The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029919	Salmonella enterica subsp. enterica serovar Typhi strain 343077_212138 chromosome, complete genome	4774558	930268	937580	4774558	protease,integrase	Dickeya_phage(16.67%)	6	931519:931533	942698:942712
AYT50848.1|930268_931387_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYT50849.1|931383_933330_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931519:931533	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYT50850.1|933459_933681_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYT50851.1|934004_934325_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYT50852.1|934355_936632_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYT50853.1|937202_937580_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942698:942712	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029919	Salmonella enterica subsp. enterica serovar Typhi strain 343077_212138 chromosome, complete genome	4774558	1008705	1086018	4774558	protease,tail,transposase,terminase,integrase	Salmonella_phage(73.33%)	93	990784:990803	1061379:1061398
990784:990803	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYT50903.1|1008705_1010046_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYT50904.1|1010042_1010291_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYT50905.1|1010331_1010577_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYT50906.1|1010576_1011458_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYT50907.1|1011454_1012519_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYT50908.1|1012596_1013277_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYT50909.1|1013273_1014059_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYT50910.1|1014064_1014361_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYT50911.1|1014451_1014652_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYT50912.1|1014940_1015345_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYT50913.1|1015676_1016051_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYT50914.1|1016135_1017119_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYT50915.1|1017121_1017871_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYT50916.1|1017881_1018229_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYT50917.1|1018225_1018750_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYT50918.1|1018749_1019223_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYT50919.1|1019226_1019799_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYT50920.1|1019892_1020159_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYT50921.1|1020240_1020402_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT50922.1|1020834_1021332_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT50923.1|1021516_1021756_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYT50924.1|1021745_1022051_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYT50925.1|1022090_1022693_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYT50926.1|1022901_1023513_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYT50927.1|1023645_1024443_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYT50928.1|1024841_1024967_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT50929.1|1025102_1025552_-	lipoprotein	NA	NA	NA	NA	NA
AYT50930.1|1025768_1026158_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYT50931.1|1026144_1026426_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYT50932.1|1026425_1027040_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYT50933.1|1027259_1027514_+	hypothetical protein	NA	NA	NA	NA	NA
AYT50934.1|1027618_1027996_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYT50935.1|1028059_1028320_+	hypothetical protein	NA	NA	NA	NA	NA
AYT50936.1|1028409_1029162_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYT50937.1|1029127_1030531_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYT50938.1|1030530_1032000_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYT50939.1|1032091_1032622_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYT50940.1|1032636_1033869_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYT50941.1|1033873_1034371_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYT50942.1|1034382_1035324_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYT50943.1|1035365_1035734_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYT50944.1|1035699_1036107_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYT50945.1|1036103_1036658_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYT50946.1|1036644_1037034_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYT50947.1|1037008_1037572_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYT50948.1|1037575_1038721_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYT50949.1|1038732_1039173_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYT50950.1|1039176_1039629_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYT50951.1|1039806_1041759_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYT50952.1|1041758_1042409_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYT50953.1|1042412_1042715_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYT50954.1|1042717_1043749_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYT50955.1|1043745_1044081_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYT50956.1|1044275_1045007_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT50957.1|1045006_1045435_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT50958.1|1045493_1046249_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYT50959.1|1046336_1046474_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYT50960.1|1046489_1046843_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYT50961.1|1046843_1048043_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYT50962.1|1048039_1048720_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYT50963.1|1048719_1050231_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.1	5.9e-111
AYT50964.1|1050245_1050764_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYT50965.1|1051685_1052387_-	hypothetical protein	NA	NA	NA	NA	NA
AYT50966.1|1052699_1052978_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYT50967.1|1053403_1056016_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYT50968.1|1056223_1057234_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYT50969.1|1057396_1057942_+	hypothetical protein	NA	NA	NA	NA	NA
AYT50970.1|1057938_1059048_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYT50971.1|1059146_1061255_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYT50972.1|1061267_1063175_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061379:1061398	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYT50973.1|1063189_1064443_+	inner membrane protein	NA	NA	NA	NA	NA
AYT50974.1|1064447_1066088_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYT50975.1|1066084_1066648_+	lipoprotein	NA	NA	NA	NA	NA
AYT50976.1|1066901_1067069_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYT50977.1|1067168_1067687_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYT50978.1|1067755_1069516_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYT50979.1|1069701_1070154_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYT50980.1|1070225_1071278_-	outer membrane protein A	NA	NA	NA	NA	NA
AYT50981.1|1071632_1072142_-	cell division inhibitor	NA	NA	NA	NA	NA
AYT50982.1|1072358_1072964_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYT50983.1|1072950_1075104_-	inner membrane protein	NA	NA	NA	NA	NA
AYT50984.1|1075122_1075569_-	hypothetical protein	NA	NA	NA	NA	NA
AYT50985.1|1075692_1077747_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYT50986.1|1077782_1078241_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYT50987.1|1078335_1078998_-	hypothetical protein	NA	NA	NA	NA	NA
AYT50988.1|1079168_1079585_+	hypothetical protein	NA	NA	NA	NA	NA
AYT50989.1|1079629_1079947_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYT50990.1|1080004_1081216_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYT50991.1|1082347_1082806_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT50992.1|1083542_1083824_+	acylphosphatase	NA	NA	NA	NA	NA
AYT50993.1|1083820_1084150_-	sulfite reductase	NA	NA	NA	NA	NA
AYT50994.1|1084236_1084896_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYT50995.1|1085559_1086018_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029919	Salmonella enterica subsp. enterica serovar Typhi strain 343077_212138 chromosome, complete genome	4774558	1530943	1604937	4774558	protease,tail,head,tRNA,transposase,plate	Burkholderia_virus(43.24%)	80	NA	NA
AYT51395.1|1530943_1531402_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT51396.1|1531904_1532186_+	stress response protein	NA	NA	NA	NA	NA
AYT51397.1|1532454_1533276_+|protease	serine protease	protease	NA	NA	NA	NA
AYT51398.1|1533310_1533640_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYT51399.1|1533626_1533989_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYT51400.1|1534100_1534271_-	hypothetical protein	NA	NA	NA	NA	NA
AYT51401.1|1534405_1535440_+	hypothetical protein	NA	NA	NA	NA	NA
AYT51402.1|1535614_1537003_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYT51403.1|1537013_1538543_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYT51404.1|1539069_1540014_+	hypothetical protein	NA	NA	NA	NA	NA
AYT51405.1|1540195_1540585_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYT51406.1|1540556_1541009_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYT51407.1|1541203_1541434_-	hypothetical protein	NA	NA	NA	NA	NA
AYT51408.1|1541430_1542114_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYT51409.1|1542110_1542326_-	hypothetical protein	NA	NA	NA	NA	NA
AYT51410.1|1542318_1542702_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYT51411.1|1542698_1543001_-	hypothetical protein	NA	NA	NA	NA	NA
AYT51412.1|1543010_1543283_-	hypothetical protein	NA	NA	NA	NA	NA
AYT51413.1|1543571_1544102_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYT51414.1|1544129_1544399_-	hypothetical protein	NA	NA	NA	NA	NA
AYT51415.1|1544401_1545568_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYT51416.1|1545578_1547348_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYT51417.1|1547525_1547957_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYT51418.1|1547952_1548945_+	nucleoid-associated protein	NA	A0A291AUQ0	Sinorhizobium_phage	37.3	3.0e-55
AYT51419.1|1549188_1549539_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYT51420.1|1550253_1550904_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYT51421.1|1550900_1551227_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYT51422.1|1551226_1551538_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYT51423.1|1551537_1552083_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYT51424.1|1552079_1553675_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYT51425.1|1553674_1555171_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYT51426.1|1555151_1555973_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYT51427.1|1555975_1556434_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYT51428.1|1556648_1557764_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYT51429.1|1557778_1558732_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYT51430.1|1558741_1559080_+	hypothetical protein	NA	NA	NA	NA	NA
AYT51431.1|1559081_1559528_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYT51432.1|1559527_1559992_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYT51433.1|1559988_1560243_+	hypothetical protein	NA	NA	NA	NA	NA
AYT51434.1|1560232_1561660_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYT51435.1|1561659_1562181_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYT51436.1|1562183_1562465_+	hypothetical protein	NA	NA	NA	NA	NA
AYT51437.1|1562562_1562898_+	hypothetical protein	NA	NA	NA	NA	NA
AYT51438.1|1563074_1565540_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYT51439.1|1565539_1566424_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYT51440.1|1566420_1566636_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYT51441.1|1566623_1567778_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYT51442.1|1567774_1568302_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYT51443.1|1568358_1568706_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYT51444.1|1568696_1569800_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYT51445.1|1569792_1570371_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYT51446.1|1571188_1571398_+|tail	phage tail protein	tail	NA	NA	NA	NA
AYT51447.1|1571911_1572529_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYT51448.1|1574039_1574612_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYT51449.1|1574892_1576275_+	amino acid permease	NA	NA	NA	NA	NA
AYT51450.1|1576336_1576672_-	hypothetical protein	NA	NA	NA	NA	NA
AYT51451.1|1576798_1577530_+	two-component response regulator	NA	NA	NA	NA	NA
AYT51452.1|1578010_1579162_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYT51453.1|1579314_1581021_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYT51454.1|1581128_1582433_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYT51455.1|1582508_1583438_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYT51456.1|1583434_1584838_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYT51457.1|1585005_1586652_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYT51458.1|1586851_1588027_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYT51459.1|1588129_1589638_+	hypothetical protein	NA	NA	NA	NA	NA
AYT51460.1|1590343_1591345_+	adenosine deaminase	NA	NA	NA	NA	NA
AYT51461.1|1591418_1592534_-	oxidoreductase	NA	NA	NA	NA	NA
AYT51462.1|1592636_1592792_+	hypothetical protein	NA	NA	NA	NA	NA
AYT51463.1|1593090_1593306_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYT51464.1|1593394_1593835_+	hypothetical protein	NA	NA	NA	NA	NA
AYT51465.1|1593911_1594493_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYT51466.1|1594492_1595071_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYT51467.1|1595063_1597085_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYT51468.1|1597085_1598144_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYT51469.1|1598147_1598768_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYT51470.1|1598770_1599463_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYT51471.1|1599462_1600098_+	endonuclease III	NA	NA	NA	NA	NA
AYT51472.1|1600698_1602204_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYT51473.1|1602308_1602914_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYT51474.1|1603662_1604937_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029919	Salmonella enterica subsp. enterica serovar Typhi strain 343077_212138 chromosome, complete genome	4774558	1785982	1790394	4774558		Escherichia_phage(50.0%)	6	NA	NA
AYT51658.1|1785982_1786222_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
AYT51659.1|1787094_1787904_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYT51660.1|1787976_1788354_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYT51661.1|1788501_1789044_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYT51662.1|1789235_1789964_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYT51663.1|1789980_1790394_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029919	Salmonella enterica subsp. enterica serovar Typhi strain 343077_212138 chromosome, complete genome	4774558	2085261	2095768	4774558		Enterobacteria_phage(37.5%)	10	NA	NA
AYT51935.1|2085261_2086575_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYT51936.1|2086601_2087681_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYT51937.1|2087685_2088459_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYT51938.1|2088474_2089449_-	reductase RfbI	NA	NA	NA	NA	NA
AYT51939.1|2089454_2090006_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYT51940.1|2090006_2090885_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYT51941.1|2090932_2091832_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYT51942.1|2091831_2092917_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYT51943.1|2093293_2094187_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYT51944.1|2094364_2095768_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 6
CP029919	Salmonella enterica subsp. enterica serovar Typhi strain 343077_212138 chromosome, complete genome	4774558	2171661	2180829	4774558	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYT52007.1|2171661_2173695_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYT52008.1|2173935_2174394_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYT52009.1|2174565_2175096_+	lipoprotein	NA	NA	NA	NA	NA
AYT52010.1|2175152_2175620_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYT52011.1|2175666_2176386_-	two-component system response regulator	NA	NA	NA	NA	NA
AYT52012.1|2176382_2178065_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	89.7	4.3e-272
AYT52013.1|2178287_2179019_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYT52014.1|2179078_2179186_+	hypothetical protein	NA	NA	NA	NA	NA
AYT52015.1|2179166_2179898_-	ABC transporter permease	NA	NA	NA	NA	NA
AYT52016.1|2179881_2180829_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 7
CP029919	Salmonella enterica subsp. enterica serovar Typhi strain 343077_212138 chromosome, complete genome	4774558	2716345	2729737	4774558	tail	Salmonella_phage(70.0%)	11	NA	NA
AYT52445.1|2716345_2716564_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYT52446.1|2716654_2717755_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYT52447.1|2717751_2718237_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYT52448.1|2718233_2721311_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYT52449.1|2721303_2721423_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYT52450.1|2721437_2721740_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYT52451.1|2721794_2722310_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYT52452.1|2722319_2723492_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYT52453.1|2723634_2724207_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYT52454.1|2724884_2726000_+	glycosyltransferase	NA	NA	NA	NA	NA
AYT52455.1|2726080_2729737_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 8
CP029919	Salmonella enterica subsp. enterica serovar Typhi strain 343077_212138 chromosome, complete genome	4774558	3060722	3104425	4774558	protease,bacteriocin,tRNA,transposase	Bacillus_virus(33.33%)	44	NA	NA
AYT52760.1|3060722_3061181_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT52761.1|3061370_3062450_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYT52762.1|3062551_3063715_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYT52763.1|3063736_3064783_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYT52764.1|3065156_3065582_+	hypothetical protein	NA	NA	NA	NA	NA
AYT52765.1|3065607_3066186_+	hypothetical protein	NA	NA	NA	NA	NA
AYT52766.1|3066219_3066894_+	hypothetical protein	NA	NA	NA	NA	NA
AYT52767.1|3066875_3067559_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYT52768.1|3067552_3068209_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYT52769.1|3068313_3068772_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT52770.1|3068960_3070952_-	transketolase	NA	NA	NA	NA	NA
AYT52771.1|3071227_3071986_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYT52772.1|3072086_3073007_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYT52773.1|3073234_3075211_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYT52774.1|3075219_3075351_-	hypothetical protein	NA	NA	NA	NA	NA
AYT52775.1|3075645_3075945_-	membrane protein	NA	NA	NA	NA	NA
AYT52776.1|3076000_3077155_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYT52777.1|3077647_3079042_+	galactose-proton symport	NA	NA	NA	NA	NA
AYT52778.1|3079120_3079618_+	hypothetical protein	NA	NA	NA	NA	NA
AYT52779.1|3079713_3080421_+	endonuclease I	NA	NA	NA	NA	NA
AYT52780.1|3080497_3081229_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYT52781.1|3081248_3082196_+	glutathione synthetase	NA	NA	NA	NA	NA
AYT52782.1|3082411_3082975_+	hypothetical protein	NA	NA	NA	NA	NA
AYT52783.1|3082974_3083391_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYT52784.1|3083437_3084124_-	global regulatory protein	NA	NA	NA	NA	NA
AYT52785.1|3084253_3085234_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYT52786.1|3085251_3085956_+	hypothetical protein	NA	NA	NA	NA	NA
AYT52787.1|3085974_3086541_+	hypothetical protein	NA	NA	NA	NA	NA
AYT52788.1|3086537_3086828_+	hypothetical protein	NA	NA	NA	NA	NA
AYT52789.1|3086835_3087429_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYT52790.1|3087421_3088558_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYT52791.1|3088648_3089656_-	hypothetical protein	NA	NA	NA	NA	NA
AYT52792.1|3089788_3090835_-	L-asparaginase	NA	NA	NA	NA	NA
AYT52793.1|3091153_3091612_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT52794.1|3091734_3092454_-	hypothetical protein	NA	NA	NA	NA	NA
AYT52795.1|3092503_3092830_-	hypothetical protein	NA	NA	NA	NA	NA
AYT52796.1|3092829_3093549_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYT52797.1|3093703_3094756_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYT52798.1|3094783_3095059_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYT52799.1|3095171_3096257_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYT52800.1|3096473_3097730_+	nucleoside permease	NA	NA	NA	NA	NA
AYT52801.1|3100340_3101048_+	hypothetical protein	NA	NA	NA	NA	NA
AYT52802.1|3103637_3103904_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYT52803.1|3104146_3104425_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 9
CP029919	Salmonella enterica subsp. enterica serovar Typhi strain 343077_212138 chromosome, complete genome	4774558	3479922	3517980	4774558	plate,tail,transposase,portal,capsid,terminase,integrase	Salmonella_phage(82.05%)	46	3474886:3474900	3487052:3487066
3474886:3474900	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYT53131.1|3479922_3481569_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYT53132.1|3481708_3481807_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYT53133.1|3482062_3482392_+	hypothetical protein	NA	NA	NA	NA	NA
AYT53134.1|3482432_3483485_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYT53135.1|3483880_3484450_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYT53136.1|3484575_3484797_+	hypothetical protein	NA	NA	NA	NA	NA
AYT53137.1|3484829_3485339_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYT53138.1|3485513_3485738_+	hypothetical protein	NA	NA	NA	NA	NA
AYT53139.1|3485760_3486102_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYT53140.1|3486169_3486403_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYT53141.1|3486402_3486630_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYT53142.1|3486626_3487484_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3487052:3487066	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYT53143.1|3487480_3489895_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYT53144.1|3490048_3490237_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYT53145.1|3492204_3493119_+	hypothetical protein	NA	NA	NA	NA	NA
AYT53146.1|3493115_3493856_+	hypothetical protein	NA	NA	NA	NA	NA
AYT53147.1|3493890_3494928_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYT53148.1|3494927_3496694_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYT53149.1|3496836_3497670_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYT53150.1|3497686_3498745_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYT53151.1|3498748_3499399_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYT53152.1|3499431_3499959_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYT53153.1|3499958_3500162_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYT53154.1|3500165_3500381_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYT53155.1|3500400_3500874_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYT53156.1|3500875_3501253_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYT53157.1|3501249_3501678_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYT53158.1|3501773_3502205_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYT53159.1|3502197_3502644_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYT53160.1|3502712_3503291_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYT53161.1|3503287_3503647_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYT53162.1|3503633_3504542_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYT53163.1|3504534_3505140_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYT53164.1|3505136_3506651_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYT53165.1|3506650_3507244_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYT53166.1|3507215_3507656_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYT53167.1|3508078_3508651_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYT53168.1|3508793_3509966_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYT53169.1|3509975_3510491_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYT53170.1|3510545_3510848_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYT53171.1|3510862_3510982_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYT53172.1|3510974_3514052_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYT53173.1|3514048_3514534_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYT53174.1|3514530_3515631_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYT53175.1|3515721_3515940_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYT53176.1|3517521_3517980_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 10
CP029919	Salmonella enterica subsp. enterica serovar Typhi strain 343077_212138 chromosome, complete genome	4774558	4433294	4507564	4774558	tail,capsid,portal,plate,terminase,integrase	Salmonella_phage(82.61%)	75	4494808:4494824	4507723:4507739
AYT53953.1|4433294_4435244_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYT53954.1|4435315_4436224_+	hypothetical protein	NA	NA	NA	NA	NA
AYT53955.1|4436297_4437197_+	hypothetical protein	NA	NA	NA	NA	NA
AYT53956.1|4437238_4437598_+	hypothetical protein	NA	NA	NA	NA	NA
AYT53957.1|4437697_4437967_-	hypothetical protein	NA	NA	NA	NA	NA
AYT53958.1|4438098_4439373_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYT53959.1|4439592_4439970_+	hypothetical protein	NA	NA	NA	NA	NA
AYT53960.1|4440056_4440275_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYT53961.1|4440342_4441443_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYT53962.1|4441439_4441925_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYT53963.1|4441924_4444705_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYT53964.1|4444697_4444817_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYT53965.1|4444831_4445134_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYT53966.1|4445188_4445704_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYT53967.1|4445713_4446886_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYT53968.1|4447420_4448143_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYT53969.1|4448340_4448748_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYT53970.1|4448754_4450374_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYT53971.1|4450370_4450976_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYT53972.1|4450968_4451877_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYT53973.1|4451863_4452223_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYT53974.1|4452219_4452798_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYT53975.1|4452866_4453313_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYT53976.1|4453305_4453737_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
AYT53977.1|4453832_4454258_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYT53978.1|4454257_4454635_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYT53979.1|4454639_4455110_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYT53980.1|4455129_4455345_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYT53981.1|4455348_4455552_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYT53982.1|4455551_4456016_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYT53983.1|4456109_4456760_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYT53984.1|4456763_4457828_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYT53985.1|4457844_4458678_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYT53986.1|4458820_4460587_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYT53987.1|4460583_4461630_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYT53988.1|4461678_4462374_-	hypothetical protein	NA	NA	NA	NA	NA
AYT53989.1|4462393_4463458_-	hypothetical protein	NA	NA	NA	NA	NA
AYT53990.1|4463454_4464519_-	hypothetical protein	NA	NA	NA	NA	NA
AYT53991.1|4465443_4467852_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.1	0.0e+00
AYT53992.1|4467842_4468703_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYT53993.1|4468699_4469284_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYT53994.1|4469280_4469508_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYT53995.1|4469507_4469741_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYT53996.1|4469808_4470150_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYT53997.1|4470113_4470314_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYT53998.1|4470321_4470831_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYT53999.1|4470863_4471106_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYT54000.1|4471222_4471855_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYT54001.1|4471858_4472884_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYT54002.1|4472990_4473344_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYT54003.1|4473960_4474248_+	hypothetical protein	NA	NA	NA	NA	NA
AYT54004.1|4474258_4475149_+	methyltransferase	NA	NA	NA	NA	NA
AYT54005.1|4475148_4475895_+	hypothetical protein	NA	NA	NA	NA	NA
AYT54006.1|4476196_4478167_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYT54007.1|4478186_4479491_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYT54008.1|4479513_4480209_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYT54009.1|4480234_4481029_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYT54010.1|4481038_4482106_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYT54011.1|4482150_4483887_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYT54012.1|4483886_4486382_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYT54013.1|4486405_4487452_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYT54014.1|4487454_4488732_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYT54015.1|4488976_4489516_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYT54016.1|4490369_4491881_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYT54017.1|4491864_4493454_+	hypothetical protein	NA	NA	NA	NA	NA
AYT54018.1|4493617_4494631_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4494808:4494824	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYT54019.1|4495057_4495351_+	hypothetical protein	NA	NA	NA	NA	NA
AYT54020.1|4495347_4495836_+	hypothetical protein	NA	NA	NA	NA	NA
AYT54021.1|4496015_4496468_-	hypothetical protein	NA	NA	NA	NA	NA
AYT54022.1|4501690_4502152_+	hypothetical protein	NA	NA	NA	NA	NA
AYT54023.1|4502148_4502370_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYT54024.1|4503226_4504009_+	hypothetical protein	NA	NA	NA	NA	NA
AYT54025.1|4504635_4504860_-	hypothetical protein	NA	NA	NA	NA	NA
AYT54026.1|4504989_4505994_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYT54027.1|4506304_4507564_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4507723:4507739	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
