The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030240	Escherichia coli strain ER1709 chromosome, complete genome	4582842	25223	36433	4582842	integrase,tail	Enterobacteria_phage(56.25%)	16	23198:23214	40108:40124
23198:23214	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
AYR80120.1|25223_26156_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
AYR80121.1|26467_27625_+|integrase	integrase	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
AYR80122.1|27777_28140_+	glucose translocase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
AYR80123.1|28136_29057_+	glycosyltransferase	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
AYR80124.1|29053_30385_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
AYR80125.1|30683_31028_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	86.2	3.1e-44
AYR80126.1|30999_31440_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
AYR84214.1|31466_31985_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
AYR80127.1|32034_32310_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
AYR80128.1|32309_32804_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
AYR80129.1|33526_33889_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
AYR80130.1|33954_34779_+	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
AYR80131.1|34906_35443_+	HD family hydrolase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
AYR80132.1|35433_35796_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
AYR80133.1|35795_36101_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
AYR80134.1|36232_36433_+	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
40108:40124	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 2
CP030240	Escherichia coli strain ER1709 chromosome, complete genome	4582842	417002	424141	4582842		Escherichia_phage(83.33%)	6	NA	NA
AYR80471.1|417002_419564_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
AYR80472.1|419669_420326_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
AYR80473.1|420376_421144_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
AYR80474.1|421339_422248_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
AYR80475.1|422244_423411_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
AYR80476.1|423502_424141_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	3.1e-82
>prophage 3
CP030240	Escherichia coli strain ER1709 chromosome, complete genome	4582842	2448582	2509474	4582842	holin,transposase	Escherichia_phage(18.18%)	58	NA	NA
AYR82275.1|2448582_2449734_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
AYR82276.1|2450095_2450533_-	hypothetical protein	NA	NA	NA	NA	NA
AYR82277.1|2451932_2452043_+	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	100.0	4.5e-13
AYR82278.1|2452080_2453097_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AYR84302.1|2453304_2454708_+	S-methylmethionine permease	NA	NA	NA	NA	NA
AYR82279.1|2454694_2455627_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AYR82280.1|2455735_2456782_-	Fe(3+) ions import ATP-binding protein FbpC	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
AYR82281.1|2458364_2458715_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AYR82282.1|2458808_2459963_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
AYR82283.1|2460257_2461166_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AYR82284.1|2461180_2463148_+	YjhG/YagF family D-xylonate dehydratase	NA	NA	NA	NA	NA
AYR82285.1|2463374_2464757_+	MFS transporter	NA	NA	NA	NA	NA
AYR82286.1|2464768_2466379_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
AYR82287.1|2466383_2467142_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AYR82288.1|2467280_2468285_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AYR82289.1|2468511_2468694_+	PTS mannitol transporter subunit IIA	NA	A0A2L1IV26	Escherichia_phage	96.3	6.1e-07
AYR82290.1|2469479_2470211_+	hypothetical protein	NA	NA	NA	NA	NA
AYR82291.1|2470301_2470928_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AYR82292.1|2471199_2471898_-	recombinase family protein	NA	NA	NA	NA	NA
AYR82293.1|2471924_2472779_-	hypothetical protein	NA	NA	NA	NA	NA
AYR82294.1|2472897_2473122_-	DNA-binding protein	NA	NA	NA	NA	NA
AYR82295.1|2473118_2473559_-	hypothetical protein	NA	NA	NA	NA	NA
AYR82296.1|2473675_2475076_-	DUF4102 domain-containing protein	NA	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
AYR82297.1|2475360_2475771_-	hypothetical protein	NA	NA	NA	NA	NA
AYR82298.1|2475749_2476706_-	XdhC family protein	NA	NA	NA	NA	NA
AYR82299.1|2476715_2478914_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
AYR82300.1|2478910_2479867_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
AYR82301.1|2479863_2480553_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
AYR82302.1|2480732_2480858_-	transporter	NA	NA	NA	NA	NA
AYR82303.1|2480970_2481585_+	hypothetical protein	NA	NA	NA	NA	NA
AYR82304.1|2481658_2481838_+	hypothetical protein	NA	NA	NA	NA	NA
AYR82305.1|2481832_2482162_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AYR82306.1|2483152_2484796_-	fimbria adhesin EcpD	NA	NA	NA	NA	NA
AYR82307.1|2487335_2488004_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
AYR82308.1|2488061_2488649_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
AYR82309.1|2488723_2489314_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AYR82310.1|2489848_2490028_+	hypothetical protein	NA	NA	NA	NA	NA
AYR82311.1|2490089_2490317_+	hypothetical protein	NA	NA	NA	NA	NA
AYR82312.1|2490351_2490492_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
AYR82313.1|2490491_2490755_-	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
AYR82314.1|2491118_2491220_-	hypothetical protein	NA	NA	NA	NA	NA
AYR82315.1|2492334_2493222_+	attaching and effacing-like protein	NA	NA	NA	NA	NA
AYR82316.1|2493268_2494430_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AYR82317.1|2495703_2496297_-	protein RclC	NA	NA	NA	NA	NA
AYR82318.1|2496308_2496545_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AYR82319.1|2496653_2497979_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
AYR82320.1|2498204_2499059_+	transcriptional regulator	NA	NA	NA	NA	NA
AYR82321.1|2499585_2500305_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
AYR82322.1|2500315_2501743_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
AYR82323.1|2501735_2502431_+	lactate utilization protein C	NA	NA	NA	NA	NA
AYR82324.1|2502385_2502598_-	hypothetical protein	NA	NA	NA	NA	NA
AYR82325.1|2502504_2502702_-	universal stress protein	NA	NA	NA	NA	NA
AYR82326.1|2502673_2503342_-	hypothetical protein	NA	NA	NA	NA	NA
AYR82327.1|2503554_2505225_-|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
AYR82328.1|2505238_2506711_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AYR82329.1|2506724_2507312_-	transcriptional regulator	NA	NA	NA	NA	NA
AYR84303.1|2507228_2507444_+	hypothetical protein	NA	NA	NA	NA	NA
AYR82330.1|2507440_2509474_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 4
CP030240	Escherichia coli strain ER1709 chromosome, complete genome	4582842	2671879	2723844	4582842	tRNA,lysis,integrase,terminase,transposase	Enterobacteria_phage(55.56%)	59	2706502:2706548	2727804:2727850
AYR82486.1|2671879_2672974_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AYR82487.1|2673042_2673969_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
AYR82488.1|2674198_2674681_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
AYR82489.1|2674758_2675574_+	transcriptional regulator	NA	NA	NA	NA	NA
AYR82490.1|2675663_2677445_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
AYR82491.1|2677457_2678234_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
AYR82492.1|2678333_2679212_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
AYR82493.1|2679380_2680835_+	putative allantoin permease	NA	NA	NA	NA	NA
AYR82494.1|2680894_2682256_+	cyclic amidohydrolase	NA	NA	NA	NA	NA
AYR82495.1|2682312_2683614_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
AYR82496.1|2683635_2684781_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
AYR82497.1|2685008_2685794_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
AYR82498.1|2685804_2687040_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
AYR82499.1|2687061_2688111_-	ureidoglycolate dehydrogenase (NAD(+))	NA	NA	NA	NA	NA
AYR82500.1|2688427_2690095_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
AYR82501.1|2690104_2691364_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
AYR82502.1|2691374_2692190_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
AYR82503.1|2692186_2693080_+	carbamate kinase	NA	NA	NA	NA	NA
AYR82504.1|2693274_2694342_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AYR82505.1|2694338_2694848_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AYR82506.1|2694965_2695688_-	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
AYR82507.1|2695690_2696185_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AYR82508.1|2696358_2697744_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
AYR82509.1|2697779_2698301_-	hypothetical protein	NA	NA	NA	NA	NA
AYR82510.1|2698408_2698621_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AYR82511.1|2698622_2699489_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AYR82512.1|2699959_2700502_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AYR82513.1|2700721_2701414_+	fimbrial chaperone SfmC	NA	NA	NA	NA	NA
AYR82514.1|2701444_2704048_+	outer membrane usher protein SfmD	NA	NA	NA	NA	NA
AYR82515.1|2704026_2705067_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AYR82516.1|2705077_2705593_+	fimbriae assembly protein	NA	NA	NA	NA	NA
2706502:2706548	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AYR82517.1|2706561_2707725_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
AYR82518.1|2707844_2708108_-	hypothetical protein	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
AYR82519.1|2708430_2708526_+	protein ren	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
AYR82520.1|2708588_2709750_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AYR82521.1|2710061_2710394_+	multidrug SMR transporter	NA	NA	NA	NA	NA
AYR82522.1|2710648_2712175_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
AYR82523.1|2712639_2713191_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AYR82524.1|2713200_2713998_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYR82525.1|2714114_2714216_+	hypothetical protein	NA	NA	NA	NA	NA
AYR82526.1|2714212_2714668_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
AYR82527.1|2714667_2714838_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AYR82528.1|2714830_2715121_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
AYR82529.1|2715117_2715480_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
AYR82530.1|2715476_2715617_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
AYR82531.1|2715702_2716086_+	antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
AYR82532.1|2716227_2716446_+	hypothetical protein	NA	Q38586	Enterobacteria_phage	70.2	1.1e-13
AYR82533.1|2716483_2717500_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AYR82534.1|2717504_2718572_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
AYR82535.1|2719144_2719360_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AYR82536.1|2719359_2719857_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
AYR82537.1|2719853_2720315_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	97.4	3.9e-74
AYR82538.1|2720346_2720640_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
AYR82539.1|2720930_2721341_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
AYR82540.1|2721626_2721833_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
AYR82541.1|2721997_2722192_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
AYR82542.1|2722339_2722441_+	hypothetical protein	NA	NA	NA	NA	NA
AYR82543.1|2722580_2723126_+	DNA-packaging protein NU1	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
AYR82544.1|2723100_2723844_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
2727804:2727850	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 5
CP030240	Escherichia coli strain ER1709 chromosome, complete genome	4582842	3535497	3599441	4582842	tRNA,integrase,tail,transposase	Escherichia_phage(35.48%)	64	3526159:3526177	3556530:3556548
3526159:3526177	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
AYR84341.1|3535497_3536730_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
AYR83273.1|3536984_3537968_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AYR83274.1|3538242_3538416_+	hypothetical protein	NA	NA	NA	NA	NA
AYR83275.1|3538445_3539819_+	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AYR83276.1|3539947_3540883_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AYR83277.1|3540934_3542170_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
AYR83278.1|3542171_3542387_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AYR84343.1|3542465_3542675_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
AYR84342.1|3542667_3542862_-	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
AYR83279.1|3542918_3543728_-	DNA recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
AYR83280.1|3543720_3546321_-	exodeoxyribonuclease 8	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
AYR83281.1|3546422_3546698_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
AYR84344.1|3546772_3546943_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AYR83282.1|3546942_3547164_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
AYR83283.1|3547292_3547571_+	hypothetical protein	NA	NA	NA	NA	NA
AYR83284.1|3547605_3548094_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
AYR83285.1|3548090_3548246_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AYR83286.1|3548256_3548436_-	hypothetical protein	NA	NA	NA	NA	NA
AYR83287.1|3548699_3549176_-	Rac prophage repressor	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
AYR83288.1|3549299_3549596_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
AYR83289.1|3549618_3550041_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
AYR83290.1|3550916_3551663_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
AYR83291.1|3552333_3552519_+	Spanin from lambdoid prophage Rac, outer membrane subunit	NA	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
AYR83292.1|3554309_3554573_+	hypothetical protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
AYR83293.1|3554553_3554913_+	hypothetical protein	NA	NA	NA	NA	NA
AYR83294.1|3555020_3555221_+	hypothetical protein	NA	NA	NA	NA	NA
AYR83295.1|3556291_3556546_+	hypothetical protein	NA	A5LH44	Enterobacteria_phage	95.8	7.4e-35
AYR84346.1|3556520_3556640_+	ABC transporter	NA	NA	NA	NA	NA
3556530:3556548	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
AYR83296.1|3556678_3557659_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.5e-184
AYR84345.1|3557701_3557917_+	hypothetical protein	NA	Q687E7	Enterobacteria_phage	98.4	1.4e-29
AYR84347.1|3557981_3561344_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
AYR83297.1|3561343_3561919_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
AYR83298.1|3562016_3562607_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AYR83299.1|3562923_3563157_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
AYR83300.1|3564117_3564552_-	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
AYR83301.1|3564692_3565826_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
AYR83302.1|3566030_3566282_+	hypothetical protein	NA	NA	NA	NA	NA
AYR83303.1|3566192_3569717_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
AYR83304.1|3569990_3570257_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AYR83305.1|3570253_3570676_-	heat-shock protein HslJ	NA	NA	NA	NA	NA
AYR83306.1|3570786_3571776_-	lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
AYR83307.1|3571983_3574623_+	YdbH family protein	NA	NA	NA	NA	NA
AYR83308.1|3574619_3574805_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
AYR83309.1|3574812_3575139_+	DUF1318 domain-containing protein	NA	NA	NA	NA	NA
AYR83310.1|3575310_3576216_-	transcriptional activator FeaR	NA	NA	NA	NA	NA
AYR83311.1|3576451_3577951_+	NAD-dependent phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
AYR83312.1|3578008_3580282_-	primary-amine oxidase	NA	NA	NA	NA	NA
AYR83313.1|3580529_3582575_-	bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase	NA	NA	NA	NA	NA
AYR83314.1|3582859_3583789_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
AYR83315.1|3583800_3584088_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
AYR83316.1|3584096_3584843_+	1,2-phenylacetyl-CoA epoxidase subunit C	NA	NA	NA	NA	NA
AYR83317.1|3585361_3586432_+	1,2-phenylacetyl-CoA epoxidase subunit E	NA	NA	NA	NA	NA
AYR83318.1|3586428_3587196_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
AYR83319.1|3587195_3587984_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
AYR83320.1|3587985_3589413_+	3-hydroxyadipyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AYR83321.1|3589402_3589825_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AYR83322.1|3589824_3591030_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AYR83323.1|3591056_3592370_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
AYR83324.1|3592470_3593421_+	transcriptional regulator	NA	NA	NA	NA	NA
AYR83325.1|3593402_3593993_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
AYR84348.1|3594096_3594162_-	hypothetical protein	NA	NA	NA	NA	NA
AYR83326.1|3594341_3596882_+	autotransporter (AT) family porin	NA	NA	NA	NA	NA
AYR83327.1|3596852_3598126_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AYR83328.1|3598289_3599441_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
>prophage 6
CP030240	Escherichia coli strain ER1709 chromosome, complete genome	4582842	3758379	3803041	4582842	protease,lysis,integrase,transposase,tail	Enterobacteria_phage(31.03%)	59	3767969:3767984	3795451:3795466
AYR83460.1|3758379_3759840_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
AYR83461.1|3759928_3761212_-	MFS transporter	NA	NA	NA	NA	NA
AYR83462.1|3761998_3762232_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AYR83463.1|3762548_3763139_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AYR83464.1|3763236_3763812_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
AYR83465.1|3763811_3764774_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
AYR83466.1|3764724_3765294_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
AYR83467.1|3765433_3765535_-	hypothetical protein	NA	NA	NA	NA	NA
AYR83468.1|3765682_3765916_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
AYR83469.1|3765973_3766384_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
AYR83470.1|3766879_3767035_-	hypothetical protein	NA	NA	NA	NA	NA
AYR83471.1|3767181_3767370_-	cold-shock protein	NA	NA	NA	NA	NA
AYR83472.1|3767380_3767593_-	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AYR83473.1|3767955_3768453_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
3767969:3767984	attL	TTTTTATCTCTTAAAG	NA	NA	NA	NA
AYR83474.1|3768449_3768983_-	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AYR83475.1|3768979_3769291_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AYR83476.1|3769295_3769511_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AYR83477.1|3770264_3770480_-	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AYR83478.1|3770780_3770993_+	cold-shock protein CspF	NA	NA	NA	NA	NA
AYR83479.1|3771413_3772166_-	antitermination protein Q	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
AYR83480.1|3772179_3773229_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
AYR83481.1|3773230_3773509_-	hypothetical protein	NA	NA	NA	NA	NA
AYR83482.1|3773575_3773827_-	hypothetical protein	NA	NA	NA	NA	NA
AYR83483.1|3774043_3774199_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AYR83484.1|3774270_3774558_-	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AYR83485.1|3774557_3774797_-	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AYR83486.1|3774821_3775127_+	hypothetical protein	NA	NA	NA	NA	NA
AYR83487.1|3775329_3775662_+	protein FlxA	NA	NA	NA	NA	NA
AYR83488.1|3775931_3776054_-	plasmid mobilization protein	NA	NA	NA	NA	NA
AYR83489.1|3776544_3776775_-	division inhibition gene dicB repressor	NA	NA	NA	NA	NA
AYR83490.1|3776858_3777266_+	transcriptional regulator	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
AYR83491.1|3777432_3777588_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AYR83492.1|3777547_3777718_+	hypothetical protein	NA	NA	NA	NA	NA
AYR83493.1|3777747_3777966_+	hypothetical protein	NA	NA	NA	NA	NA
AYR83494.1|3778533_3778722_+	division inhibition protein DicB	NA	NA	NA	NA	NA
AYR83495.1|3778718_3778910_+	DUF1482 family protein	NA	NA	NA	NA	NA
AYR83496.1|3780791_3782065_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AYR84356.1|3782078_3782969_+|integrase	site-specific integrase	integrase	Q859D2	Escherichia_coli_phage	63.6	1.5e-101
AYR83497.1|3782988_3783099_-	transporter	NA	NA	NA	NA	NA
AYR83498.1|3783156_3784176_-	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AYR83499.1|3784187_3785402_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AYR83500.1|3785382_3785571_-	hypothetical protein	NA	NA	NA	NA	NA
AYR83501.1|3785607_3785934_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AYR83502.1|3786068_3786410_+	DUF1283 family protein	NA	NA	NA	NA	NA
AYR83503.1|3786444_3787005_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AYR84357.1|3787007_3787718_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AYR83504.1|3787825_3788131_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AYR84358.1|3790815_3793239_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
AYR83505.1|3793249_3793867_+	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AYR83506.1|3793868_3794723_+	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AYR83507.1|3794765_3795380_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AYR84359.1|3795538_3796831_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
3795451:3795466	attR	TTTTTATCTCTTAAAG	NA	NA	NA	NA
AYR83508.1|3796783_3797479_-	dethiobiotin synthase	NA	NA	NA	NA	NA
AYR83509.1|3797603_3798824_-	protein mlc	NA	NA	NA	NA	NA
AYR83510.1|3798958_3799852_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYR83511.1|3799958_3801212_+	MFS transporter	NA	NA	NA	NA	NA
AYR83512.1|3801608_3801944_+	acid shock protein	NA	NA	NA	NA	NA
AYR83513.1|3802036_3802120_+	hypothetical protein	NA	NA	NA	NA	NA
AYR83514.1|3802219_3803041_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 7
CP030240	Escherichia coli strain ER1709 chromosome, complete genome	4582842	4237493	4246163	4582842		Escherichia_phage(28.57%)	7	NA	NA
AYR83931.1|4237493_4238597_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
AYR83932.1|4239847_4240405_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
AYR83933.1|4240404_4241286_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
AYR83934.1|4241343_4242243_-	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
AYR83935.1|4242242_4243328_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
AYR83936.1|4243700_4244594_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AYR83937.1|4244768_4246163_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 8
CP030240	Escherichia coli strain ER1709 chromosome, complete genome	4582842	4338227	4345858	4582842		Enterobacteria_phage(100.0%)	7	NA	NA
AYR84007.1|4338227_4339364_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
AYR84008.1|4339360_4341205_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.9	0.0e+00
AYR84009.1|4341485_4341947_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AYR84010.1|4341986_4342457_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
AYR84011.1|4342503_4343223_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYR84012.1|4343219_4344905_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AYR84013.1|4345126_4345858_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
