The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029870	Salmonella enterica subsp. enterica serovar Typhi strain 343077_212159 chromosome, complete genome	4795465	868803	876115	4795465	protease,integrase	Dickeya_phage(16.67%)	6	870054:870068	881233:881247
AYT55014.1|868803_869922_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYT55015.1|869918_871865_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
870054:870068	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYT55016.1|871994_872216_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYT55017.1|872539_872860_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYT55018.1|872890_875167_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYT55019.1|875737_876115_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
881233:881247	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029870	Salmonella enterica subsp. enterica serovar Typhi strain 343077_212159 chromosome, complete genome	4795465	947240	1024553	4795465	tail,terminase,transposase,integrase,protease	Salmonella_phage(73.33%)	93	929319:929338	999914:999933
929319:929338	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYT55069.1|947240_948581_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYT55070.1|948577_948826_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYT55071.1|948866_949112_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYT55072.1|949111_949993_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYT55073.1|949989_951054_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYT55074.1|951131_951812_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYT55075.1|951808_952594_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYT55076.1|952599_952896_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYT55077.1|952986_953187_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYT55078.1|953475_953880_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYT55079.1|954211_954586_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYT55080.1|954670_955654_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYT55081.1|955656_956406_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYT55082.1|956416_956764_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYT55083.1|956760_957285_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYT55084.1|957284_957758_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYT55085.1|957761_958334_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYT55086.1|958427_958694_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYT55087.1|958775_958937_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT55088.1|959369_959867_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT55089.1|960051_960291_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYT55090.1|960280_960586_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYT55091.1|960625_961228_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYT55092.1|961436_962048_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYT55093.1|962180_962978_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYT55094.1|963376_963502_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT55095.1|963637_964087_-	lipoprotein	NA	NA	NA	NA	NA
AYT55096.1|964303_964693_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYT55097.1|964679_964961_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYT55098.1|964960_965575_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYT55099.1|965794_966049_+	hypothetical protein	NA	NA	NA	NA	NA
AYT55100.1|966153_966531_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYT55101.1|966594_966855_+	hypothetical protein	NA	NA	NA	NA	NA
AYT55102.1|966944_967697_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYT55103.1|967662_969066_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYT55104.1|969065_970532_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	96.7	6.4e-272
AYT55105.1|970626_971157_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYT55106.1|971171_972404_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYT55107.1|972408_972906_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYT55108.1|972917_973859_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYT55109.1|973900_974269_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYT55110.1|974234_974642_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYT55111.1|974638_975193_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYT55112.1|975179_975569_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYT55113.1|975543_976107_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYT55114.1|976110_977256_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYT55115.1|977267_977708_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYT55116.1|977711_978164_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYT55117.1|978341_980294_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYT55118.1|980293_980944_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYT55119.1|980947_981250_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYT55120.1|981252_982284_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYT55121.1|982280_982616_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYT55122.1|982810_983542_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT55123.1|983541_983970_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT55124.1|984028_984784_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYT55125.1|984871_985009_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYT55126.1|985024_985378_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYT55127.1|985378_986578_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.2	2.5e-213
AYT55128.1|986574_987255_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYT55129.1|987254_988766_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.1	1.7e-110
AYT55130.1|988780_989299_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYT55131.1|990220_990922_-	hypothetical protein	NA	NA	NA	NA	NA
AYT55132.1|991234_991513_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYT55133.1|991938_994551_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYT55134.1|994758_995769_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYT55135.1|995931_996477_+	hypothetical protein	NA	NA	NA	NA	NA
AYT55136.1|996473_997583_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYT55137.1|997681_999790_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYT55138.1|999802_1001710_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
999914:999933	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYT55139.1|1001724_1002978_+	inner membrane protein	NA	NA	NA	NA	NA
AYT55140.1|1002982_1004623_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYT55141.1|1004619_1005183_+	lipoprotein	NA	NA	NA	NA	NA
AYT55142.1|1005436_1005604_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYT55143.1|1005703_1006222_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYT55144.1|1006290_1008051_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYT55145.1|1008236_1008689_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYT55146.1|1008760_1009813_-	outer membrane protein A	NA	NA	NA	NA	NA
AYT55147.1|1010167_1010677_-	cell division inhibitor	NA	NA	NA	NA	NA
AYT55148.1|1010893_1011499_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYT55149.1|1011485_1013639_-	inner membrane protein	NA	NA	NA	NA	NA
AYT55150.1|1013657_1014104_-	hypothetical protein	NA	NA	NA	NA	NA
AYT55151.1|1014227_1016282_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYT55152.1|1016317_1016776_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYT55153.1|1016870_1017533_-	hypothetical protein	NA	NA	NA	NA	NA
AYT55154.1|1017703_1018120_+	hypothetical protein	NA	NA	NA	NA	NA
AYT55155.1|1018164_1018482_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYT55156.1|1018539_1019751_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYT55157.1|1020882_1021341_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT55158.1|1022077_1022359_+	acylphosphatase	NA	NA	NA	NA	NA
AYT55159.1|1022355_1022685_-	sulfite reductase	NA	NA	NA	NA	NA
AYT55160.1|1022771_1023431_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYT55161.1|1024094_1024553_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029870	Salmonella enterica subsp. enterica serovar Typhi strain 343077_212159 chromosome, complete genome	4795465	1467849	1541419	4795465	head,tail,tRNA,transposase,protease,plate	Burkholderia_virus(42.11%)	81	NA	NA
AYT55559.1|1467849_1468308_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT55560.1|1468810_1469092_+	stress response protein	NA	NA	NA	NA	NA
AYT55561.1|1469360_1470182_+|protease	serine protease	protease	NA	NA	NA	NA
AYT55562.1|1470216_1470546_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYT55563.1|1470532_1470895_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYT55564.1|1471006_1471177_-	hypothetical protein	NA	NA	NA	NA	NA
AYT55565.1|1471311_1472346_+	hypothetical protein	NA	NA	NA	NA	NA
AYT55566.1|1472520_1473909_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYT55567.1|1473919_1475449_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYT55568.1|1475975_1476920_+	hypothetical protein	NA	NA	NA	NA	NA
AYT55569.1|1477101_1477491_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYT55570.1|1477462_1477915_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYT55571.1|1478109_1478340_-	hypothetical protein	NA	NA	NA	NA	NA
AYT55572.1|1478336_1479020_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYT55573.1|1479016_1479232_-	hypothetical protein	NA	NA	NA	NA	NA
AYT55574.1|1479224_1479608_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYT55575.1|1479604_1479907_-	hypothetical protein	NA	NA	NA	NA	NA
AYT55576.1|1479916_1480189_-	hypothetical protein	NA	NA	NA	NA	NA
AYT55577.1|1480477_1481008_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYT55578.1|1481035_1481305_-	hypothetical protein	NA	NA	NA	NA	NA
AYT55579.1|1481307_1482474_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYT55580.1|1482484_1484254_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYT55581.1|1484431_1484863_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYT55582.1|1484858_1485455_+	hypothetical protein	NA	NA	NA	NA	NA
AYT55583.1|1485698_1486049_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYT55584.1|1486763_1487414_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYT55585.1|1487410_1487737_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYT55586.1|1487736_1488048_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYT55587.1|1488047_1488593_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYT55588.1|1488589_1490185_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYT55589.1|1490184_1491681_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYT55590.1|1491661_1492483_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYT55591.1|1492485_1492944_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.2e-30
AYT55592.1|1493158_1494274_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYT55593.1|1494288_1495242_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYT55594.1|1495251_1495590_+	hypothetical protein	NA	NA	NA	NA	NA
AYT55595.1|1495591_1496038_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYT55596.1|1496037_1496502_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYT55597.1|1496498_1496753_+	hypothetical protein	NA	NA	NA	NA	NA
AYT55598.1|1496742_1498170_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYT55599.1|1498169_1498691_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYT55600.1|1498693_1498975_+	hypothetical protein	NA	NA	NA	NA	NA
AYT55601.1|1499072_1499408_+	hypothetical protein	NA	NA	NA	NA	NA
AYT55602.1|1499583_1502049_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.5	1.1e-167
AYT55603.1|1502048_1502933_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYT55604.1|1502929_1503145_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYT55605.1|1503132_1504287_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYT55606.1|1504283_1504811_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYT55607.1|1504867_1505215_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYT55608.1|1505205_1506309_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYT55609.1|1506301_1506880_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYT55610.1|1506882_1507908_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYT55611.1|1508421_1509039_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYT55612.1|1509532_1509925_-	hypothetical protein	NA	Q9MCR6	Enterobacteria_phage	51.1	6.8e-19
AYT55613.1|1510521_1511094_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYT55614.1|1511374_1512757_+	amino acid permease	NA	NA	NA	NA	NA
AYT55615.1|1512818_1513154_-	hypothetical protein	NA	NA	NA	NA	NA
AYT55616.1|1513280_1514012_+	two-component response regulator	NA	NA	NA	NA	NA
AYT55617.1|1514492_1515644_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	4.2e-117
AYT55618.1|1515796_1517503_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYT55619.1|1517610_1518915_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYT55620.1|1518990_1519920_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYT55621.1|1519916_1521320_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYT55622.1|1521487_1523134_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYT55623.1|1523333_1524509_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYT55624.1|1524611_1526120_+	hypothetical protein	NA	NA	NA	NA	NA
AYT55625.1|1526825_1527827_+	adenosine deaminase	NA	NA	NA	NA	NA
AYT55626.1|1527900_1529016_-	oxidoreductase	NA	NA	NA	NA	NA
AYT55627.1|1529118_1529274_+	hypothetical protein	NA	NA	NA	NA	NA
AYT55628.1|1529572_1529788_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYT55629.1|1529876_1530317_+	hypothetical protein	NA	NA	NA	NA	NA
AYT55630.1|1530393_1530975_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYT55631.1|1530974_1531553_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYT55632.1|1531545_1533567_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYT55633.1|1533567_1534626_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYT55634.1|1534629_1535250_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYT55635.1|1535252_1535945_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYT55636.1|1535944_1536580_+	endonuclease III	NA	NA	NA	NA	NA
AYT55637.1|1537180_1538686_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYT55638.1|1538790_1539396_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYT55639.1|1540144_1541419_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029870	Salmonella enterica subsp. enterica serovar Typhi strain 343077_212159 chromosome, complete genome	4795465	1722450	1726862	4795465		Escherichia_phage(50.0%)	6	NA	NA
AYT55823.1|1722450_1722690_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
AYT55824.1|1723562_1724372_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYT55825.1|1724444_1724822_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYT55826.1|1724969_1725512_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYT55827.1|1725703_1726432_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYT55828.1|1726448_1726862_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029870	Salmonella enterica subsp. enterica serovar Typhi strain 343077_212159 chromosome, complete genome	4795465	1826937	1863024	4795465	holin,integrase	Salmonella_phage(36.59%)	47	1853490:1853503	1868549:1868562
AYT55915.1|1826937_1827291_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	86.5	1.0e-29
AYT55916.1|1827290_1828358_-	bacteriophage protein	NA	A0A0M4QX01	Salmonella_phage	82.8	7.7e-158
AYT55917.1|1828360_1828663_-	bacteriophage protein	NA	A0A0M4R5B7	Salmonella_phage	92.0	2.2e-49
AYT55918.1|1828662_1829250_-	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	1.5e-83
AYT55919.1|1829249_1831238_-	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	74.8	1.0e-272
AYT55920.1|1831415_1831868_-	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	4.7e-56
AYT55921.1|1831871_1832312_-	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
AYT55922.1|1832322_1833468_-	hypothetical protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	1.0e-160
AYT55923.1|1833471_1834035_-	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.7	1.7e-79
AYT55924.1|1834009_1834399_-	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	2.5e-66
AYT55925.1|1834385_1834940_-	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	71.7	8.0e-66
AYT55926.1|1834936_1835344_-	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	9.7e-69
AYT55927.1|1835718_1836660_-	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	3.2e-155
AYT55928.1|1836671_1837178_-	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	79.9	3.7e-70
AYT55929.1|1837181_1838402_-	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	88.0	1.2e-199
AYT55930.1|1838416_1838947_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	84.0	1.7e-81
AYT55931.1|1839041_1840508_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	92.4	1.8e-261
AYT55932.1|1840507_1841911_-	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	69.2	3.2e-188
AYT55933.1|1842680_1842860_+	hypothetical protein	NA	NA	NA	NA	NA
AYT55934.1|1842849_1843194_-	hypothetical protein	NA	Q8SBD8	Shigella_phage	74.5	1.4e-36
AYT55935.1|1843388_1843865_-	endolysin	NA	Q8SBE0	Shigella_phage	96.2	1.0e-85
AYT55936.1|1843868_1844210_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	89.2	4.0e-52
AYT55937.1|1844557_1845127_-	hypothetical protein	NA	NA	NA	NA	NA
AYT55938.1|1845360_1846050_-	bacteriophage protein	NA	A0A0N7C203	Escherichia_phage	77.9	2.1e-52
AYT55939.1|1846190_1846745_-	hypothetical protein	NA	A0A0U2S606	Escherichia_phage	71.0	1.3e-71
AYT55940.1|1846741_1847032_-	bacteriophage protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
AYT55941.1|1847031_1847631_-	hypothetical protein	NA	A0A0U2RT94	Escherichia_phage	93.0	5.9e-107
AYT55942.1|1847702_1847915_-	hypothetical protein	NA	NA	NA	NA	NA
AYT55943.1|1848192_1848405_-	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	95.7	9.6e-28
AYT55944.1|1848773_1849706_+	hypothetical protein	NA	NA	NA	NA	NA
AYT55945.1|1849702_1850257_+	hypothetical protein	NA	NA	NA	NA	NA
AYT55946.1|1850355_1850763_-	bacteriophage protein	NA	A0A2R2Z307	Escherichia_phage	95.8	1.7e-57
AYT55947.1|1850769_1851192_-	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	91.3	1.7e-63
AYT55948.1|1851207_1852002_-	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	88.5	1.3e-117
AYT55949.1|1851991_1852738_-	DNA replication protein	NA	V5UQI5	Shigella_phage	79.3	2.0e-112
AYT55950.1|1852744_1853533_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.0	3.9e-42
1853490:1853503	attL	TTATCCGGCGTAAT	NA	NA	NA	NA
AYT55951.1|1853610_1854033_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	94.3	3.4e-69
AYT55952.1|1854029_1854272_-	cro repressor	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
AYT55953.1|1854368_1854788_+	regulator	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
AYT55954.1|1855030_1855249_+	hypothetical protein	NA	M4QQ57	Salicola_phage	53.2	2.5e-07
AYT55955.1|1855402_1855615_-	hypothetical protein	NA	NA	NA	NA	NA
AYT55956.1|1856121_1856343_+	cell division inhibitor protein	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
AYT55957.1|1856587_1856863_+	bacteriophage protein	NA	A0A0U2QW85	Escherichia_phage	92.3	3.7e-40
AYT55958.1|1856962_1860091_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	79.5	0.0e+00
AYT55959.1|1860087_1861155_+	hypothetical protein	NA	A0A0U2S5Y9	Escherichia_phage	62.5	1.8e-114
AYT55960.1|1861333_1861594_+	gydaC	NA	A0A0U2QL97	Escherichia_phage	97.9	1.7e-18
AYT55961.1|1861947_1863024_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	6.9e-98
1868549:1868562	attR	TTATCCGGCGTAAT	NA	NA	NA	NA
>prophage 6
CP029870	Salmonella enterica subsp. enterica serovar Typhi strain 343077_212159 chromosome, complete genome	4795465	1967431	1974665	4795465		Morganella_phage(33.33%)	7	NA	NA
AYT56065.1|1967431_1968862_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYT56066.1|1968935_1969631_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYT56067.1|1969710_1970022_-	hypothetical protein	NA	NA	NA	NA	NA
AYT56068.1|1970672_1971857_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYT56069.1|1972316_1972529_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYT56070.1|1972974_1974243_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYT56071.1|1974245_1974665_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 7
CP029870	Salmonella enterica subsp. enterica serovar Typhi strain 343077_212159 chromosome, complete genome	4795465	2058407	2068914	4795465		Enterobacteria_phage(37.5%)	10	NA	NA
AYT56148.1|2058407_2059721_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYT56149.1|2059747_2060827_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYT56150.1|2060831_2061605_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYT56151.1|2061620_2062595_-	reductase RfbI	NA	NA	NA	NA	NA
AYT56152.1|2062600_2063152_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYT56153.1|2063152_2064031_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYT56154.1|2064078_2064978_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYT56155.1|2064977_2066063_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYT56156.1|2066439_2067333_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYT56157.1|2067510_2068914_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 8
CP029870	Salmonella enterica subsp. enterica serovar Typhi strain 343077_212159 chromosome, complete genome	4795465	2144806	2153977	4795465	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYT56214.1|2144806_2146840_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYT56215.1|2147080_2147539_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYT56216.1|2147710_2148241_+	lipoprotein	NA	NA	NA	NA	NA
AYT56217.1|2148297_2148765_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYT56218.1|2148811_2149531_-	two-component system response regulator	NA	NA	NA	NA	NA
AYT56219.1|2149527_2151213_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYT56220.1|2151435_2152167_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYT56221.1|2152226_2152334_+	hypothetical protein	NA	NA	NA	NA	NA
AYT56222.1|2152314_2153046_-	ABC transporter permease	NA	NA	NA	NA	NA
AYT56223.1|2153029_2153977_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 9
CP029870	Salmonella enterica subsp. enterica serovar Typhi strain 343077_212159 chromosome, complete genome	4795465	2689420	2702812	4795465	tail	Salmonella_phage(70.0%)	11	NA	NA
AYT56653.1|2689420_2689639_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYT56654.1|2689729_2690830_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYT56655.1|2690826_2691312_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYT56656.1|2691308_2694386_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYT56657.1|2694378_2694498_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYT56658.1|2694512_2694815_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYT56659.1|2694869_2695385_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYT56660.1|2695394_2696567_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYT56661.1|2696709_2697282_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYT56662.1|2697959_2699075_+	glycosyltransferase	NA	NA	NA	NA	NA
AYT56663.1|2699155_2702812_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 10
CP029870	Salmonella enterica subsp. enterica serovar Typhi strain 343077_212159 chromosome, complete genome	4795465	3019700	3063403	4795465	bacteriocin,protease,transposase,tRNA	Bacillus_virus(33.33%)	44	NA	NA
AYT56950.1|3019700_3020159_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT56951.1|3020348_3021428_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYT56952.1|3021529_3022693_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYT56953.1|3022714_3023761_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYT56954.1|3024134_3024560_+	hypothetical protein	NA	NA	NA	NA	NA
AYT56955.1|3024585_3025164_+	hypothetical protein	NA	NA	NA	NA	NA
AYT56956.1|3025197_3025872_+	hypothetical protein	NA	NA	NA	NA	NA
AYT56957.1|3025853_3026537_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYT56958.1|3026530_3027187_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYT56959.1|3027291_3027750_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT56960.1|3027938_3029930_-	transketolase	NA	NA	NA	NA	NA
AYT56961.1|3030205_3030964_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYT56962.1|3031064_3031985_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYT56963.1|3032212_3034189_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYT56964.1|3034197_3034329_-	hypothetical protein	NA	NA	NA	NA	NA
AYT56965.1|3034623_3034923_-	membrane protein	NA	NA	NA	NA	NA
AYT56966.1|3034978_3036133_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYT56967.1|3036625_3038020_+	galactose-proton symport	NA	NA	NA	NA	NA
AYT56968.1|3038098_3038596_+	hypothetical protein	NA	NA	NA	NA	NA
AYT56969.1|3038691_3039399_+	endonuclease I	NA	NA	NA	NA	NA
AYT56970.1|3039475_3040207_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYT56971.1|3040226_3041174_+	glutathione synthetase	NA	NA	NA	NA	NA
AYT56972.1|3041389_3041953_+	hypothetical protein	NA	NA	NA	NA	NA
AYT56973.1|3041952_3042369_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYT56974.1|3042415_3043102_-	global regulatory protein	NA	NA	NA	NA	NA
AYT56975.1|3043231_3044212_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYT56976.1|3044229_3044934_+	hypothetical protein	NA	NA	NA	NA	NA
AYT56977.1|3044952_3045519_+	hypothetical protein	NA	NA	NA	NA	NA
AYT56978.1|3045515_3045806_+	hypothetical protein	NA	NA	NA	NA	NA
AYT56979.1|3045813_3046407_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYT56980.1|3046399_3047536_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYT56981.1|3047626_3048634_-	hypothetical protein	NA	NA	NA	NA	NA
AYT56982.1|3048766_3049813_-	L-asparaginase	NA	NA	NA	NA	NA
AYT56983.1|3050131_3050590_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT56984.1|3050712_3051432_-	hypothetical protein	NA	NA	NA	NA	NA
AYT56985.1|3051481_3051808_-	hypothetical protein	NA	NA	NA	NA	NA
AYT56986.1|3051807_3052527_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYT56987.1|3052681_3053734_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYT56988.1|3053761_3054037_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYT56989.1|3054149_3055235_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYT56990.1|3055451_3056708_+	nucleoside permease	NA	NA	NA	NA	NA
AYT56991.1|3059318_3060026_+	hypothetical protein	NA	NA	NA	NA	NA
AYT56992.1|3062615_3062882_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYT56993.1|3063124_3063403_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 11
CP029870	Salmonella enterica subsp. enterica serovar Typhi strain 343077_212159 chromosome, complete genome	4795465	3440858	3478916	4795465	tail,terminase,capsid,transposase,integrase,portal,plate	Salmonella_phage(82.05%)	46	3435822:3435836	3447988:3448002
3435822:3435836	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYT57322.1|3440858_3442505_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYT57323.1|3442644_3442743_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYT57324.1|3442998_3443328_+	hypothetical protein	NA	NA	NA	NA	NA
AYT57325.1|3443368_3444421_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYT57326.1|3444816_3445386_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYT57327.1|3445511_3445733_+	hypothetical protein	NA	NA	NA	NA	NA
AYT57328.1|3445765_3446275_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYT57329.1|3446449_3446674_+	hypothetical protein	NA	NA	NA	NA	NA
AYT57330.1|3446696_3447038_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYT57331.1|3447105_3447339_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYT57332.1|3447338_3447566_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYT57333.1|3447562_3448420_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3447988:3448002	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYT57334.1|3448416_3450831_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYT57335.1|3450984_3451173_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYT57336.1|3453140_3454055_+	hypothetical protein	NA	NA	NA	NA	NA
AYT57337.1|3454051_3454792_+	hypothetical protein	NA	NA	NA	NA	NA
AYT57338.1|3454826_3455864_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYT57339.1|3455863_3457630_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYT57340.1|3457772_3458606_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYT57341.1|3458622_3459681_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYT57342.1|3459684_3460335_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYT57343.1|3460367_3460895_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYT57344.1|3460894_3461098_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYT57345.1|3461101_3461317_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYT57346.1|3461336_3461810_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYT57347.1|3461811_3462189_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYT57348.1|3462185_3462614_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYT57349.1|3462709_3463141_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYT57350.1|3463133_3463580_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYT57351.1|3463648_3464227_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYT57352.1|3464223_3464583_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYT57353.1|3464569_3465478_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYT57354.1|3465470_3466076_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYT57355.1|3466072_3467587_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYT57356.1|3467586_3468180_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYT57357.1|3468151_3468592_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYT57358.1|3469014_3469587_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYT57359.1|3469729_3470902_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYT57360.1|3470911_3471427_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYT57361.1|3471481_3471784_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYT57362.1|3471798_3471918_+	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYT57363.1|3471910_3474988_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYT57364.1|3474984_3475470_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYT57365.1|3475466_3476567_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYT57366.1|3476657_3476876_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYT57367.1|3478457_3478916_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 12
CP029870	Salmonella enterica subsp. enterica serovar Typhi strain 343077_212159 chromosome, complete genome	4795465	4394412	4468589	4795465	tail,terminase,capsid,integrase,portal,plate	Salmonella_phage(82.61%)	75	4455926:4455942	4468748:4468764
AYT58138.1|4394412_4396362_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYT58139.1|4396433_4397342_+	hypothetical protein	NA	NA	NA	NA	NA
AYT58140.1|4397415_4398315_+	hypothetical protein	NA	NA	NA	NA	NA
AYT58141.1|4398356_4398716_+	hypothetical protein	NA	NA	NA	NA	NA
AYT58142.1|4398815_4399085_-	hypothetical protein	NA	NA	NA	NA	NA
AYT58143.1|4399216_4400491_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYT58144.1|4400710_4401088_+	hypothetical protein	NA	NA	NA	NA	NA
AYT58145.1|4401174_4401393_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYT58146.1|4401460_4402561_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYT58147.1|4402557_4403043_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYT58148.1|4403042_4405823_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYT58149.1|4405815_4405935_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYT58150.1|4405949_4406252_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYT58151.1|4406306_4406822_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYT58152.1|4406831_4408004_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYT58153.1|4408538_4409261_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYT58154.1|4409458_4409866_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYT58155.1|4409872_4411492_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYT58156.1|4411488_4412094_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYT58157.1|4412086_4412995_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYT58158.1|4412981_4413341_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYT58159.1|4413337_4413916_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYT58160.1|4413984_4414431_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYT58161.1|4414423_4414855_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
AYT58162.1|4414950_4415376_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYT58163.1|4415375_4415753_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYT58164.1|4415757_4416228_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYT58165.1|4416247_4416463_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYT58166.1|4416466_4416670_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYT58167.1|4416669_4417134_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	97.4	7.1e-84
AYT58168.1|4417227_4417878_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYT58169.1|4417881_4418946_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYT58170.1|4418962_4419796_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYT58171.1|4419938_4421705_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYT58172.1|4421701_4422748_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYT58173.1|4422796_4423492_-	hypothetical protein	NA	NA	NA	NA	NA
AYT58174.1|4423511_4424576_-	hypothetical protein	NA	NA	NA	NA	NA
AYT58175.1|4424572_4425637_-	hypothetical protein	NA	NA	NA	NA	NA
AYT58176.1|4426561_4428970_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.1	0.0e+00
AYT58177.1|4428960_4429821_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYT58178.1|4429817_4430402_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYT58179.1|4430398_4430626_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYT58180.1|4430625_4430859_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYT58181.1|4430926_4431268_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYT58182.1|4431231_4431432_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYT58183.1|4431439_4431949_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYT58184.1|4431981_4432224_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYT58185.1|4432340_4432973_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYT58186.1|4432976_4434002_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYT58187.1|4434108_4434462_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYT58188.1|4435078_4435366_+	hypothetical protein	NA	NA	NA	NA	NA
AYT58189.1|4435376_4436267_+	methyltransferase	NA	NA	NA	NA	NA
AYT58190.1|4436266_4437013_+	hypothetical protein	NA	NA	NA	NA	NA
AYT58191.1|4437314_4439285_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYT58192.1|4439304_4440609_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYT58193.1|4440631_4441327_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYT58194.1|4441352_4442147_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYT58195.1|4442156_4443224_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYT58196.1|4443268_4445005_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYT58197.1|4445004_4447500_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYT58198.1|4447523_4448570_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYT58199.1|4448572_4449850_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYT58200.1|4450094_4450634_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYT58201.1|4451487_4452999_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYT58202.1|4452982_4454572_+	hypothetical protein	NA	NA	NA	NA	NA
AYT58203.1|4454735_4455749_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4455926:4455942	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYT58204.1|4456175_4456469_+	hypothetical protein	NA	NA	NA	NA	NA
AYT58205.1|4456465_4456954_+	hypothetical protein	NA	NA	NA	NA	NA
AYT58206.1|4457133_4457586_-	hypothetical protein	NA	NA	NA	NA	NA
AYT58207.1|4462808_4463270_+	hypothetical protein	NA	NA	NA	NA	NA
AYT58208.1|4463266_4463488_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYT58209.1|4464344_4465127_+	hypothetical protein	NA	NA	NA	NA	NA
AYT58210.1|4465753_4465978_-	hypothetical protein	NA	NA	NA	NA	NA
AYT58211.1|4466107_4467019_-	hypothetical protein	NA	NA	NA	NA	NA
AYT58212.1|4467329_4468589_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4468748:4468764	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 13
CP029870	Salmonella enterica subsp. enterica serovar Typhi strain 343077_212159 chromosome, complete genome	4795465	4610845	4617321	4795465	capsid	Enterobacteria_phage(66.67%)	8	NA	NA
AYT58349.1|4610845_4611922_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYT58350.1|4611918_4612992_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYT58351.1|4612966_4614130_-	hypothetical protein	NA	NA	NA	NA	NA
AYT58352.1|4614405_4614972_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYT58353.1|4614987_4615227_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYT58354.1|4615230_4616091_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYT58355.1|4616513_4616837_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYT58356.1|4616820_4617321_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
