The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029866	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228140 chromosome, complete genome	4790593	930266	937578	4790593	integrase,protease	Dickeya_phage(16.67%)	6	931517:931531	942696:942710
AYT76982.1|930266_931385_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYT76983.1|931381_933328_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931517:931531	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYT76984.1|933457_933679_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYT76985.1|934002_934323_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYT76986.1|934353_936630_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYT76987.1|937200_937578_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942696:942710	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029866	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228140 chromosome, complete genome	4790593	1008517	1085830	4790593	terminase,integrase,protease,tail,transposase	Salmonella_phage(73.33%)	93	990596:990615	1061191:1061210
990596:990615	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYT77037.1|1008517_1009858_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYT77038.1|1009854_1010103_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYT77039.1|1010143_1010389_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYT77040.1|1010388_1011270_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYT77041.1|1011266_1012331_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYT77042.1|1012408_1013089_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYT77043.1|1013085_1013871_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYT77044.1|1013876_1014173_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYT77045.1|1014263_1014464_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYT77046.1|1014752_1015157_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYT77047.1|1015488_1015863_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYT77048.1|1015947_1016931_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYT77049.1|1016933_1017683_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYT77050.1|1017693_1018041_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYT77051.1|1018037_1018562_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYT77052.1|1018561_1019035_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYT77053.1|1019038_1019611_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYT77054.1|1019704_1019971_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYT77055.1|1020052_1020214_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT77056.1|1020646_1021144_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT77057.1|1021328_1021568_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYT77058.1|1021557_1021863_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYT77059.1|1021902_1022505_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYT77060.1|1022713_1023325_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYT77061.1|1023457_1024255_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYT77062.1|1024653_1024779_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT77063.1|1024914_1025364_-	lipoprotein	NA	NA	NA	NA	NA
AYT77064.1|1025580_1025970_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYT77065.1|1025956_1026238_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYT77066.1|1026237_1026852_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYT77067.1|1027071_1027326_+	hypothetical protein	NA	NA	NA	NA	NA
AYT77068.1|1027430_1027808_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYT77069.1|1027871_1028132_+	hypothetical protein	NA	NA	NA	NA	NA
AYT77070.1|1028221_1028974_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYT77071.1|1028939_1030343_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYT77072.1|1030342_1031812_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYT77073.1|1031903_1032434_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYT77074.1|1032448_1033681_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYT77075.1|1033685_1034183_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYT77076.1|1034194_1035136_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYT77077.1|1035177_1035546_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYT77078.1|1035511_1035919_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYT77079.1|1035915_1036470_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYT77080.1|1036456_1036846_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYT77081.1|1036820_1037384_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYT77082.1|1037387_1038533_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYT77083.1|1038544_1038985_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYT77084.1|1038988_1039441_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYT77085.1|1039618_1041571_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYT77086.1|1041570_1042221_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYT77087.1|1042224_1042527_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYT77088.1|1042529_1043561_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYT77089.1|1043557_1043893_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYT77090.1|1044087_1044819_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT77091.1|1044818_1045247_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT77092.1|1045305_1046061_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYT77093.1|1046148_1046286_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYT77094.1|1046301_1046655_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYT77095.1|1046655_1047855_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYT77096.1|1047851_1048532_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYT77097.1|1048531_1050043_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYT77098.1|1050057_1050576_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYT77099.1|1051497_1052199_-	hypothetical protein	NA	NA	NA	NA	NA
AYT77100.1|1052511_1052790_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYT77101.1|1053215_1055828_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYT77102.1|1056035_1057046_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYT77103.1|1057208_1057754_+	hypothetical protein	NA	NA	NA	NA	NA
AYT77104.1|1057750_1058860_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYT77105.1|1058958_1061067_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYT77106.1|1061079_1062987_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061191:1061210	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYT77107.1|1063001_1064255_+	inner membrane protein	NA	NA	NA	NA	NA
AYT77108.1|1064259_1065900_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYT77109.1|1065896_1066460_+	lipoprotein	NA	NA	NA	NA	NA
AYT77110.1|1066713_1066881_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYT77111.1|1066980_1067499_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYT77112.1|1067567_1069328_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYT77113.1|1069513_1069966_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYT77114.1|1070037_1071090_-	outer membrane protein A	NA	NA	NA	NA	NA
AYT77115.1|1071444_1071954_-	cell division inhibitor	NA	NA	NA	NA	NA
AYT77116.1|1072170_1072776_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYT77117.1|1072762_1074916_-	inner membrane protein	NA	NA	NA	NA	NA
AYT77118.1|1074934_1075381_-	hypothetical protein	NA	NA	NA	NA	NA
AYT77119.1|1075504_1077559_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYT77120.1|1077594_1078053_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYT77121.1|1078147_1078810_-	hypothetical protein	NA	NA	NA	NA	NA
AYT77122.1|1078980_1079397_+	hypothetical protein	NA	NA	NA	NA	NA
AYT77123.1|1079441_1079759_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYT77124.1|1079816_1081028_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYT77125.1|1082159_1082618_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT77126.1|1083354_1083636_+	acylphosphatase	NA	NA	NA	NA	NA
AYT77127.1|1083632_1083962_-	sulfite reductase	NA	NA	NA	NA	NA
AYT77128.1|1084048_1084708_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYT77129.1|1085371_1085830_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029866	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228140 chromosome, complete genome	4790593	1530385	1603499	4790593	tRNA,protease,tail,transposase,plate,head	Burkholderia_virus(43.24%)	80	NA	NA
AYT77533.1|1530385_1530844_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT77534.1|1531346_1531628_+	stress response protein	NA	NA	NA	NA	NA
AYT77535.1|1531896_1532718_+|protease	serine protease	protease	NA	NA	NA	NA
AYT77536.1|1532752_1533082_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYT77537.1|1533068_1533431_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYT77538.1|1533542_1533713_-	hypothetical protein	NA	NA	NA	NA	NA
AYT77539.1|1533847_1534882_+	hypothetical protein	NA	NA	NA	NA	NA
AYT77540.1|1535056_1536445_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYT77541.1|1536455_1537985_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYT77542.1|1538511_1539456_+	hypothetical protein	NA	NA	NA	NA	NA
AYT77543.1|1539637_1540027_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYT77544.1|1539998_1540451_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYT77545.1|1540645_1540876_-	hypothetical protein	NA	NA	NA	NA	NA
AYT77546.1|1540872_1541556_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYT77547.1|1541552_1541768_-	hypothetical protein	NA	NA	NA	NA	NA
AYT77548.1|1541760_1542144_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYT77549.1|1542140_1542443_-	hypothetical protein	NA	NA	NA	NA	NA
AYT77550.1|1542452_1542725_-	hypothetical protein	NA	NA	NA	NA	NA
AYT77551.1|1543013_1543544_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYT77552.1|1543571_1543841_-	hypothetical protein	NA	NA	NA	NA	NA
AYT77553.1|1543843_1545010_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYT77554.1|1545020_1546790_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYT77555.1|1546967_1547399_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYT77556.1|1547394_1547991_+	hypothetical protein	NA	NA	NA	NA	NA
AYT77557.1|1548234_1548585_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYT77558.1|1549299_1549950_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYT77559.1|1549946_1550273_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYT77560.1|1550272_1550584_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYT77561.1|1550583_1551129_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYT77562.1|1551125_1552721_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYT77563.1|1552720_1554217_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYT77564.1|1554197_1555019_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYT77565.1|1555021_1555480_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYT77566.1|1555694_1556810_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYT77567.1|1556824_1557778_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYT77568.1|1557787_1558126_+	hypothetical protein	NA	NA	NA	NA	NA
AYT77569.1|1558127_1558574_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYT77570.1|1558573_1559038_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYT77571.1|1559034_1559289_+	hypothetical protein	NA	NA	NA	NA	NA
AYT77572.1|1559278_1560706_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYT77573.1|1560705_1561227_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYT77574.1|1561229_1561511_+	hypothetical protein	NA	NA	NA	NA	NA
AYT77575.1|1561608_1561944_+	hypothetical protein	NA	NA	NA	NA	NA
AYT77576.1|1562119_1564585_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYT77577.1|1564584_1565469_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYT77578.1|1565465_1565681_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYT77579.1|1565668_1566823_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYT77580.1|1566819_1567347_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYT77581.1|1567403_1567751_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYT77582.1|1567741_1568845_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYT77583.1|1568837_1569416_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYT77584.1|1569418_1570444_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYT77585.1|1570957_1571575_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYT77586.1|1572601_1573174_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYT77587.1|1573454_1574837_+	amino acid permease	NA	NA	NA	NA	NA
AYT77588.1|1574898_1575234_-	hypothetical protein	NA	NA	NA	NA	NA
AYT77589.1|1575360_1576092_+	two-component response regulator	NA	NA	NA	NA	NA
AYT77590.1|1576572_1577724_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYT77591.1|1577876_1579583_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYT77592.1|1579690_1580995_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYT77593.1|1581070_1582000_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYT77594.1|1581996_1583400_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYT77595.1|1583567_1585214_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYT77596.1|1585413_1586589_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYT77597.1|1586691_1588200_+	hypothetical protein	NA	NA	NA	NA	NA
AYT77598.1|1588905_1589907_+	adenosine deaminase	NA	NA	NA	NA	NA
AYT77599.1|1589980_1591096_-	oxidoreductase	NA	NA	NA	NA	NA
AYT77600.1|1591198_1591354_+	hypothetical protein	NA	NA	NA	NA	NA
AYT77601.1|1591652_1591868_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYT77602.1|1591956_1592397_+	hypothetical protein	NA	NA	NA	NA	NA
AYT77603.1|1592473_1593055_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYT77604.1|1593054_1593633_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYT77605.1|1593625_1595647_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYT77606.1|1595647_1596706_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYT77607.1|1596709_1597330_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYT77608.1|1597332_1598025_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYT77609.1|1598024_1598660_+	endonuclease III	NA	NA	NA	NA	NA
AYT77610.1|1599260_1600766_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYT77611.1|1600870_1601476_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYT77612.1|1602224_1603499_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029866	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228140 chromosome, complete genome	4790593	1691005	1754870	4790593	tRNA,terminase,capsid,tail,transposase,plate,portal	Enterobacteria_phage(75.0%)	74	NA	NA
AYT77699.1|1691005_1691755_-	vitamin B12 ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	4.6e-08
AYT77700.1|1691754_1692306_-	glutathione peroxidase	NA	NA	NA	NA	NA
AYT77701.1|1692397_1693378_-	vitamin B12 ABC transporter permease	NA	NA	NA	NA	NA
AYT77702.1|1693585_1693915_-	hypothetical protein	NA	NA	NA	NA	NA
AYT77703.1|1694022_1694385_-	hypothetical protein	NA	NA	NA	NA	NA
AYT77704.1|1694387_1695515_-	Integrase	NA	A0A0M4RTQ0	Salmonella_phage	51.4	7.0e-85
AYT77705.1|1695817_1696096_+	DNA-binding protein	NA	NA	NA	NA	NA
AYT77706.1|1696110_1696449_+	hypothetical protein	NA	A0A0A7NV42	Enterobacteria_phage	82.8	1.1e-46
AYT77707.1|1696459_1696738_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	4.5e-33
AYT77708.1|1696749_1696992_+	hypothetical protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AYT77709.1|1696988_1697102_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	94.6	3.6e-10
AYT77710.1|1697189_1697393_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	82.1	3.3e-25
AYT77711.1|1697389_1697608_+	hypothetical protein	NA	NA	NA	NA	NA
AYT77712.1|1697716_1698106_+	hypothetical protein	NA	NA	NA	NA	NA
AYT77713.1|1698102_1700943_+	Phage replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
AYT77714.1|1701019_1701979_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	1.3e-177
AYT77715.1|1701983_1702298_+	Plasmid stability protein	NA	A0A0A7NPT5	Enterobacteria_phage	51.4	9.2e-19
AYT77716.1|1702381_1703224_-	hypothetical protein	NA	NA	NA	NA	NA
AYT77717.1|1703263_1703761_-	hypothetical protein	NA	NA	NA	NA	NA
AYT77718.1|1704409_1705456_-|portal	Presumed portal vertex protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
AYT77719.1|1705455_1707207_-|terminase	Phage terminase ATPase subunit	terminase	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
AYT77720.1|1707361_1708198_+|capsid	Phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.2	7.2e-119
AYT77721.1|1708221_1709274_+|capsid	Phage major capsid protein	capsid	A0A0A7NQ82	Enterobacteria_phage	99.7	1.5e-198
AYT77722.1|1709319_1710120_+|terminase	Phage terminase endonuclease subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	98.1	7.8e-139
AYT77723.1|1710221_1710716_+	Head completion/stabilization protein	NA	A0A0A7NPU2	Enterobacteria_phage	98.8	3.0e-88
AYT77724.1|1710715_1710916_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
AYT77725.1|1710918_1711242_+	hypothetical protein	NA	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
AYT77726.1|1711238_1711631_+	peptidase M15	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
AYT77727.1|1711627_1712035_+	hypothetical protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.0	6.5e-65
AYT77728.1|1712172_1712640_+|tail	tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
AYT77729.1|1712623_1713268_+|tail	Phage tail completion protein	tail	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
AYT77730.1|1713264_1713846_+|plate	Baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	8.6e-103
AYT77731.1|1713842_1714193_+|plate	Phage baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
AYT77732.1|1714196_1715093_+|plate	Baseplate assembly protein J	plate	A0A0A7NPY5	Enterobacteria_phage	99.0	1.2e-156
AYT77733.1|1715085_1715616_+|tail	Phage tail fiber	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	2.1e-92
AYT77734.1|1715618_1717721_+|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	59.6	3.2e-200
AYT77735.1|1717723_1718257_+|tail	Phage tail fiber	tail	C9DGR0	Escherichia_phage	98.9	3.2e-96
AYT77736.1|1718285_1718813_-|tail	Phage tail fiber	tail	A0A0C4UR05	Shigella_phage	94.9	8.9e-91
AYT77737.1|1718814_1719780_-	hypothetical protein	NA	A0A0C4UQV0	Shigella_phage	94.1	8.4e-180
AYT77738.1|1719902_1720490_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	97.9	2.3e-103
AYT77739.1|1720525_1721014_-|tail	tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
AYT77740.1|1721026_1723834_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	98.1	0.0e+00
AYT77741.1|1723984_1724359_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
AYT77742.1|1724414_1724927_-|tail	tail protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
AYT77743.1|1724926_1726111_-|tail	tail protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	3.4e-223
AYT77744.1|1726268_1727372_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.8	1.1e-194
AYT77745.1|1727536_1728172_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
AYT77746.1|1728168_1729281_-	molybdenum cofactor biosynthesis protein A	NA	NA	NA	NA	NA
AYT77747.1|1729273_1730662_-	Chondro-6-sulfatase	NA	S5VT21	Leptospira_phage	27.4	1.3e-48
AYT77748.1|1730661_1730934_-	His-Xaa-Ser system protein HsxD	NA	NA	NA	NA	NA
AYT77749.1|1731186_1731447_+	hypothetical protein	NA	NA	NA	NA	NA
AYT77750.1|1731637_1731778_+	hok/gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
AYT77751.1|1732186_1732486_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AYT77752.1|1732490_1734878_-|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AYT77753.1|1734893_1735877_-|tRNA	phenylalanyl-tRNA synthetase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
AYT77754.1|1736178_1736535_-	50S ribosomal subunit protein L20	NA	NA	NA	NA	NA
AYT77755.1|1736585_1736783_-	50S ribosomal subunit protein L35	NA	NA	NA	NA	NA
AYT77756.1|1736878_1737421_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	6.3e-15
AYT77757.1|1737424_1739353_-|tRNA	threonyl-tRNA synthetase	tRNA	A0A2K9L297	Tupanvirus	37.6	1.6e-129
AYT77758.1|1739935_1740064_+	hypothetical protein	NA	NA	NA	NA	NA
AYT77759.1|1740244_1741468_+	O-antigen polymerase	NA	NA	NA	NA	NA
AYT77760.1|1743021_1743336_-	hypothetical protein	NA	NA	NA	NA	NA
AYT77761.1|1743478_1744438_+	outer membrane protein	NA	NA	NA	NA	NA
AYT77762.1|1744486_1745245_-	outer membrane protein	NA	NA	NA	NA	NA
AYT77763.1|1745533_1746466_+	6-phosphofructokinase isozyme	NA	NA	NA	NA	NA
AYT77764.1|1746562_1746853_+	hypothetical protein	NA	NA	NA	NA	NA
AYT77765.1|1746959_1747820_+	hypothetical protein	NA	NA	NA	NA	NA
AYT77766.1|1747862_1748399_-	hypothetical protein	NA	NA	NA	NA	NA
AYT77767.1|1748547_1749216_+	hydrolase	NA	NA	NA	NA	NA
AYT77768.1|1749353_1749953_+	hypothetical protein	NA	NA	NA	NA	NA
AYT77769.1|1750089_1751481_+	sodium:dicarboxylate symporter	NA	NA	NA	NA	NA
AYT77770.1|1751583_1751826_-	cell division activator CedA	NA	NA	NA	NA	NA
AYT77771.1|1752042_1754295_+	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	50.0	1.3e-143
AYT77772.1|1754411_1754870_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 5
CP029866	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228140 chromosome, complete genome	4790593	1823143	1827555	4790593		Escherichia_phage(50.0%)	6	NA	NA
AYT77843.1|1823143_1823383_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
AYT77844.1|1824255_1825065_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYT77845.1|1825137_1825515_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYT77846.1|1825662_1826205_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYT77847.1|1826396_1827125_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYT77848.1|1827141_1827555_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 6
CP029866	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228140 chromosome, complete genome	4790593	2031435	2038669	4790593		Morganella_phage(33.33%)	7	NA	NA
AYT78038.1|2031435_2032866_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYT78039.1|2032939_2033635_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYT78040.1|2033714_2034026_-	hypothetical protein	NA	NA	NA	NA	NA
AYT78041.1|2034676_2035861_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYT78042.1|2036320_2036533_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYT78043.1|2036978_2038247_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYT78044.1|2038249_2038669_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 7
CP029866	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228140 chromosome, complete genome	4790593	2122411	2132918	4790593		Enterobacteria_phage(37.5%)	10	NA	NA
AYT78121.1|2122411_2123725_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYT78122.1|2123751_2124831_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYT78123.1|2124835_2125609_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYT78124.1|2125624_2126599_-	reductase RfbI	NA	NA	NA	NA	NA
AYT78125.1|2126604_2127156_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYT78126.1|2127156_2128035_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYT78127.1|2128082_2128982_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYT78128.1|2128981_2130067_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYT78129.1|2130443_2131337_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYT78130.1|2131514_2132918_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 8
CP029866	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228140 chromosome, complete genome	4790593	2208810	2217981	4790593	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYT78188.1|2208810_2210844_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYT78189.1|2211084_2211543_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYT78190.1|2211714_2212245_+	lipoprotein	NA	NA	NA	NA	NA
AYT78191.1|2212301_2212769_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYT78192.1|2212815_2213535_-	two-component system response regulator	NA	NA	NA	NA	NA
AYT78193.1|2213531_2215217_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYT78194.1|2215439_2216171_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYT78195.1|2216230_2216338_+	hypothetical protein	NA	NA	NA	NA	NA
AYT78196.1|2216318_2217050_-	ABC transporter permease	NA	NA	NA	NA	NA
AYT78197.1|2217033_2217981_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 9
CP029866	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228140 chromosome, complete genome	4790593	2753424	2766816	4790593	tail	Salmonella_phage(70.0%)	11	NA	NA
AYT78626.1|2753424_2753643_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYT78627.1|2753733_2754834_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYT78628.1|2754830_2755316_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYT78629.1|2755312_2758390_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYT78630.1|2758382_2758502_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYT78631.1|2758516_2758819_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYT78632.1|2758873_2759389_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYT78633.1|2759398_2760571_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYT78634.1|2760713_2761286_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYT78635.1|2761963_2763079_+	glycosyltransferase	NA	NA	NA	NA	NA
AYT78636.1|2763159_2766816_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 10
CP029866	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228140 chromosome, complete genome	4790593	3084285	3127988	4790593	bacteriocin,tRNA,transposase,protease	Bacillus_virus(33.33%)	44	NA	NA
AYT78925.1|3084285_3084744_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT78926.1|3084933_3086013_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYT78927.1|3086114_3087278_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYT78928.1|3087299_3088346_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYT78929.1|3088719_3089145_+	hypothetical protein	NA	NA	NA	NA	NA
AYT78930.1|3089170_3089749_+	hypothetical protein	NA	NA	NA	NA	NA
AYT78931.1|3089782_3090457_+	hypothetical protein	NA	NA	NA	NA	NA
AYT78932.1|3090438_3091122_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYT78933.1|3091115_3091772_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYT78934.1|3091876_3092335_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT78935.1|3092523_3094515_-	transketolase	NA	NA	NA	NA	NA
AYT78936.1|3094790_3095549_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYT78937.1|3095649_3096570_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYT78938.1|3096797_3098774_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYT78939.1|3098782_3098914_-	hypothetical protein	NA	NA	NA	NA	NA
AYT78940.1|3099208_3099508_-	membrane protein	NA	NA	NA	NA	NA
AYT78941.1|3099563_3100718_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYT78942.1|3101210_3102605_+	galactose-proton symport	NA	NA	NA	NA	NA
AYT78943.1|3102683_3103181_+	hypothetical protein	NA	NA	NA	NA	NA
AYT78944.1|3103276_3103984_+	endonuclease I	NA	NA	NA	NA	NA
AYT78945.1|3104060_3104792_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYT78946.1|3104811_3105759_+	glutathione synthetase	NA	NA	NA	NA	NA
AYT78947.1|3105974_3106538_+	hypothetical protein	NA	NA	NA	NA	NA
AYT78948.1|3106537_3106954_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYT78949.1|3107000_3107687_-	global regulatory protein	NA	NA	NA	NA	NA
AYT78950.1|3107816_3108797_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYT78951.1|3108814_3109519_+	hypothetical protein	NA	NA	NA	NA	NA
AYT78952.1|3109537_3110104_+	hypothetical protein	NA	NA	NA	NA	NA
AYT78953.1|3110100_3110391_+	hypothetical protein	NA	NA	NA	NA	NA
AYT78954.1|3110398_3110992_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYT78955.1|3110984_3112121_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYT78956.1|3112211_3113219_-	hypothetical protein	NA	NA	NA	NA	NA
AYT78957.1|3113351_3114398_-	L-asparaginase	NA	NA	NA	NA	NA
AYT78958.1|3114716_3115175_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT78959.1|3115297_3116017_-	hypothetical protein	NA	NA	NA	NA	NA
AYT78960.1|3116066_3116393_-	hypothetical protein	NA	NA	NA	NA	NA
AYT78961.1|3116392_3117112_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYT78962.1|3117266_3118319_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYT78963.1|3118346_3118622_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYT78964.1|3118734_3119820_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYT78965.1|3120036_3121293_+	nucleoside permease	NA	NA	NA	NA	NA
AYT78966.1|3123903_3124611_+	hypothetical protein	NA	NA	NA	NA	NA
AYT78967.1|3127200_3127467_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYT78968.1|3127709_3127988_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 11
CP029866	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228140 chromosome, complete genome	4790593	3496613	3534671	4790593	terminase,integrase,capsid,tail,transposase,plate,portal	Salmonella_phage(82.05%)	46	3491577:3491591	3503743:3503757
3491577:3491591	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYT79290.1|3496613_3498260_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYT79291.1|3498399_3498498_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYT79292.1|3498753_3499083_+	hypothetical protein	NA	NA	NA	NA	NA
AYT79293.1|3499123_3500176_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYT79294.1|3500571_3501141_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYT79295.1|3501266_3501488_+	hypothetical protein	NA	NA	NA	NA	NA
AYT79296.1|3501520_3502030_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYT79297.1|3502204_3502429_+	hypothetical protein	NA	NA	NA	NA	NA
AYT79298.1|3502451_3502793_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYT79299.1|3502860_3503094_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYT79300.1|3503093_3503321_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYT79301.1|3503317_3504175_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3503743:3503757	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYT79302.1|3504171_3506586_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYT79303.1|3506739_3506928_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYT79304.1|3508895_3509810_+	hypothetical protein	NA	NA	NA	NA	NA
AYT79305.1|3509806_3510547_+	hypothetical protein	NA	NA	NA	NA	NA
AYT79306.1|3510581_3511619_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYT79307.1|3511618_3513385_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYT79308.1|3513527_3514361_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYT79309.1|3514377_3515436_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYT79310.1|3515439_3516090_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYT79311.1|3516122_3516650_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYT79312.1|3516649_3516853_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYT79313.1|3516856_3517072_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYT79314.1|3517091_3517565_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYT79315.1|3517566_3517944_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYT79316.1|3517940_3518369_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYT79317.1|3518464_3518896_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYT79318.1|3518888_3519335_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYT79319.1|3519403_3519982_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYT79320.1|3519978_3520338_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYT79321.1|3520324_3521233_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYT79322.1|3521225_3521831_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYT79323.1|3521827_3523342_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.0	4.4e-199
AYT79324.1|3523341_3523935_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYT79325.1|3523906_3524347_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYT79326.1|3524769_3525342_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYT79327.1|3525484_3526657_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYT79328.1|3526666_3527182_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYT79329.1|3527236_3527539_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYT79330.1|3527553_3527673_+	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYT79331.1|3527665_3530743_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYT79332.1|3530739_3531225_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYT79333.1|3531221_3532322_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYT79334.1|3532412_3532631_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYT79335.1|3534212_3534671_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 12
CP029866	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228140 chromosome, complete genome	4790593	4450176	4524446	4790593	terminase,integrase,capsid,tail,plate,portal	Salmonella_phage(82.61%)	75	4511690:4511706	4524605:4524621
AYT80107.1|4450176_4452126_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYT80108.1|4452197_4453106_+	hypothetical protein	NA	NA	NA	NA	NA
AYT80109.1|4453179_4454079_+	hypothetical protein	NA	NA	NA	NA	NA
AYT80110.1|4454120_4454480_+	hypothetical protein	NA	NA	NA	NA	NA
AYT80111.1|4454579_4454849_-	hypothetical protein	NA	NA	NA	NA	NA
AYT80112.1|4454980_4456255_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYT80113.1|4456474_4456852_+	hypothetical protein	NA	NA	NA	NA	NA
AYT80114.1|4456938_4457157_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYT80115.1|4457224_4458325_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYT80116.1|4458321_4458807_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYT80117.1|4458806_4461587_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYT80118.1|4461579_4461699_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYT80119.1|4461713_4462016_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYT80120.1|4462070_4462586_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYT80121.1|4462595_4463768_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYT80122.1|4464302_4465025_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYT80123.1|4465222_4465630_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYT80124.1|4465636_4467256_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYT80125.1|4467252_4467858_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYT80126.1|4467850_4468759_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYT80127.1|4468745_4469105_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYT80128.1|4469101_4469680_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYT80129.1|4469748_4470195_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYT80130.1|4470187_4470619_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
AYT80131.1|4470714_4471140_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYT80132.1|4471139_4471517_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYT80133.1|4471521_4471992_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYT80134.1|4472011_4472227_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYT80135.1|4472230_4472434_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYT80136.1|4472433_4472898_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYT80137.1|4472991_4473642_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYT80138.1|4473645_4474710_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYT80139.1|4474726_4475560_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYT80140.1|4475702_4477469_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYT80141.1|4477465_4478512_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYT80142.1|4478560_4479256_-	hypothetical protein	NA	NA	NA	NA	NA
AYT80143.1|4479275_4480340_-	hypothetical protein	NA	NA	NA	NA	NA
AYT80144.1|4480336_4481401_-	hypothetical protein	NA	NA	NA	NA	NA
AYT80145.1|4482325_4484734_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.1	0.0e+00
AYT80146.1|4484724_4485585_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYT80147.1|4485581_4486166_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYT80148.1|4486162_4486390_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYT80149.1|4486389_4486623_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYT80150.1|4486690_4487032_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYT80151.1|4486995_4487196_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYT80152.1|4487203_4487713_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYT80153.1|4487745_4487988_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYT80154.1|4488104_4488737_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYT80155.1|4488740_4489766_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYT80156.1|4489872_4490226_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYT80157.1|4490842_4491130_+	hypothetical protein	NA	NA	NA	NA	NA
AYT80158.1|4491140_4492031_+	methyltransferase	NA	NA	NA	NA	NA
AYT80159.1|4492030_4492777_+	hypothetical protein	NA	NA	NA	NA	NA
AYT80160.1|4493078_4495049_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYT80161.1|4495068_4496373_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYT80162.1|4496395_4497091_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYT80163.1|4497116_4497911_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYT80164.1|4497920_4498988_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYT80165.1|4499032_4500769_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYT80166.1|4500768_4503264_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYT80167.1|4503287_4504334_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYT80168.1|4504336_4505614_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYT80169.1|4505858_4506398_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYT80170.1|4507251_4508763_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYT80171.1|4508746_4510336_+	hypothetical protein	NA	NA	NA	NA	NA
AYT80172.1|4510499_4511513_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4511690:4511706	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYT80173.1|4511939_4512233_+	hypothetical protein	NA	NA	NA	NA	NA
AYT80174.1|4512229_4512718_+	hypothetical protein	NA	NA	NA	NA	NA
AYT80175.1|4512897_4513350_-	hypothetical protein	NA	NA	NA	NA	NA
AYT80176.1|4518572_4519034_+	hypothetical protein	NA	NA	NA	NA	NA
AYT80177.1|4519030_4519252_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYT80178.1|4520108_4520891_+	hypothetical protein	NA	NA	NA	NA	NA
AYT80179.1|4521517_4521742_-	hypothetical protein	NA	NA	NA	NA	NA
AYT80180.1|4521871_4522876_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYT80181.1|4523186_4524446_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4524605:4524621	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 13
CP029866	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228140 chromosome, complete genome	4790593	4666699	4673175	4790593	capsid	Enterobacteria_phage(66.67%)	8	NA	NA
AYT80318.1|4666699_4667776_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYT80319.1|4667772_4668846_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYT80320.1|4668820_4669984_-	hypothetical protein	NA	NA	NA	NA	NA
AYT80321.1|4670259_4670826_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYT80322.1|4670841_4671081_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYT80323.1|4671084_4671945_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYT80324.1|4672367_4672691_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYT80325.1|4672674_4673175_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
>prophage 1
CP029867	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228140 plasmid pHCM2, complete sequence	106706	71	79066	106706	tail	Salmonella_phage(94.57%)	94	NA	NA
AYT80420.1|71_377_-	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	97.0	2.0e-50
AYT80421.1|803_1889_+	exonuclease	NA	J9Q7S9	Salmonella_phage	98.9	2.7e-206
AYT80422.1|1885_2122_+	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
AYT80423.1|2118_4035_+	exonuclease	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
AYT80424.1|4024_4771_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.0	4.4e-136
AYT80425.1|4783_5353_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	1.7e-103
AYT80426.1|5430_7746_+	ribonucleotide-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
AYT80427.1|7853_8996_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.5	2.4e-218
AYT80428.1|9078_10008_+	hypothetical protein	NA	J9Q742	Salmonella_phage	99.0	3.8e-161
AYT80429.1|10123_11239_+	putative thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.1	7.6e-217
AYT80430.1|11240_11654_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
AYT80431.1|11650_12127_+	hypothetical protein	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
AYT80432.1|12126_12771_+	hypothetical protein	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
AYT80433.1|12834_13254_+	hypothetical protein	NA	J9Q743	Salmonella_phage	98.6	2.9e-68
AYT80434.1|13263_13821_+	hypothetical protein	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
AYT80435.1|13865_14792_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	85.4	4.1e-107
AYT80436.1|14977_15571_+	hypothetical protein	NA	J9Q7T2	Salmonella_phage	99.5	4.6e-112
AYT80437.1|15773_16004_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
AYT80438.1|16589_17198_+	putative ribonuclease H	NA	J9Q745	Salmonella_phage	99.5	2.2e-117
AYT80439.1|17340_17835_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	96.3	1.9e-79
AYT80440.1|17844_18033_+	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
AYT80441.1|18141_18984_+	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
AYT80442.1|19092_19665_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	8.2e-98
AYT80443.1|19788_21492_+	putative DNA modification methylase	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
AYT80444.1|21550_22240_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	98.3	6.1e-124
AYT80445.1|22236_22410_+	hypothetical protein	NA	J9Q801	Salmonella_phage	98.2	9.5e-26
AYT80446.1|22520_22892_+	hypothetical protein	NA	J9Q7T4	Salmonella_phage	99.2	9.4e-63
AYT80447.1|22983_23625_+	hypothetical protein	NA	J9Q7H7	Salmonella_phage	100.0	9.7e-116
AYT80448.1|23621_24164_+	hypothetical protein	NA	J9Q748	Salmonella_phage	93.1	2.6e-93
AYT80449.1|24175_24484_+	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	56.9	3.0e-14
AYT80450.1|24480_24768_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	58.8	9.9e-28
AYT80451.1|24828_25032_-	hypothetical protein	NA	J9Q802	Salmonella_phage	95.5	1.5e-30
AYT80452.1|25205_25487_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.6	3.2e-31
AYT80453.1|25571_25889_+	hypothetical protein	NA	J9Q750	Salmonella_phage	80.0	8.1e-47
AYT80454.1|25898_27089_+	hypothetical protein	NA	J9Q803	Salmonella_phage	54.6	5.4e-120
AYT80455.1|28525_28771_-	hypothetical protein	NA	J9Q751	Salmonella_phage	92.5	5.8e-37
AYT80456.1|28913_29129_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	95.8	4.5e-33
AYT80457.1|29139_29358_+	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
AYT80458.1|29452_29767_+	hypothetical protein	NA	NA	NA	NA	NA
AYT80459.1|29843_30155_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	92.2	1.1e-45
AYT80460.1|30283_30676_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	65.4	1.7e-41
AYT80461.1|30796_31084_+	hypothetical protein	NA	J9Q753	Salmonella_phage	94.6	1.5e-47
AYT80462.1|31289_31772_+	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	5.5e-87
AYT80463.1|32403_32631_-	hypothetical protein	NA	NA	NA	NA	NA
AYT80464.1|32715_33366_-	hypothetical protein	NA	J9Q754	Salmonella_phage	100.0	1.4e-114
AYT80465.1|34000_34528_-	putative transcriptional regulator	NA	J9Q6L0	Salmonella_phage	96.6	4.1e-80
AYT80466.1|34532_34955_-	putative lipoprotein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
AYT80467.1|35014_35293_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
AYT80468.1|35295_36855_-	putative helicase	NA	J9Q7I4	Salmonella_phage	99.4	5.7e-295
AYT80469.1|36937_37618_+	hypothetical protein	NA	J9Q756	Salmonella_phage	99.6	7.4e-122
AYT80470.1|37617_38286_+	hypothetical protein	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
AYT80471.1|38282_38921_+	putative ABC transporter ATP-binding protein	NA	J9Q807	Salmonella_phage	99.1	5.5e-111
AYT80472.1|38913_39168_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AYT80473.1|39164_40064_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	4.0e-168
AYT80474.1|40073_40340_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
AYT80475.1|40535_41177_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	99.5	1.8e-109
AYT80476.1|41179_42436_+	hypothetical protein	NA	J9Q7Y2	Salmonella_phage	99.8	5.3e-251
AYT80477.1|42469_44044_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	3.2e-301
AYT80478.1|44066_44963_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.6	5.7e-146
AYT80479.1|44989_45865_+	hypothetical protein	NA	J9Q710	Salmonella_phage	100.0	3.8e-163
AYT80480.1|45939_46863_+	hypothetical protein	NA	J9Q6D6	Salmonella_phage	100.0	3.3e-157
AYT80481.1|46906_47341_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
AYT80482.1|47340_48174_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	100.0	2.6e-153
AYT80483.1|48271_48616_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
AYT80484.1|48606_49080_+	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
AYT80485.1|49081_49465_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
AYT80486.1|49539_50286_+	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	96.8	7.8e-125
AYT80487.1|50345_50663_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
AYT80488.1|50743_51013_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AYT80489.1|51020_55604_+	hypothetical protein	NA	J9Q712	Salmonella_phage	92.9	0.0e+00
AYT80490.1|55645_55981_+	hypothetical protein	NA	J9Q6E1	Salmonella_phage	97.3	5.7e-59
AYT80491.1|56037_56769_+|tail	putative phage tail protein	tail	J9Q7Y5	Salmonella_phage	99.1	3.3e-136
AYT80492.1|56761_57559_+	hypothetical protein	NA	J9Q7R4	Salmonella_phage	95.8	1.2e-155
AYT80493.1|57546_58134_+|tail	putative phage tail protein	tail	J9Q7F8	Salmonella_phage	92.3	1.1e-102
AYT80494.1|58148_62537_+|tail	putative phage tail protein	tail	J9Q713	Salmonella_phage	86.7	0.0e+00
AYT80495.1|62619_65172_+	hypothetical protein	NA	A0A0A0YQM3	Citrobacter_virus	52.5	1.4e-152
AYT80496.1|65286_65610_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	2.7e-50
AYT80497.1|65596_66316_+	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	95.7	1.5e-125
AYT80498.1|66384_66729_+	hypothetical protein	NA	J9Q7G2	Salmonella_phage	83.6	5.9e-27
AYT80499.1|66779_67331_-	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	39.8	7.8e-29
AYT80500.1|67661_68327_+	hypothetical protein	NA	J9Q7R7	Salmonella_phage	95.0	8.0e-113
AYT80501.1|68326_68686_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
AYT80502.1|68734_69490_+	hypothetical protein	NA	J9Q7Y9	Salmonella_phage	43.0	3.2e-57
AYT80503.1|69559_70615_-	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	42.6	5.1e-61
AYT80504.1|70892_71618_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.3	2.4e-139
AYT80505.1|71678_73019_+	putative DNA helicase	NA	J9Q7G4	Salmonella_phage	99.6	3.8e-247
AYT80506.1|73081_74293_+	hypothetical protein	NA	J9Q720	Salmonella_phage	96.5	6.6e-214
AYT80507.1|74294_75347_-	hypothetical protein	NA	J9Q6F5	Salmonella_phage	56.7	1.9e-92
AYT80508.1|75530_76325_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.2	4.9e-141
AYT80509.1|76625_76883_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	92.9	4.9e-34
AYT80510.1|76917_78240_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.4	5.8e-256
AYT80511.1|78405_78612_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	8.1e-32
AYT80512.1|78611_78764_+	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	96.0	7.6e-19
AYT80513.1|78760_79066_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
>prophage 2
CP029867	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228140 plasmid pHCM2, complete sequence	106706	87556	106176	106706		Salmonella_phage(100.0%)	18	NA	NA
AYT80526.1|87556_89914_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	90.7	0.0e+00
AYT80527.1|90010_91246_+	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	99.5	1.8e-238
AYT80528.1|91426_94945_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.1	0.0e+00
AYT80529.1|94941_95385_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	97.9	3.0e-71
AYT80530.1|95478_96069_-	hypothetical protein	NA	NA	NA	NA	NA
AYT80531.1|96314_96746_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	100.0	4.0e-73
AYT80532.1|96865_97894_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.8	1.1e-164
AYT80533.1|97954_98899_+	exonuclease	NA	J9Q7S6	Salmonella_phage	99.4	6.8e-182
AYT80534.1|98898_99165_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AYT80535.1|99167_100244_+	putative recombinase	NA	J9Q736	Salmonella_phage	99.7	5.5e-204
AYT80536.1|100539_101382_+	putative lipoprotein	NA	J9Q7Z4	Salmonella_phage	97.1	2.3e-125
AYT80537.1|101544_101916_+	hypothetical protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
AYT80538.1|101899_102310_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.1	1.4e-75
AYT80539.1|102378_102654_+	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.9e-46
AYT80540.1|102694_103000_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	90.8	4.9e-33
AYT80541.1|102999_103203_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	4.0e-31
AYT80542.1|103731_104787_-	putative replication protein A	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
AYT80543.1|105531_106176_+	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	2.4e-122
