The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029888	Salmonella enterica subsp. enterica serovar Typhi strain 343076_294172 chromosome, complete genome	4809171	930227	937539	4809171	integrase,protease	Dickeya_phage(16.67%)	6	931478:931492	942657:942671
AYT42190.1|930227_931346_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYT42191.1|931342_933289_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931478:931492	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYT42192.1|933418_933640_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYT42193.1|933963_934284_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYT42194.1|934314_936591_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYT42195.1|937161_937539_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942657:942671	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029888	Salmonella enterica subsp. enterica serovar Typhi strain 343076_294172 chromosome, complete genome	4809171	1008677	1085989	4809171	tail,terminase,protease,integrase,transposase	Salmonella_phage(73.33%)	93	990743:990762	1061350:1061369
990743:990762	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYT42245.1|1008677_1010018_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYT42246.1|1010014_1010263_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYT42247.1|1010303_1010549_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYT42248.1|1010548_1011430_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYT42249.1|1011426_1012491_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYT42250.1|1012568_1013249_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYT42251.1|1013245_1014031_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYT42252.1|1014036_1014333_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYT42253.1|1014423_1014624_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYT42254.1|1014912_1015317_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYT42255.1|1015648_1016023_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYT42256.1|1016107_1017091_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYT42257.1|1017093_1017843_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYT42258.1|1017853_1018201_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYT42259.1|1018197_1018722_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYT42260.1|1018721_1019195_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYT42261.1|1019198_1019771_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYT42262.1|1019864_1020131_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYT42263.1|1020212_1020374_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT42264.1|1020806_1021304_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT42265.1|1021488_1021728_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYT42266.1|1021717_1022023_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYT42267.1|1022062_1022665_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYT42268.1|1022873_1023485_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYT42269.1|1023617_1024415_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYT42270.1|1024813_1024939_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT42271.1|1025074_1025524_-	lipoprotein	NA	NA	NA	NA	NA
AYT42272.1|1025740_1026130_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYT42273.1|1026116_1026398_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYT42274.1|1026397_1027012_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYT42275.1|1027230_1027485_+	hypothetical protein	NA	NA	NA	NA	NA
AYT42276.1|1027589_1027967_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYT42277.1|1028030_1028291_+	hypothetical protein	NA	NA	NA	NA	NA
AYT42278.1|1028380_1029133_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYT42279.1|1029098_1030502_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYT42280.1|1030501_1031971_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYT42281.1|1032062_1032593_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYT42282.1|1032607_1033840_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYT42283.1|1033844_1034342_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYT42284.1|1034353_1035295_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYT42285.1|1035336_1035705_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYT42286.1|1035670_1036078_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYT42287.1|1036074_1036629_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYT42288.1|1036615_1037005_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYT42289.1|1036979_1037543_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYT42290.1|1037546_1038692_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYT42291.1|1038703_1039144_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYT42292.1|1039147_1039600_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYT42293.1|1039777_1041730_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYT42294.1|1041729_1042380_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYT42295.1|1042383_1042686_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYT42296.1|1042688_1043720_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYT42297.1|1043716_1044052_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYT42298.1|1044246_1044978_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT42299.1|1044977_1045406_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT42300.1|1045464_1046220_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYT42301.1|1046307_1046445_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYT42302.1|1046460_1046814_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYT42303.1|1046814_1048014_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYT42304.1|1048010_1048691_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYT42305.1|1048690_1050202_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYT42306.1|1050216_1050735_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYT42307.1|1051656_1052358_-	hypothetical protein	NA	NA	NA	NA	NA
AYT42308.1|1052670_1052949_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYT42309.1|1053374_1055987_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYT42310.1|1056194_1057205_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYT42311.1|1057367_1057913_+	hypothetical protein	NA	NA	NA	NA	NA
AYT42312.1|1057909_1059019_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYT42313.1|1059117_1061226_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYT42314.1|1061238_1063146_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061350:1061369	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYT42315.1|1063160_1064414_+	inner membrane protein	NA	NA	NA	NA	NA
AYT42316.1|1064418_1066059_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYT42317.1|1066055_1066619_+	lipoprotein	NA	NA	NA	NA	NA
AYT42318.1|1066872_1067040_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYT42319.1|1067139_1067658_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYT42320.1|1067726_1069487_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYT42321.1|1069672_1070125_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYT42322.1|1070196_1071249_-	outer membrane protein A	NA	NA	NA	NA	NA
AYT42323.1|1071603_1072113_-	cell division inhibitor	NA	NA	NA	NA	NA
AYT42324.1|1072329_1072935_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYT42325.1|1072921_1075075_-	inner membrane protein	NA	NA	NA	NA	NA
AYT42326.1|1075093_1075540_-	hypothetical protein	NA	NA	NA	NA	NA
AYT42327.1|1075663_1077718_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYT42328.1|1077753_1078212_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYT42329.1|1078306_1078969_-	hypothetical protein	NA	NA	NA	NA	NA
AYT42330.1|1079139_1079556_+	hypothetical protein	NA	NA	NA	NA	NA
AYT42331.1|1079600_1079918_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYT42332.1|1079975_1081187_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYT42333.1|1082318_1082777_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT42334.1|1083513_1083795_+	acylphosphatase	NA	NA	NA	NA	NA
AYT42335.1|1083791_1084121_-	sulfite reductase	NA	NA	NA	NA	NA
AYT42336.1|1084207_1084867_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYT42337.1|1085530_1085989_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029888	Salmonella enterica subsp. enterica serovar Typhi strain 343076_294172 chromosome, complete genome	4809171	1528806	1602888	4809171	tRNA,tail,plate,head,protease,transposase	Burkholderia_virus(43.24%)	80	NA	NA
AYT42736.1|1528806_1529265_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT42737.1|1529767_1530049_+	stress response protein	NA	NA	NA	NA	NA
AYT42738.1|1530317_1531139_+|protease	serine protease	protease	NA	NA	NA	NA
AYT42739.1|1531173_1531503_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYT42740.1|1531489_1531852_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYT42741.1|1531963_1532134_-	hypothetical protein	NA	NA	NA	NA	NA
AYT42742.1|1532268_1533303_+	hypothetical protein	NA	NA	NA	NA	NA
AYT42743.1|1533477_1534866_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYT42744.1|1534876_1536406_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYT42745.1|1536932_1537877_+	hypothetical protein	NA	NA	NA	NA	NA
AYT42746.1|1538058_1538448_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYT42747.1|1538419_1538872_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYT42748.1|1539066_1539297_-	hypothetical protein	NA	NA	NA	NA	NA
AYT42749.1|1539293_1539977_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYT42750.1|1539973_1540189_-	hypothetical protein	NA	NA	NA	NA	NA
AYT42751.1|1540181_1540565_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYT42752.1|1540561_1540864_-	hypothetical protein	NA	NA	NA	NA	NA
AYT42753.1|1540873_1541146_-	hypothetical protein	NA	NA	NA	NA	NA
AYT42754.1|1541434_1541965_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYT42755.1|1541992_1542262_-	hypothetical protein	NA	NA	NA	NA	NA
AYT42756.1|1542264_1543431_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYT42757.1|1543441_1545211_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYT42758.1|1545388_1545820_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYT42759.1|1545815_1546412_+	hypothetical protein	NA	NA	NA	NA	NA
AYT42760.1|1546655_1547006_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYT42761.1|1547720_1548371_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYT42762.1|1548367_1548694_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYT42763.1|1548693_1549005_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYT42764.1|1549004_1549550_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYT42765.1|1549546_1551142_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYT42766.1|1551141_1552638_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYT42767.1|1552618_1553440_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYT42768.1|1553442_1553901_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYT42769.1|1554115_1555231_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYT42770.1|1555245_1556199_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYT42771.1|1556208_1556547_+	hypothetical protein	NA	NA	NA	NA	NA
AYT42772.1|1556548_1556995_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYT42773.1|1556994_1557459_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYT42774.1|1557455_1557710_+	hypothetical protein	NA	NA	NA	NA	NA
AYT42775.1|1557699_1559127_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYT42776.1|1559126_1559648_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYT42777.1|1559650_1559932_+	hypothetical protein	NA	NA	NA	NA	NA
AYT42778.1|1560029_1560365_+	hypothetical protein	NA	NA	NA	NA	NA
AYT42779.1|1560540_1563006_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYT42780.1|1563005_1563890_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYT42781.1|1563886_1564102_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYT42782.1|1564089_1565244_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYT42783.1|1565240_1565768_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYT42784.1|1565824_1566172_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYT42785.1|1566162_1567266_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYT42786.1|1567258_1567837_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYT42787.1|1567839_1568865_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYT42788.1|1569378_1569996_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYT42789.1|1571990_1572563_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYT42790.1|1572843_1574226_+	amino acid permease	NA	NA	NA	NA	NA
AYT42791.1|1574287_1574623_-	hypothetical protein	NA	NA	NA	NA	NA
AYT42792.1|1574749_1575481_+	two-component response regulator	NA	NA	NA	NA	NA
AYT42793.1|1575961_1577113_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYT42794.1|1577265_1578972_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYT42795.1|1579079_1580384_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYT42796.1|1580459_1581389_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYT42797.1|1581385_1582789_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYT42798.1|1582956_1584603_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYT42799.1|1584802_1585978_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYT42800.1|1586080_1587589_+	hypothetical protein	NA	NA	NA	NA	NA
AYT42801.1|1588294_1589296_+	adenosine deaminase	NA	NA	NA	NA	NA
AYT42802.1|1589369_1590485_-	oxidoreductase	NA	NA	NA	NA	NA
AYT42803.1|1590587_1590743_+	hypothetical protein	NA	NA	NA	NA	NA
AYT42804.1|1591041_1591257_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYT42805.1|1591345_1591786_+	hypothetical protein	NA	NA	NA	NA	NA
AYT42806.1|1591862_1592444_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYT42807.1|1592443_1593022_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYT42808.1|1593014_1595036_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYT42809.1|1595036_1596095_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYT42810.1|1596098_1596719_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYT42811.1|1596721_1597414_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYT42812.1|1597413_1598049_+	endonuclease III	NA	NA	NA	NA	NA
AYT42813.1|1598649_1600155_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYT42814.1|1600259_1600865_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYT42815.1|1601613_1602888_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029888	Salmonella enterica subsp. enterica serovar Typhi strain 343076_294172 chromosome, complete genome	4809171	1783925	1788337	4809171		Escherichia_phage(50.0%)	6	NA	NA
AYT42999.1|1783925_1784165_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYT43000.1|1785037_1785847_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYT43001.1|1785919_1786297_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYT43002.1|1786444_1786987_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYT43003.1|1787178_1787907_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYT43004.1|1787923_1788337_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029888	Salmonella enterica subsp. enterica serovar Typhi strain 343076_294172 chromosome, complete genome	4809171	1992191	1999425	4809171		Morganella_phage(33.33%)	7	NA	NA
AYT43195.1|1992191_1993622_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYT43196.1|1993695_1994391_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYT43197.1|1994470_1994782_-	hypothetical protein	NA	NA	NA	NA	NA
AYT43198.1|1995432_1996617_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYT43199.1|1997076_1997289_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYT43200.1|1997734_1999003_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYT43201.1|1999005_1999425_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029888	Salmonella enterica subsp. enterica serovar Typhi strain 343076_294172 chromosome, complete genome	4809171	2105725	2116232	4809171		Enterobacteria_phage(37.5%)	10	NA	NA
AYT43298.1|2105725_2107039_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYT43299.1|2107065_2108145_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYT43300.1|2108149_2108923_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYT43301.1|2108938_2109913_-	reductase RfbI	NA	NA	NA	NA	NA
AYT43302.1|2109918_2110470_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYT43303.1|2110470_2111349_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYT43304.1|2111396_2112296_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYT43305.1|2112295_2113381_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYT43306.1|2113757_2114651_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYT43307.1|2114828_2116232_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029888	Salmonella enterica subsp. enterica serovar Typhi strain 343076_294172 chromosome, complete genome	4809171	2192123	2201294	4809171	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYT43366.1|2192123_2194157_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYT43367.1|2194397_2194856_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYT43368.1|2195027_2195558_+	lipoprotein	NA	NA	NA	NA	NA
AYT43369.1|2195614_2196082_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYT43370.1|2196128_2196848_-	two-component system response regulator	NA	NA	NA	NA	NA
AYT43371.1|2196844_2198530_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYT43372.1|2198752_2199484_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYT43373.1|2199543_2199651_+	hypothetical protein	NA	NA	NA	NA	NA
AYT43374.1|2199631_2200363_-	ABC transporter permease	NA	NA	NA	NA	NA
AYT43375.1|2200346_2201294_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029888	Salmonella enterica subsp. enterica serovar Typhi strain 343076_294172 chromosome, complete genome	4809171	2736731	2750123	4809171	tail	Salmonella_phage(70.0%)	11	NA	NA
AYT43804.1|2736731_2736950_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYT43805.1|2737040_2738141_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYT43806.1|2738137_2738623_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYT43807.1|2738619_2741697_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYT43808.1|2741689_2741809_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYT43809.1|2741823_2742126_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYT43810.1|2742180_2742696_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYT43811.1|2742705_2743878_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYT43812.1|2744020_2744593_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYT43813.1|2745270_2746386_+	glycosyltransferase	NA	NA	NA	NA	NA
AYT43814.1|2746466_2750123_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029888	Salmonella enterica subsp. enterica serovar Typhi strain 343076_294172 chromosome, complete genome	4809171	3067757	3111460	4809171	tRNA,transposase,bacteriocin,protease	Bacillus_virus(33.33%)	44	NA	NA
AYT44101.1|3067757_3068216_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT44102.1|3068405_3069485_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYT44103.1|3069586_3070750_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYT44104.1|3070771_3071818_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYT44105.1|3072191_3072617_+	hypothetical protein	NA	NA	NA	NA	NA
AYT44106.1|3072642_3073221_+	hypothetical protein	NA	NA	NA	NA	NA
AYT44107.1|3073254_3073929_+	hypothetical protein	NA	NA	NA	NA	NA
AYT44108.1|3073910_3074594_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYT44109.1|3074587_3075244_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYT44110.1|3075348_3075807_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT44111.1|3075995_3077987_-	transketolase	NA	NA	NA	NA	NA
AYT44112.1|3078262_3079021_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYT44113.1|3079121_3080042_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYT44114.1|3080269_3082246_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYT44115.1|3082254_3082386_-	hypothetical protein	NA	NA	NA	NA	NA
AYT44116.1|3082680_3082980_-	membrane protein	NA	NA	NA	NA	NA
AYT44117.1|3083035_3084190_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYT44118.1|3084682_3086077_+	galactose-proton symport	NA	NA	NA	NA	NA
AYT44119.1|3086155_3086653_+	hypothetical protein	NA	NA	NA	NA	NA
AYT44120.1|3086748_3087456_+	endonuclease I	NA	NA	NA	NA	NA
AYT44121.1|3087532_3088264_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYT44122.1|3088283_3089231_+	glutathione synthetase	NA	NA	NA	NA	NA
AYT44123.1|3089446_3090010_+	hypothetical protein	NA	NA	NA	NA	NA
AYT44124.1|3090009_3090426_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYT44125.1|3090472_3091159_-	global regulatory protein	NA	NA	NA	NA	NA
AYT44126.1|3091288_3092269_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYT44127.1|3092286_3092991_+	hypothetical protein	NA	NA	NA	NA	NA
AYT44128.1|3093009_3093576_+	hypothetical protein	NA	NA	NA	NA	NA
AYT44129.1|3093572_3093863_+	hypothetical protein	NA	NA	NA	NA	NA
AYT44130.1|3093870_3094464_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYT44131.1|3094456_3095593_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYT44132.1|3095683_3096691_-	hypothetical protein	NA	NA	NA	NA	NA
AYT44133.1|3096823_3097870_-	L-asparaginase	NA	NA	NA	NA	NA
AYT44134.1|3098188_3098647_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT44135.1|3098769_3099489_-	hypothetical protein	NA	NA	NA	NA	NA
AYT44136.1|3099538_3099865_-	hypothetical protein	NA	NA	NA	NA	NA
AYT44137.1|3099864_3100584_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYT44138.1|3100738_3101791_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYT44139.1|3101818_3102094_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYT44140.1|3102206_3103292_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYT44141.1|3103508_3104765_+	nucleoside permease	NA	NA	NA	NA	NA
AYT44142.1|3107375_3108083_+	hypothetical protein	NA	NA	NA	NA	NA
AYT44143.1|3110672_3110939_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYT44144.1|3111181_3111460_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029888	Salmonella enterica subsp. enterica serovar Typhi strain 343076_294172 chromosome, complete genome	4809171	3489775	3527833	4809171	tail,terminase,plate,portal,capsid,integrase,transposase	Salmonella_phage(82.05%)	46	3484739:3484753	3496905:3496919
3484739:3484753	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYT44473.1|3489775_3491422_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYT44474.1|3491561_3491660_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYT44475.1|3491915_3492245_+	hypothetical protein	NA	NA	NA	NA	NA
AYT44476.1|3492285_3493338_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYT44477.1|3493733_3494303_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYT44478.1|3494428_3494650_+	hypothetical protein	NA	NA	NA	NA	NA
AYT44479.1|3494682_3495192_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYT44480.1|3495366_3495591_+	hypothetical protein	NA	NA	NA	NA	NA
AYT44481.1|3495613_3495955_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYT44482.1|3496022_3496256_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYT44483.1|3496255_3496483_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYT44484.1|3496479_3497337_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3496905:3496919	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYT44485.1|3497333_3499748_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYT44486.1|3499901_3500090_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYT44487.1|3502057_3502972_+	hypothetical protein	NA	NA	NA	NA	NA
AYT44488.1|3502968_3503709_+	hypothetical protein	NA	NA	NA	NA	NA
AYT44489.1|3503743_3504781_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYT44490.1|3504780_3506547_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYT44491.1|3506689_3507523_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYT44492.1|3507539_3508598_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYT44493.1|3508601_3509252_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYT44494.1|3509284_3509812_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYT44495.1|3509811_3510015_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYT44496.1|3510018_3510234_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYT44497.1|3510253_3510727_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYT44498.1|3510728_3511106_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYT44499.1|3511102_3511531_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYT44500.1|3511626_3512058_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYT44501.1|3512050_3512497_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYT44502.1|3512565_3513144_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYT44503.1|3513140_3513500_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYT44504.1|3513486_3514395_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYT44505.1|3514387_3514993_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYT44506.1|3514989_3516504_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYT44507.1|3516503_3517097_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYT44508.1|3517068_3517509_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYT44509.1|3517931_3518504_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYT44510.1|3518646_3519819_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYT44511.1|3519828_3520344_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYT44512.1|3520398_3520701_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYT44513.1|3520715_3520835_+	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYT44514.1|3520827_3523905_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYT44515.1|3523901_3524387_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYT44516.1|3524383_3525484_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYT44517.1|3525574_3525793_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYT44518.1|3527374_3527833_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029888	Salmonella enterica subsp. enterica serovar Typhi strain 343076_294172 chromosome, complete genome	4809171	3794584	3811993	4809171	transposase,integrase	Escherichia_phage(30.0%)	17	3792290:3792349	3816790:3817557
3792290:3792349	attL	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
AYT44737.1|3794584_3797551_-|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYT44738.1|3797553_3798114_-	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYT44739.1|3798239_3798803_-	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYT44740.1|3798792_3799806_-|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYT44741.1|3799837_3800437_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	31.4	3.1e-15
AYT44742.1|3800633_3801014_+	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYT44743.1|3800920_3801847_+	sulfonamide-resistant dihydropteroate synthase sul1	NA	NA	NA	NA	NA
AYT44744.1|3802080_3802803_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYT44745.1|3802835_3803102_+	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
AYT44746.1|3803284_3804145_+	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AYT44747.1|3804724_3805447_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYT44748.1|3805507_3806344_-	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYT44749.1|3806343_3807147_-	streptomycin phosphotransferase	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
AYT44750.1|3807207_3808023_-	dihydropteroate synthase	NA	NA	NA	NA	NA
AYT44751.1|3808330_3809182_-	replication protein	NA	NA	NA	NA	NA
AYT44752.1|3809937_3810660_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYT44753.1|3810688_3811993_-|integrase	integrase	integrase	NA	NA	NA	NA
3816790:3817557	attR	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACGTATCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAATGGCGGAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCGGTTGCCCGGCATCCAACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCAGTTGCCATGTTTTACGGCAGTGAGAGCAGAGATAGCGCTGATGTCCGGCGGTGCTTTTGCCGTTACGCACCACCCCGTCAGTAGCTGAACAGGAGGGACAGCTGATAGAAACAGAAGCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACC	NA	NA	NA	NA
>prophage 12
CP029888	Salmonella enterica subsp. enterica serovar Typhi strain 343076_294172 chromosome, complete genome	4809171	4468644	4543087	4809171	tail,terminase,plate,portal,capsid,integrase	Salmonella_phage(82.98%)	76	4530145:4530161	4543246:4543262
AYT45317.1|4468644_4470594_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYT45318.1|4470665_4471574_+	hypothetical protein	NA	NA	NA	NA	NA
AYT45319.1|4471647_4472547_+	hypothetical protein	NA	NA	NA	NA	NA
AYT45320.1|4472588_4472948_+	hypothetical protein	NA	NA	NA	NA	NA
AYT45321.1|4473047_4473317_-	hypothetical protein	NA	NA	NA	NA	NA
AYT45322.1|4473448_4474723_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYT45323.1|4474942_4475320_+	hypothetical protein	NA	NA	NA	NA	NA
AYT45324.1|4475406_4475625_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYT45325.1|4475692_4476793_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYT45326.1|4476789_4477275_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYT45327.1|4477274_4480055_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYT45328.1|4480047_4480167_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYT45329.1|4480181_4480484_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYT45330.1|4480538_4481054_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYT45331.1|4481063_4482236_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYT45332.1|4482770_4483493_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYT45333.1|4483690_4484098_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYT45334.1|4484104_4485724_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYT45335.1|4485720_4486326_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYT45336.1|4486318_4487227_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYT45337.1|4487213_4487573_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYT45338.1|4487569_4488148_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYT45339.1|4488216_4488663_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYT45340.1|4488655_4489087_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYT45341.1|4489182_4489608_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYT45342.1|4489607_4489985_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYT45343.1|4489989_4490460_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYT45344.1|4490479_4490695_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYT45345.1|4490698_4490902_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYT45346.1|4490901_4491366_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYT45347.1|4491459_4492110_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYT45348.1|4492113_4493178_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYT45349.1|4493194_4494028_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYT45350.1|4494170_4495937_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYT45351.1|4495933_4496980_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYT45352.1|4497028_4497724_-	hypothetical protein	NA	NA	NA	NA	NA
AYT45353.1|4497743_4498808_-	hypothetical protein	NA	NA	NA	NA	NA
AYT45354.1|4498804_4499869_-	hypothetical protein	NA	NA	NA	NA	NA
AYT45355.1|4500793_4501123_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYT45356.1|4501119_4503189_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYT45357.1|4503179_4504040_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYT45358.1|4504036_4504621_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYT45359.1|4504617_4504845_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYT45360.1|4504844_4505078_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYT45361.1|4505145_4505487_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYT45362.1|4505450_4505651_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYT45363.1|4505658_4506168_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYT45364.1|4506200_4506443_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYT45365.1|4506559_4507192_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYT45366.1|4507195_4508221_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYT45367.1|4508327_4508681_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYT45368.1|4509297_4509585_+	hypothetical protein	NA	NA	NA	NA	NA
AYT45369.1|4509595_4510486_+	methyltransferase	NA	NA	NA	NA	NA
AYT45370.1|4510485_4511232_+	hypothetical protein	NA	NA	NA	NA	NA
AYT45371.1|4511533_4513504_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYT45372.1|4513523_4514828_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYT45373.1|4514850_4515546_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYT45374.1|4515571_4516366_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYT45375.1|4516375_4517443_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYT45376.1|4517487_4519224_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYT45377.1|4519223_4521719_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYT45378.1|4521742_4522789_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYT45379.1|4522791_4524069_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYT45380.1|4524313_4524853_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYT45381.1|4525706_4527218_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYT45382.1|4527201_4528791_+	hypothetical protein	NA	NA	NA	NA	NA
AYT45383.1|4528954_4529968_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4530145:4530161	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYT45384.1|4530394_4530688_+	hypothetical protein	NA	NA	NA	NA	NA
AYT45385.1|4530684_4531173_+	hypothetical protein	NA	NA	NA	NA	NA
AYT45386.1|4531352_4531805_-	hypothetical protein	NA	NA	NA	NA	NA
AYT45387.1|4537027_4537489_+	hypothetical protein	NA	NA	NA	NA	NA
AYT45388.1|4537485_4537707_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYT45389.1|4538563_4539346_+	hypothetical protein	NA	NA	NA	NA	NA
AYT45390.1|4539972_4540197_-	hypothetical protein	NA	NA	NA	NA	NA
AYT45391.1|4540326_4541517_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYT45392.1|4541827_4543087_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4543246:4543262	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 13
CP029888	Salmonella enterica subsp. enterica serovar Typhi strain 343076_294172 chromosome, complete genome	4809171	4685339	4695598	4809171	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYT45529.1|4685339_4686416_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYT45530.1|4686412_4687486_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYT45531.1|4687460_4688624_-	hypothetical protein	NA	NA	NA	NA	NA
AYT45532.1|4688899_4689466_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYT45533.1|4689481_4689721_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYT45534.1|4689724_4690585_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYT45535.1|4691007_4691331_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYT45536.1|4691314_4691815_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYT45537.1|4691811_4692039_+	hypothetical protein	NA	NA	NA	NA	NA
AYT45538.1|4692035_4692356_+	P4 phage protein	NA	NA	NA	NA	NA
AYT45539.1|4692370_4693045_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYT45540.1|4693041_4694703_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYT45541.1|4695439_4695598_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029889	Salmonella enterica subsp. enterica serovar Typhi strain 343076_294172 plasmid pHCM2, complete sequence	106706	483	63776	106706	tail	Salmonella_phage(93.33%)	77	NA	NA
AYT45632.1|483_714_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
AYT45633.1|1299_1908_+	putative ribonuclease H	NA	J9Q745	Salmonella_phage	99.5	2.2e-117
AYT45634.1|2050_2545_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	96.3	1.9e-79
AYT45635.1|2554_2743_+	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
AYT45636.1|2851_3694_+	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
AYT45637.1|3802_4375_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	8.2e-98
AYT45638.1|4498_6202_+	putative DNA modification methylase	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
AYT45639.1|6260_6950_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	98.3	6.1e-124
AYT45640.1|6946_7120_+	hypothetical protein	NA	J9Q801	Salmonella_phage	98.2	9.5e-26
AYT45641.1|7230_7602_+	hypothetical protein	NA	J9Q7T4	Salmonella_phage	100.0	3.2e-63
AYT45642.1|7693_8335_+	hypothetical protein	NA	J9Q7H7	Salmonella_phage	100.0	9.7e-116
AYT45643.1|8331_8874_+	hypothetical protein	NA	J9Q748	Salmonella_phage	93.1	2.6e-93
AYT45644.1|8885_9194_+	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	56.9	3.0e-14
AYT45645.1|9190_9478_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	58.8	9.9e-28
AYT45646.1|9538_9742_-	hypothetical protein	NA	J9Q802	Salmonella_phage	95.5	1.5e-30
AYT45647.1|9915_10197_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.6	3.2e-31
AYT45648.1|10281_10599_+	hypothetical protein	NA	J9Q750	Salmonella_phage	80.0	8.1e-47
AYT45649.1|10608_11799_+	hypothetical protein	NA	J9Q803	Salmonella_phage	54.6	5.4e-120
AYT45650.1|13235_13481_-	hypothetical protein	NA	J9Q751	Salmonella_phage	92.5	5.8e-37
AYT45651.1|13623_13839_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	95.8	4.5e-33
AYT45652.1|13849_14068_+	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
AYT45653.1|14162_14477_+	hypothetical protein	NA	NA	NA	NA	NA
AYT45654.1|14553_14865_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	92.2	1.1e-45
AYT45655.1|14993_15386_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	65.4	1.7e-41
AYT45656.1|15506_15794_+	hypothetical protein	NA	J9Q753	Salmonella_phage	94.6	1.5e-47
AYT45657.1|15999_16482_+	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	5.5e-87
AYT45658.1|17113_17341_-	hypothetical protein	NA	NA	NA	NA	NA
AYT45659.1|17425_18076_-	hypothetical protein	NA	J9Q754	Salmonella_phage	100.0	1.4e-114
AYT45660.1|18710_19238_-	putative transcriptional regulator	NA	J9Q6L0	Salmonella_phage	96.6	4.1e-80
AYT45661.1|19242_19665_-	putative lipoprotein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
AYT45662.1|19724_20003_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
AYT45663.1|20005_21565_-	putative helicase	NA	J9Q7I4	Salmonella_phage	99.4	5.7e-295
AYT45664.1|21647_22328_+	hypothetical protein	NA	J9Q756	Salmonella_phage	99.6	7.4e-122
AYT45665.1|22327_22996_+	hypothetical protein	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
AYT45666.1|22992_23631_+	putative ABC transporter ATP-binding protein	NA	J9Q807	Salmonella_phage	99.1	5.5e-111
AYT45667.1|23623_23878_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AYT45668.1|23874_24774_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	4.0e-168
AYT45669.1|24783_25050_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
AYT45670.1|25245_25887_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	99.5	1.8e-109
AYT45671.1|25889_27146_+	hypothetical protein	NA	J9Q7Y2	Salmonella_phage	99.8	5.3e-251
AYT45672.1|27179_28754_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	3.2e-301
AYT45673.1|28776_29673_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.6	5.7e-146
AYT45674.1|29699_30575_+	hypothetical protein	NA	J9Q710	Salmonella_phage	100.0	3.8e-163
AYT45675.1|30649_31573_+	hypothetical protein	NA	J9Q6D6	Salmonella_phage	100.0	3.3e-157
AYT45676.1|31616_32051_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
AYT45677.1|32050_32884_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	100.0	2.6e-153
AYT45678.1|32981_33326_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
AYT45679.1|33316_33790_+	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
AYT45680.1|33791_34175_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
AYT45681.1|34249_34996_+	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	96.8	7.8e-125
AYT45682.1|35055_35373_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
AYT45683.1|35453_35723_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AYT45684.1|35730_40314_+	hypothetical protein	NA	J9Q712	Salmonella_phage	92.9	0.0e+00
AYT45685.1|40355_40691_+	hypothetical protein	NA	J9Q6E1	Salmonella_phage	97.3	5.7e-59
AYT45686.1|40747_41479_+|tail	putative phage tail protein	tail	J9Q7Y5	Salmonella_phage	99.1	3.3e-136
AYT45687.1|41471_42269_+	hypothetical protein	NA	J9Q7R4	Salmonella_phage	95.8	1.2e-155
AYT45688.1|42256_42844_+|tail	putative phage tail protein	tail	J9Q7F8	Salmonella_phage	92.3	1.1e-102
AYT45689.1|42858_47247_+|tail	putative phage tail protein	tail	J9Q713	Salmonella_phage	86.7	0.0e+00
AYT45690.1|47329_49882_+	hypothetical protein	NA	A0A0A0YQM3	Citrobacter_virus	52.5	1.4e-152
AYT45691.1|49996_50320_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	2.7e-50
AYT45692.1|50306_51026_+	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	95.7	1.5e-125
AYT45693.1|51094_51439_+	hypothetical protein	NA	J9Q7G2	Salmonella_phage	83.6	5.9e-27
AYT45694.1|51489_52041_-	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	39.8	7.8e-29
AYT45695.1|52371_53037_+	hypothetical protein	NA	J9Q7R7	Salmonella_phage	95.0	8.0e-113
AYT45696.1|53036_53396_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
AYT45697.1|53444_54200_+	hypothetical protein	NA	J9Q7Y9	Salmonella_phage	43.0	3.2e-57
AYT45698.1|54269_55325_-	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	42.6	5.1e-61
AYT45699.1|55602_56328_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.3	2.4e-139
AYT45700.1|56388_57729_+	putative DNA helicase	NA	J9Q7G4	Salmonella_phage	99.6	3.8e-247
AYT45701.1|57791_59003_+	hypothetical protein	NA	J9Q720	Salmonella_phage	96.5	6.6e-214
AYT45702.1|59004_60057_-	hypothetical protein	NA	J9Q6F5	Salmonella_phage	56.7	1.9e-92
AYT45703.1|60240_61035_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.2	4.9e-141
AYT45704.1|61335_61593_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	92.9	4.9e-34
AYT45705.1|61627_62950_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.4	5.8e-256
AYT45706.1|63115_63322_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	8.1e-32
AYT45707.1|63321_63474_+	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	96.0	7.6e-19
AYT45708.1|63470_63776_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
>prophage 2
CP029889	Salmonella enterica subsp. enterica serovar Typhi strain 343076_294172 plasmid pHCM2, complete sequence	106706	72266	106208	106706		Salmonella_phage(100.0%)	35	NA	NA
AYT45721.1|72266_74624_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	90.7	0.0e+00
AYT45722.1|74720_75956_+	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	99.5	1.8e-238
AYT45723.1|76136_79655_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.1	0.0e+00
AYT45724.1|79651_80095_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	97.9	3.0e-71
AYT45725.1|80188_80779_-	hypothetical protein	NA	NA	NA	NA	NA
AYT45726.1|81024_81456_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	100.0	4.0e-73
AYT45727.1|81575_82604_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.8	1.1e-164
AYT45728.1|82664_83609_+	exonuclease	NA	J9Q7S6	Salmonella_phage	99.4	6.8e-182
AYT45729.1|83608_83875_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AYT45730.1|83877_84954_+	putative recombinase	NA	J9Q736	Salmonella_phage	99.7	5.5e-204
AYT45731.1|85249_86092_+	putative lipoprotein	NA	J9Q7Z4	Salmonella_phage	97.1	2.3e-125
AYT45732.1|86254_86626_+	hypothetical protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
AYT45733.1|86609_87020_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.1	1.4e-75
AYT45734.1|87088_87364_+	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.9e-46
AYT45735.1|87404_87710_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	90.8	4.9e-33
AYT45736.1|87709_87913_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	4.0e-31
AYT45737.1|88441_89497_-	putative replication protein A	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
AYT45738.1|90241_90886_+	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	2.4e-122
AYT45739.1|90961_91456_+	hypothetical protein	NA	J9Q6J3	Salmonella_phage	97.6	2.3e-88
AYT45740.1|91487_91793_-	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	97.0	2.0e-50
AYT45741.1|92219_93305_+	exonuclease	NA	J9Q7S9	Salmonella_phage	98.9	2.7e-206
AYT45742.1|93301_93538_+	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
AYT45743.1|93534_95451_+	exonuclease	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
AYT45744.1|95440_96187_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.0	4.4e-136
AYT45745.1|96199_96769_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	1.7e-103
AYT45746.1|96846_99162_+	ribonucleotide-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
AYT45747.1|99269_100412_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.5	2.4e-218
AYT45748.1|100494_101424_+	hypothetical protein	NA	J9Q742	Salmonella_phage	99.0	3.8e-161
AYT45749.1|101539_102655_+	putative thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.1	7.6e-217
AYT45750.1|102656_103070_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
AYT45751.1|103066_103543_+	hypothetical protein	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
AYT45752.1|103542_104187_+	hypothetical protein	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
AYT45753.1|104250_104670_+	hypothetical protein	NA	J9Q743	Salmonella_phage	98.6	2.9e-68
AYT45754.1|104679_105237_+	hypothetical protein	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
AYT45755.1|105281_106208_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	85.4	4.1e-107
