242_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYT29337.1|1039245_1039698_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYT29338.1|1039875_1041828_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYT29339.1|1041827_1042478_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYT29340.1|1042481_1042784_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYT29341.1|1042786_1043818_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYT29342.1|1043814_1044150_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYT29343.1|1044344_1045076_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT29344.1|1045075_1045504_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT29345.1|1045562_1046318_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYT29346.1|1046405_1046543_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYT29347.1|1046558_1046912_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYT29348.1|1046912_1048112_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYT29349.1|1048108_1048789_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYT29350.1|1048788_1050300_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYT29351.1|1050314_1050833_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYT29352.1|1051754_1052456_-	hypothetical protein	NA	NA	NA	NA	NA
AYT29353.1|1052768_1053047_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYT29354.1|1053472_1056085_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYT29355.1|1056292_1057303_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYT29356.1|1057465_1058011_+	hypothetical protein	NA	NA	NA	NA	NA
AYT29357.1|1058007_1059117_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYT29358.1|1059215_1061324_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYT29359.1|1061336_1063244_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061448:1061467	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYT29360.1|1063258_1064512_+	inner membrane protein	NA	NA	NA	NA	NA
AYT29361.1|1064516_1066157_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYT29362.1|1066153_1066717_+	lipoprotein	NA	NA	NA	NA	NA
AYT29363.1|1066970_1067138_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYT29364.1|1067237_1067756_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYT29365.1|1067824_1069585_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYT29366.1|1069770_1070223_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYT29367.1|1070294_1071347_-	outer membrane protein A	NA	NA	NA	NA	NA
AYT29368.1|1071701_1072211_-	cell division inhibitor	NA	NA	NA	NA	NA
AYT29369.1|1072427_1073033_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYT29370.1|1073019_1075173_-	inner membrane protein	NA	NA	NA	NA	NA
AYT29371.1|1075191_1075638_-	hypothetical protein	NA	NA	NA	NA	NA
AYT29372.1|1075761_1077816_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYT29373.1|1077851_1078310_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYT29374.1|1078404_1079067_-	hypothetical protein	NA	NA	NA	NA	NA
AYT29375.1|1079237_1079654_+	hypothetical protein	NA	NA	NA	NA	NA
AYT29376.1|1079698_1080016_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYT29377.1|1080073_1081285_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYT29378.1|1082416_1082875_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT29379.1|1083611_1083893_+	acylphosphatase	NA	NA	NA	NA	NA
AYT29380.1|1083889_1084219_-	sulfite reductase	NA	NA	NA	NA	NA
AYT29381.1|1084305_1084965_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYT29382.1|1085628_1086087_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029892	Salmonella enterica subsp. enterica serovar Typhi strain 343076_252143 chromosome, complete genome	4808285	1528905	1602503	4808285	transposase,tRNA,plate,protease,tail,head	Burkholderia_virus(44.12%)	72	NA	NA
AYT29782.1|1528905_1529364_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT29783.1|1529866_1530148_+	stress response protein	NA	NA	NA	NA	NA
AYT29784.1|1530416_1531238_+|protease	serine protease	protease	NA	NA	NA	NA
AYT29785.1|1531272_1531602_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYT29786.1|1531588_1531951_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYT29787.1|1532062_1532233_-	hypothetical protein	NA	NA	NA	NA	NA
AYT29788.1|1532367_1533402_+	hypothetical protein	NA	NA	NA	NA	NA
AYT29789.1|1533576_1534965_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYT29790.1|1534975_1536505_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYT29791.1|1537031_1537976_+	hypothetical protein	NA	NA	NA	NA	NA
AYT29792.1|1538157_1538547_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYT29793.1|1538518_1538971_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYT29794.1|1539165_1539396_-	hypothetical protein	NA	NA	NA	NA	NA
AYT29795.1|1539392_1540076_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYT29796.1|1540660_1540963_-	hypothetical protein	NA	NA	NA	NA	NA
AYT29797.1|1541533_1542064_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYT29798.1|1542363_1543530_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYT29799.1|1543540_1545310_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYT29800.1|1546754_1547105_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYT29801.1|1547819_1548470_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYT29802.1|1548792_1549104_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYT29803.1|1549103_1549649_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYT29804.1|1549645_1551241_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYT29805.1|1551240_1552737_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYT29806.1|1552717_1553539_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYT29807.1|1553541_1554000_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYT29808.1|1554214_1555330_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYT29809.1|1555344_1556298_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYT29810.1|1556307_1556646_+	hypothetical protein	NA	NA	NA	NA	NA
AYT29811.1|1556647_1557094_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYT29812.1|1557093_1557558_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYT29813.1|1557798_1559226_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYT29814.1|1559225_1559747_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYT29815.1|1559749_1560031_+	hypothetical protein	NA	NA	NA	NA	NA
AYT29816.1|1560128_1560464_+	hypothetical protein	NA	NA	NA	NA	NA
AYT29817.1|1560639_1563105_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYT29818.1|1563104_1563989_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYT29819.1|1563985_1564201_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYT29820.1|1564188_1565343_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYT29821.1|1565339_1565867_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYT29822.1|1565923_1566271_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYT29823.1|1566261_1567365_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYT29824.1|1567357_1567936_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYT29825.1|1567938_1568964_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYT29826.1|1569477_1570095_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYT29827.1|1571605_1572178_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYT29828.1|1572458_1573841_+	amino acid permease	NA	NA	NA	NA	NA
AYT29829.1|1573902_1574238_-	hypothetical protein	NA	NA	NA	NA	NA
AYT29830.1|1574364_1575096_+	two-component response regulator	NA	NA	NA	NA	NA
AYT29831.1|1575576_1576728_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYT29832.1|1576880_1578587_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYT29833.1|1578694_1579999_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYT29834.1|1580074_1581004_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYT29835.1|1581000_1582404_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYT29836.1|1582571_1584218_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYT29837.1|1584417_1585593_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYT29838.1|1585695_1587204_+	hypothetical protein	NA	NA	NA	NA	NA
AYT29839.1|1587909_1588911_+	adenosine deaminase	NA	NA	NA	NA	NA
AYT29840.1|1588984_1590100_-	oxidoreductase	NA	NA	NA	NA	NA
AYT29841.1|1590202_1590358_+	hypothetical protein	NA	NA	NA	NA	NA
AYT29842.1|1590656_1590872_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYT29843.1|1590960_1591401_+	hypothetical protein	NA	NA	NA	NA	NA
AYT29844.1|1591477_1592059_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYT29845.1|1592058_1592637_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYT29846.1|1592629_1594651_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYT29847.1|1594651_1595710_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYT29848.1|1595713_1596334_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYT29849.1|1596336_1597029_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYT29850.1|1597028_1597664_+	endonuclease III	NA	NA	NA	NA	NA
AYT29851.1|1598264_1599770_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYT29852.1|1599874_1600480_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYT29853.1|1601228_1602503_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029892	Salmonella enterica subsp. enterica serovar Typhi strain 343076_252143 chromosome, complete genome	4808285	1783540	1787952	4808285		Escherichia_phage(50.0%)	6	NA	NA
AYT30037.1|1783540_1783780_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYT30038.1|1784652_1785462_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYT30039.1|1785534_1785912_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYT30040.1|1786059_1786602_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYT30041.1|1786793_1787522_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYT30042.1|1787538_1787952_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029892	Salmonella enterica subsp. enterica serovar Typhi strain 343076_252143 chromosome, complete genome	4808285	1991806	1999040	4808285		Morganella_phage(33.33%)	7	NA	NA
AYT30233.1|1991806_1993237_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYT30234.1|1993310_1994006_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYT30235.1|1994085_1994397_-	hypothetical protein	NA	NA	NA	NA	NA
AYT30236.1|1995047_1996232_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYT30237.1|1996691_1996904_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYT30238.1|1997349_1998618_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYT30239.1|1998620_1999040_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029892	Salmonella enterica subsp. enterica serovar Typhi strain 343076_252143 chromosome, complete genome	4808285	2105340	2115847	4808285		Enterobacteria_phage(37.5%)	10	NA	NA
AYT30336.1|2105340_2106654_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYT30337.1|2106680_2107760_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYT30338.1|2107764_2108538_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYT30339.1|2108553_2109528_-	reductase RfbI	NA	NA	NA	NA	NA
AYT30340.1|2109533_2110085_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYT30341.1|2110085_2110964_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYT30342.1|2111011_2111911_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYT30343.1|2111910_2112996_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYT30344.1|2113372_2114266_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYT30345.1|2114443_2115847_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029892	Salmonella enterica subsp. enterica serovar Typhi strain 343076_252143 chromosome, complete genome	4808285	2191738	2200909	4808285	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYT30404.1|2191738_2193772_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYT30405.1|2194012_2194471_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYT30406.1|2194642_2195173_+	lipoprotein	NA	NA	NA	NA	NA
AYT30407.1|2195229_2195697_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYT30408.1|2195743_2196463_-	two-component system response regulator	NA	NA	NA	NA	NA
AYT30409.1|2196459_2198145_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYT30410.1|2198367_2199099_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYT30411.1|2199158_2199266_+	hypothetical protein	NA	NA	NA	NA	NA
AYT30412.1|2199246_2199978_-	ABC transporter permease	NA	NA	NA	NA	NA
AYT30413.1|2199961_2200909_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029892	Salmonella enterica subsp. enterica serovar Typhi strain 343076_252143 chromosome, complete genome	4808285	2736345	2749737	4808285	tail	Salmonella_phage(70.0%)	11	NA	NA
AYT30842.1|2736345_2736564_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYT30843.1|2736654_2737755_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYT30844.1|2737751_2738237_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYT30845.1|2738233_2741311_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYT30846.1|2741303_2741423_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYT30847.1|2741437_2741740_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYT30848.1|2741794_2742310_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYT30849.1|2742319_2743492_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYT30850.1|2743634_2744207_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYT30851.1|2744884_2746000_+	glycosyltransferase	NA	NA	NA	NA	NA
AYT30852.1|2746080_2749737_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029892	Salmonella enterica subsp. enterica serovar Typhi strain 343076_252143 chromosome, complete genome	4808285	3067091	3110794	4808285	transposase,protease,bacteriocin,tRNA	Bacillus_virus(33.33%)	44	NA	NA
AYT31139.1|3067091_3067550_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT31140.1|3067739_3068819_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYT31141.1|3068920_3070084_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYT31142.1|3070105_3071152_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYT31143.1|3071525_3071951_+	hypothetical protein	NA	NA	NA	NA	NA
AYT31144.1|3071976_3072555_+	hypothetical protein	NA	NA	NA	NA	NA
AYT31145.1|3072588_3073263_+	hypothetical protein	NA	NA	NA	NA	NA
AYT31146.1|3073244_3073928_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYT31147.1|3073921_3074578_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYT31148.1|3074682_3075141_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT31149.1|3075329_3077321_-	transketolase	NA	NA	NA	NA	NA
AYT31150.1|3077596_3078355_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYT31151.1|3078455_3079376_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYT31152.1|3079603_3081580_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYT31153.1|3081588_3081720_-	hypothetical protein	NA	NA	NA	NA	NA
AYT31154.1|3082014_3082314_-	membrane protein	NA	NA	NA	NA	NA
AYT31155.1|3082369_3083524_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYT31156.1|3084016_3085411_+	galactose-proton symport	NA	NA	NA	NA	NA
AYT31157.1|3085489_3085987_+	hypothetical protein	NA	NA	NA	NA	NA
AYT31158.1|3086082_3086790_+	endonuclease I	NA	NA	NA	NA	NA
AYT31159.1|3086866_3087598_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYT31160.1|3087617_3088565_+	glutathione synthetase	NA	NA	NA	NA	NA
AYT31161.1|3088780_3089344_+	hypothetical protein	NA	NA	NA	NA	NA
AYT31162.1|3089343_3089760_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYT31163.1|3089806_3090493_-	global regulatory protein	NA	NA	NA	NA	NA
AYT31164.1|3090622_3091603_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYT31165.1|3091620_3092325_+	hypothetical protein	NA	NA	NA	NA	NA
AYT31166.1|3092343_3092910_+	hypothetical protein	NA	NA	NA	NA	NA
AYT31167.1|3092906_3093197_+	hypothetical protein	NA	NA	NA	NA	NA
AYT31168.1|3093204_3093798_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYT31169.1|3093790_3094927_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYT31170.1|3095017_3096025_-	hypothetical protein	NA	NA	NA	NA	NA
AYT31171.1|3096157_3097204_-	L-asparaginase	NA	NA	NA	NA	NA
AYT31172.1|3097522_3097981_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT31173.1|3098103_3098823_-	hypothetical protein	NA	NA	NA	NA	NA
AYT31174.1|3098872_3099199_-	hypothetical protein	NA	NA	NA	NA	NA
AYT31175.1|3099198_3099918_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYT31176.1|3100072_3101125_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYT31177.1|3101152_3101428_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYT31178.1|3101540_3102626_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYT31179.1|3102842_3104099_+	nucleoside permease	NA	NA	NA	NA	NA
AYT31180.1|3106709_3107417_+	hypothetical protein	NA	NA	NA	NA	NA
AYT31181.1|3110006_3110273_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYT31182.1|3110515_3110794_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029892	Salmonella enterica subsp. enterica serovar Typhi strain 343076_252143 chromosome, complete genome	4808285	3489025	3527083	4808285	portal,transposase,capsid,integrase,terminase,plate,tail	Salmonella_phage(82.05%)	46	3483989:3484003	3496155:3496169
3483989:3484003	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYT31511.1|3489025_3490672_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYT31512.1|3490811_3490910_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYT31513.1|3491165_3491495_+	hypothetical protein	NA	NA	NA	NA	NA
AYT31514.1|3491535_3492588_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYT31515.1|3492983_3493553_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYT31516.1|3493678_3493900_+	hypothetical protein	NA	NA	NA	NA	NA
AYT31517.1|3493932_3494442_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYT31518.1|3494616_3494841_+	hypothetical protein	NA	NA	NA	NA	NA
AYT31519.1|3494863_3495205_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYT31520.1|3495272_3495506_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYT31521.1|3495505_3495733_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYT31522.1|3495729_3496587_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3496155:3496169	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYT31523.1|3496583_3498998_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYT31524.1|3499151_3499340_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYT31525.1|3501307_3502222_+	hypothetical protein	NA	NA	NA	NA	NA
AYT31526.1|3502218_3502959_+	hypothetical protein	NA	NA	NA	NA	NA
AYT31527.1|3502993_3504031_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYT31528.1|3504030_3505797_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYT31529.1|3505939_3506773_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYT31530.1|3506789_3507848_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYT31531.1|3507851_3508502_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYT31532.1|3508534_3509062_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYT31533.1|3509061_3509265_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYT31534.1|3509268_3509484_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYT31535.1|3509503_3509977_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYT31536.1|3509978_3510356_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYT31537.1|3510352_3510781_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYT31538.1|3510876_3511308_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYT31539.1|3511300_3511747_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYT31540.1|3511815_3512394_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYT31541.1|3512390_3512750_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYT31542.1|3512736_3513645_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYT31543.1|3513637_3514243_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYT31544.1|3514239_3515754_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYT31545.1|3515753_3516347_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYT31546.1|3516318_3516759_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYT31547.1|3517181_3517754_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYT31548.1|3517896_3519069_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYT31549.1|3519078_3519594_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYT31550.1|3519648_3519951_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYT31551.1|3519965_3520085_+	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYT31552.1|3520077_3523155_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYT31553.1|3523151_3523637_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYT31554.1|3523633_3524734_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYT31555.1|3524824_3525043_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYT31556.1|3526624_3527083_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029892	Salmonella enterica subsp. enterica serovar Typhi strain 343076_252143 chromosome, complete genome	4808285	3793995	3811404	4808285	transposase,integrase	Escherichia_phage(30.0%)	17	3791701:3791760	3816201:3816968
3791701:3791760	attL	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
AYT31775.1|3793995_3796962_-|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYT31776.1|3796964_3797525_-	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYT31777.1|3797650_3798214_-	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYT31778.1|3798203_3799217_-|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYT31779.1|3799248_3799848_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	31.4	3.1e-15
AYT31780.1|3800044_3800425_+	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYT31781.1|3800331_3801258_+	sulfonamide-resistant dihydropteroate synthase sul1	NA	NA	NA	NA	NA
AYT31782.1|3801491_3802214_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYT31783.1|3802246_3802513_+	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
AYT31784.1|3802695_3803556_+	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AYT31785.1|3804135_3804858_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYT31786.1|3804918_3805755_-	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYT31787.1|3805754_3806558_-	streptomycin phosphotransferase	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
AYT31788.1|3806618_3807434_-	dihydropteroate synthase	NA	NA	NA	NA	NA
AYT31789.1|3807741_3808593_-	replication protein	NA	NA	NA	NA	NA
AYT31790.1|3809348_3810071_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYT31791.1|3810099_3811404_-|integrase	integrase	integrase	NA	NA	NA	NA
3816201:3816968	attR	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACGTATCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAATGGCGGAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCGGTTGCCCGGCATCCAACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCAGTTGCCATGTTTTACGGCAGTGAGAGCAGAGATAGCGCTGATGTCCGGCGGTGCTTTTGCCGTTACGCACCACCCCGTCAGTAGCTGAACAGGAGGGACAGCTGATAGAAACAGAAGCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACC	NA	NA	NA	NA
>prophage 12
CP029892	Salmonella enterica subsp. enterica serovar Typhi strain 343076_252143 chromosome, complete genome	4808285	4468055	4542219	4808285	portal,capsid,integrase,terminase,plate,tail	Salmonella_phage(82.98%)	76	4529556:4529572	4542378:4542394
AYT32355.1|4468055_4470005_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYT32356.1|4470076_4470985_+	hypothetical protein	NA	NA	NA	NA	NA
AYT32357.1|4471058_4471958_+	hypothetical protein	NA	NA	NA	NA	NA
AYT32358.1|4471999_4472359_+	hypothetical protein	NA	NA	NA	NA	NA
AYT32359.1|4472458_4472728_-	hypothetical protein	NA	NA	NA	NA	NA
AYT32360.1|4472859_4474134_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYT32361.1|4474353_4474731_+	hypothetical protein	NA	NA	NA	NA	NA
AYT32362.1|4474817_4475036_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYT32363.1|4475103_4476204_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYT32364.1|4476200_4476686_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYT32365.1|4476685_4479466_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYT32366.1|4479458_4479578_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYT32367.1|4479592_4479895_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYT32368.1|4479949_4480465_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYT32369.1|4480474_4481647_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYT32370.1|4482181_4482904_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYT32371.1|4483101_4483509_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYT32372.1|4483515_4485135_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYT32373.1|4485131_4485737_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYT32374.1|4485729_4486638_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYT32375.1|4486624_4486984_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYT32376.1|4486980_4487559_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYT32377.1|4487627_4488074_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYT32378.1|4488066_4488498_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYT32379.1|4488593_4489019_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYT32380.1|4489018_4489396_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYT32381.1|4489400_4489871_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYT32382.1|4489890_4490106_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYT32383.1|4490109_4490313_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYT32384.1|4490312_4490777_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYT32385.1|4490870_4491521_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYT32386.1|4491524_4492589_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYT32387.1|4492605_4493439_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYT32388.1|4493581_4495348_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYT32389.1|4495344_4496391_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYT32390.1|4496439_4497135_-	hypothetical protein	NA	NA	NA	NA	NA
AYT32391.1|4497154_4498219_-	hypothetical protein	NA	NA	NA	NA	NA
AYT32392.1|4498215_4499280_-	hypothetical protein	NA	NA	NA	NA	NA
AYT32393.1|4500204_4500534_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYT32394.1|4500530_4502600_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYT32395.1|4502590_4503451_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYT32396.1|4503447_4504032_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYT32397.1|4504028_4504256_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYT32398.1|4504255_4504489_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYT32399.1|4504556_4504898_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYT32400.1|4504861_4505062_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYT32401.1|4505069_4505579_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYT32402.1|4505611_4505854_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYT32403.1|4505970_4506603_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYT32404.1|4506606_4507632_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYT32405.1|4507738_4508092_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYT32406.1|4508708_4508996_+	hypothetical protein	NA	NA	NA	NA	NA
AYT32407.1|4509006_4509897_+	methyltransferase	NA	NA	NA	NA	NA
AYT32408.1|4509896_4510643_+	hypothetical protein	NA	NA	NA	NA	NA
AYT32409.1|4510944_4512915_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYT32410.1|4512934_4514239_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYT32411.1|4514261_4514957_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYT32412.1|4514982_4515777_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYT32413.1|4515786_4516854_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYT32414.1|4516898_4518635_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYT32415.1|4518634_4521130_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYT32416.1|4521153_4522200_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYT32417.1|4522202_4523480_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYT32418.1|4523724_4524264_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYT32419.1|4525117_4526629_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYT32420.1|4526612_4528202_+	hypothetical protein	NA	NA	NA	NA	NA
AYT32421.1|4528365_4529379_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4529556:4529572	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYT32422.1|4529805_4530099_+	hypothetical protein	NA	NA	NA	NA	NA
AYT32423.1|4530095_4530584_+	hypothetical protein	NA	NA	NA	NA	NA
AYT32424.1|4530763_4531216_-	hypothetical protein	NA	NA	NA	NA	NA
AYT32425.1|4536438_4536900_+	hypothetical protein	NA	NA	NA	NA	NA
AYT32426.1|4536896_4537118_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYT32427.1|4537974_4538757_+	hypothetical protein	NA	NA	NA	NA	NA
AYT32428.1|4539383_4539608_-	hypothetical protein	NA	NA	NA	NA	NA
AYT32429.1|4539737_4540649_-	hypothetical protein	NA	NA	NA	NA	NA
AYT32430.1|4540959_4542219_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4542378:4542394	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 13
CP029892	Salmonella enterica subsp. enterica serovar Typhi strain 343076_252143 chromosome, complete genome	4808285	4684471	4694730	4808285	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYT32567.1|4684471_4685548_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYT32568.1|4685544_4686618_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYT32569.1|4686592_4687756_-	hypothetical protein	NA	NA	NA	NA	NA
AYT32570.1|4688031_4688598_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYT32571.1|4688613_4688853_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYT32572.1|4688856_4689717_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYT32573.1|4690139_4690463_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYT32574.1|4690446_4690947_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYT32575.1|4690943_4691171_+	hypothetical protein	NA	NA	NA	NA	NA
AYT32576.1|4691167_4691488_+	P4 phage protein	NA	NA	NA	NA	NA
AYT32577.1|4691502_4692177_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYT32578.1|4692173_4693835_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYT32579.1|4694571_4694730_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029893	Salmonella enterica subsp. enterica serovar Typhi strain 343076_252143 plasmid pHCM2, complete sequence	106706	961	82648	106706	tail	Salmonella_phage(97.8%)	94	NA	NA
AYT32670.1|961_5350_-|tail	putative phage tail protein	tail	J9Q713	Salmonella_phage	86.7	0.0e+00
AYT32671.1|5364_5952_-|tail	putative phage tail protein	tail	J9Q7F8	Salmonella_phage	92.3	1.1e-102
AYT32672.1|5939_6737_-	hypothetical protein	NA	J9Q7R4	Salmonella_phage	95.8	1.2e-155
AYT32673.1|6729_7461_-|tail	putative phage tail protein	tail	J9Q7Y5	Salmonella_phage	99.1	3.3e-136
AYT32674.1|7517_7853_-	hypothetical protein	NA	J9Q6E1	Salmonella_phage	97.3	5.7e-59
AYT32675.1|7894_12478_-	hypothetical protein	NA	J9Q712	Salmonella_phage	92.9	0.0e+00
AYT32676.1|12485_12755_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AYT32677.1|12835_13153_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
AYT32678.1|13212_13959_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	96.8	7.8e-125
AYT32679.1|14033_14417_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
AYT32680.1|14418_14892_-	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
AYT32681.1|14882_15227_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
AYT32682.1|15324_16158_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	100.0	2.6e-153
AYT32683.1|16157_16592_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
AYT32684.1|16635_17559_-	hypothetical protein	NA	J9Q6D6	Salmonella_phage	100.0	3.3e-157
AYT32685.1|17633_18509_-	hypothetical protein	NA	J9Q710	Salmonella_phage	100.0	3.8e-163
AYT32686.1|18535_19432_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.6	5.7e-146
AYT32687.1|19454_21029_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	3.2e-301
AYT32688.1|21062_22319_-	hypothetical protein	NA	J9Q7Y2	Salmonella_phage	99.8	5.3e-251
AYT32689.1|22321_22963_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	99.5	1.8e-109
AYT32690.1|23158_23425_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
AYT32691.1|23434_24334_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	4.0e-168
AYT32692.1|24330_24585_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AYT32693.1|24577_25216_-	putative ABC transporter ATP-binding protein	NA	J9Q807	Salmonella_phage	99.1	5.5e-111
AYT32694.1|25212_25881_-	hypothetical protein	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
AYT32695.1|25880_26561_-	hypothetical protein	NA	J9Q756	Salmonella_phage	99.6	7.4e-122
AYT32696.1|26643_28203_+	putative helicase	NA	J9Q7I4	Salmonella_phage	99.4	5.7e-295
AYT32697.1|28205_28484_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
AYT32698.1|28543_28966_+	putative lipoprotein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
AYT32699.1|28970_29498_+	putative transcriptional regulator	NA	J9Q6L0	Salmonella_phage	96.6	4.1e-80
AYT32700.1|30132_30783_+	hypothetical protein	NA	J9Q754	Salmonella_phage	100.0	1.4e-114
AYT32701.1|30867_31095_+	hypothetical protein	NA	NA	NA	NA	NA
AYT32702.1|31726_32209_-	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	5.5e-87
AYT32703.1|32414_32702_-	hypothetical protein	NA	J9Q753	Salmonella_phage	94.6	1.5e-47
AYT32704.1|32822_33215_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	65.4	1.7e-41
AYT32705.1|33343_33655_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	92.2	1.1e-45
AYT32706.1|33731_34046_-	hypothetical protein	NA	NA	NA	NA	NA
AYT32707.1|34140_34359_-	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
AYT32708.1|34369_34585_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	95.8	4.5e-33
AYT32709.1|34727_34973_+	hypothetical protein	NA	J9Q751	Salmonella_phage	92.5	5.8e-37
AYT32710.1|36409_37600_-	hypothetical protein	NA	J9Q803	Salmonella_phage	54.6	5.4e-120
AYT32711.1|37609_37927_-	hypothetical protein	NA	J9Q750	Salmonella_phage	80.0	8.1e-47
AYT32712.1|38011_38293_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.6	3.2e-31
AYT32713.1|38466_38670_+	hypothetical protein	NA	J9Q802	Salmonella_phage	95.5	1.5e-30
AYT32714.1|38730_39018_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	58.8	9.9e-28
AYT32715.1|39014_39323_-	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	56.9	3.0e-14
AYT32716.1|39334_39877_-	hypothetical protein	NA	J9Q748	Salmonella_phage	93.1	2.6e-93
AYT32717.1|39873_40515_-	hypothetical protein	NA	J9Q7H7	Salmonella_phage	100.0	9.7e-116
AYT32718.1|40606_40978_-	hypothetical protein	NA	J9Q7T4	Salmonella_phage	100.0	3.2e-63
AYT32719.1|41088_41262_-	hypothetical protein	NA	J9Q801	Salmonella_phage	98.2	9.5e-26
AYT32720.1|41258_41948_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	98.3	6.1e-124
AYT32721.1|42006_43710_-	putative DNA modification methylase	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
AYT32722.1|43833_44406_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	8.2e-98
AYT32723.1|44514_45357_-	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
AYT32724.1|45465_45654_-	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
AYT32725.1|45663_46158_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	96.3	1.9e-79
AYT32726.1|46300_46909_-	putative ribonuclease H	NA	J9Q745	Salmonella_phage	99.5	2.2e-117
AYT32727.1|47494_47725_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
AYT32728.1|47927_48521_-	hypothetical protein	NA	J9Q7T2	Salmonella_phage	99.5	4.6e-112
AYT32729.1|48706_49633_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	85.4	4.1e-107
AYT32730.1|49677_50235_-	hypothetical protein	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
AYT32731.1|50244_50664_-	hypothetical protein	NA	J9Q743	Salmonella_phage	98.6	2.9e-68
AYT32732.1|50727_51372_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
AYT32733.1|51371_51848_-	hypothetical protein	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
AYT32734.1|51844_52258_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
AYT32735.1|52259_53375_-	putative thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.1	7.6e-217
AYT32736.1|53490_54420_-	hypothetical protein	NA	J9Q742	Salmonella_phage	99.0	3.8e-161
AYT32737.1|54502_55645_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.5	2.4e-218
AYT32738.1|55752_58068_-	ribonucleotide-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
AYT32739.1|58145_58715_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	1.7e-103
AYT32740.1|58727_59474_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.0	4.4e-136
AYT32741.1|59463_61380_-	exonuclease	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
AYT32742.1|61376_61613_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
AYT32743.1|61609_62695_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.9	2.7e-206
AYT32744.1|63121_63427_+	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	97.0	2.0e-50
AYT32745.1|63458_63953_-	hypothetical protein	NA	J9Q6J3	Salmonella_phage	97.6	2.3e-88
AYT32746.1|64028_64673_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	2.4e-122
AYT32747.1|65417_66473_+	putative replication protein A	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
AYT32748.1|67001_67205_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	4.0e-31
AYT32749.1|67204_67510_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	90.8	4.9e-33
AYT32750.1|67550_67826_-	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.9e-46
AYT32751.1|67894_68305_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.1	1.4e-75
AYT32752.1|68288_68660_-	hypothetical protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
AYT32753.1|68822_69665_-	putative lipoprotein	NA	J9Q7Z4	Salmonella_phage	97.1	2.3e-125
AYT32754.1|69960_71037_-	putative recombinase	NA	J9Q736	Salmonella_phage	99.7	5.5e-204
AYT32755.1|71039_71306_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AYT32756.1|71305_72250_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.4	6.8e-182
AYT32757.1|72310_73339_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.8	1.1e-164
AYT32758.1|73458_73890_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	100.0	4.0e-73
AYT32759.1|74135_74726_+	hypothetical protein	NA	NA	NA	NA	NA
AYT32760.1|74819_75263_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	97.9	3.0e-71
AYT32761.1|75259_78778_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.1	0.0e+00
AYT32762.1|78958_80194_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	99.5	1.8e-238
AYT32763.1|80290_82648_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	90.7	0.0e+00
>prophage 2
CP029893	Salmonella enterica subsp. enterica serovar Typhi strain 343076_252143 plasmid pHCM2, complete sequence	106706	91138	105545	106706		Salmonella_phage(89.47%)	19	NA	NA
AYT32776.1|91138_91444_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
AYT32777.1|91440_91593_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	96.0	7.6e-19
AYT32778.1|91592_91799_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	8.1e-32
AYT32779.1|91964_93287_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.4	5.8e-256
AYT32780.1|93321_93579_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	92.9	4.9e-34
AYT32781.1|93879_94674_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.2	4.9e-141
AYT32782.1|94857_95910_+	hypothetical protein	NA	J9Q6F5	Salmonella_phage	56.7	1.9e-92
AYT32783.1|95911_97123_-	hypothetical protein	NA	J9Q720	Salmonella_phage	96.5	6.6e-214
AYT32784.1|97185_98526_-	putative DNA helicase	NA	J9Q7G4	Salmonella_phage	99.6	3.8e-247
AYT32785.1|98586_99312_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.3	2.4e-139
AYT32786.1|99589_100645_+	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	42.6	5.1e-61
AYT32787.1|100714_101470_-	hypothetical protein	NA	J9Q7Y9	Salmonella_phage	43.0	3.2e-57
AYT32788.1|101518_101878_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
AYT32789.1|101877_102543_-	hypothetical protein	NA	J9Q7R7	Salmonella_phage	95.0	8.0e-113
AYT32790.1|102873_103425_+	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	39.8	7.8e-29
AYT32791.1|103475_103820_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	83.6	5.9e-27
AYT32792.1|103888_104608_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	95.7	1.5e-125
AYT32793.1|104594_104918_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	96.3	6.1e-50
AYT32794.1|105032_105545_-	hypothetical protein	NA	A0A249Y265	Salmonella_phage	53.9	3.0e-43
