The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029956	Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 chromosome, complete genome	4799946	930258	937570	4799946	integrase,protease	Dickeya_phage(16.67%)	6	931509:931523	942501:942515
AYR41669.1|930258_931377_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYR41670.1|931373_933320_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931509:931523	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYR41671.1|933449_933671_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYR41672.1|933994_934315_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYR41673.1|934345_936622_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYR41674.1|937192_937570_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942501:942515	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029956	Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 chromosome, complete genome	4799946	1008313	1085626	4799946	terminase,integrase,tail,protease,transposase	Salmonella_phage(73.33%)	93	990392:990411	1060987:1061006
990392:990411	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYR41724.1|1008313_1009654_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYR41725.1|1009650_1009899_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYR41726.1|1009939_1010185_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYR41727.1|1010184_1011066_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYR41728.1|1011062_1012127_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYR41729.1|1012204_1012885_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYR41730.1|1012881_1013667_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYR41731.1|1013672_1013969_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYR41732.1|1014059_1014260_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYR41733.1|1014548_1014953_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYR41734.1|1015284_1015659_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYR41735.1|1015743_1016727_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYR41736.1|1016729_1017479_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYR41737.1|1017489_1017837_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYR41738.1|1017833_1018358_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYR41739.1|1018357_1018831_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYR41740.1|1018834_1019407_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYR41741.1|1019500_1019767_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYR41742.1|1019848_1020010_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR41743.1|1020442_1020940_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR41744.1|1021124_1021364_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYR41745.1|1021353_1021659_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYR41746.1|1021698_1022301_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYR41747.1|1022509_1023121_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYR41748.1|1023253_1024051_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYR41749.1|1024449_1024575_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR41750.1|1024710_1025160_-	lipoprotein	NA	NA	NA	NA	NA
AYR41751.1|1025376_1025766_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYR41752.1|1025752_1026034_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYR41753.1|1026033_1026648_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYR41754.1|1026867_1027122_+	hypothetical protein	NA	NA	NA	NA	NA
AYR41755.1|1027226_1027604_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYR41756.1|1027667_1027928_+	hypothetical protein	NA	NA	NA	NA	NA
AYR41757.1|1028017_1028770_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYR41758.1|1028735_1030139_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYR41759.1|1030138_1031608_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYR41760.1|1031699_1032230_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYR41761.1|1032244_1033477_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYR41762.1|1033481_1033979_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYR41763.1|1033990_1034932_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYR41764.1|1034973_1035342_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYR41765.1|1035307_1035715_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYR41766.1|1035711_1036266_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYR41767.1|1036252_1036642_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYR41768.1|1036616_1037180_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYR41769.1|1037183_1038329_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYR41770.1|1038340_1038781_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYR41771.1|1038784_1039237_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYR41772.1|1039414_1041367_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYR41773.1|1041366_1042017_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYR41774.1|1042020_1042323_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYR41775.1|1042325_1043357_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYR41776.1|1043353_1043689_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYR41777.1|1043883_1044615_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR41778.1|1044614_1045043_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR41779.1|1045101_1045857_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYR41780.1|1045944_1046082_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYR41781.1|1046097_1046451_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYR41782.1|1046451_1047651_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYR41783.1|1047647_1048328_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYR41784.1|1048327_1049839_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYR41785.1|1049853_1050372_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYR41786.1|1051293_1051995_-	hypothetical protein	NA	NA	NA	NA	NA
AYR41787.1|1052307_1052586_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYR41788.1|1053011_1055624_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYR41789.1|1055831_1056842_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYR41790.1|1057004_1057550_+	hypothetical protein	NA	NA	NA	NA	NA
AYR41791.1|1057546_1058656_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYR41792.1|1058754_1060863_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYR41793.1|1060875_1062783_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1060987:1061006	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYR41794.1|1062797_1064051_+	inner membrane protein	NA	NA	NA	NA	NA
AYR41795.1|1064055_1065696_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYR41796.1|1065692_1066256_+	lipoprotein	NA	NA	NA	NA	NA
AYR41797.1|1066509_1066677_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYR41798.1|1066776_1067295_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYR41799.1|1067363_1069124_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYR41800.1|1069309_1069762_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYR41801.1|1069833_1070886_-	outer membrane protein A	NA	NA	NA	NA	NA
AYR41802.1|1071240_1071750_-	cell division inhibitor	NA	NA	NA	NA	NA
AYR41803.1|1071966_1072572_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYR41804.1|1072558_1074712_-	inner membrane protein	NA	NA	NA	NA	NA
AYR41805.1|1074730_1075177_-	hypothetical protein	NA	NA	NA	NA	NA
AYR41806.1|1075300_1077355_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYR41807.1|1077390_1077849_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYR41808.1|1077943_1078606_-	hypothetical protein	NA	NA	NA	NA	NA
AYR41809.1|1078776_1079193_+	hypothetical protein	NA	NA	NA	NA	NA
AYR41810.1|1079237_1079555_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYR41811.1|1079612_1080824_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYR41812.1|1081955_1082414_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR41813.1|1083150_1083432_+	acylphosphatase	NA	NA	NA	NA	NA
AYR41814.1|1083428_1083758_-	sulfite reductase	NA	NA	NA	NA	NA
AYR41815.1|1083844_1084504_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYR41816.1|1085167_1085626_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029956	Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 chromosome, complete genome	4799946	1530183	1603660	4799946	tRNA,head,tail,plate,protease,transposase	Burkholderia_virus(42.11%)	80	NA	NA
AYR42218.1|1530183_1530642_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR42219.1|1531144_1531426_+	stress response protein	NA	NA	NA	NA	NA
AYR42220.1|1531694_1532516_+|protease	serine protease	protease	NA	NA	NA	NA
AYR42221.1|1532550_1532880_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYR42222.1|1532866_1533229_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYR42223.1|1533340_1533511_-	hypothetical protein	NA	NA	NA	NA	NA
AYR42224.1|1533645_1534680_+	hypothetical protein	NA	NA	NA	NA	NA
AYR42225.1|1534854_1536243_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYR42226.1|1536253_1537783_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYR42227.1|1538309_1539254_+	hypothetical protein	NA	NA	NA	NA	NA
AYR42228.1|1539435_1539825_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYR42229.1|1539796_1540249_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYR42230.1|1540443_1540674_-	hypothetical protein	NA	NA	NA	NA	NA
AYR42231.1|1540670_1541354_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYR42232.1|1541350_1541566_-	hypothetical protein	NA	NA	NA	NA	NA
AYR42233.1|1541558_1541942_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYR42234.1|1541938_1542241_-	hypothetical protein	NA	NA	NA	NA	NA
AYR42235.1|1542250_1542523_-	hypothetical protein	NA	NA	NA	NA	NA
AYR42236.1|1542811_1543342_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYR42237.1|1543369_1543639_-	hypothetical protein	NA	NA	NA	NA	NA
AYR42238.1|1543641_1544808_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYR42239.1|1544818_1546588_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYR42240.1|1546765_1547197_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYR42241.1|1547192_1547789_+	hypothetical protein	NA	NA	NA	NA	NA
AYR42242.1|1548032_1548383_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYR42243.1|1549097_1549748_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYR42244.1|1549744_1550071_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYR42245.1|1550070_1550382_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYR42246.1|1550381_1550927_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYR42247.1|1550923_1552519_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYR42248.1|1552518_1554015_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYR42249.1|1553995_1554817_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYR42250.1|1554819_1555278_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYR42251.1|1555492_1556608_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYR42252.1|1556622_1557576_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYR42253.1|1557585_1557924_+	hypothetical protein	NA	NA	NA	NA	NA
AYR42254.1|1557925_1558372_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYR42255.1|1558371_1558836_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYR42256.1|1558832_1559087_+	hypothetical protein	NA	NA	NA	NA	NA
AYR42257.1|1559076_1560504_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYR42258.1|1560503_1561025_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYR42259.1|1561027_1561309_+	hypothetical protein	NA	NA	NA	NA	NA
AYR42260.1|1561406_1561742_+	hypothetical protein	NA	NA	NA	NA	NA
AYR42261.1|1561917_1564383_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYR42262.1|1564382_1565267_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYR42263.1|1565263_1565479_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYR42264.1|1565466_1566621_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYR42265.1|1566617_1567145_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYR42266.1|1567201_1567549_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYR42267.1|1567539_1568643_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYR42268.1|1568635_1569214_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYR42269.1|1569216_1570242_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYR42270.1|1570755_1571373_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYR42271.1|1571866_1572259_-	hypothetical protein	NA	Q9MCR6	Enterobacteria_phage	51.1	6.8e-19
AYR42272.1|1572855_1573428_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYR42273.1|1573708_1575091_+	amino acid permease	NA	NA	NA	NA	NA
AYR42274.1|1575152_1575488_-	hypothetical protein	NA	NA	NA	NA	NA
AYR42275.1|1575614_1576346_+	two-component response regulator	NA	NA	NA	NA	NA
AYR42276.1|1576826_1577978_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYR42277.1|1578130_1579837_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYR42278.1|1579944_1581249_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYR42279.1|1581324_1582254_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYR42280.1|1582250_1583654_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYR42281.1|1583821_1585468_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYR42282.1|1585667_1586843_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYR42283.1|1586945_1588454_+	hypothetical protein	NA	NA	NA	NA	NA
AYR42284.1|1589159_1590161_+	adenosine deaminase	NA	NA	NA	NA	NA
AYR42285.1|1590234_1591350_-	oxidoreductase	NA	NA	NA	NA	NA
AYR42286.1|1591452_1591608_+	hypothetical protein	NA	NA	NA	NA	NA
AYR42287.1|1591906_1592122_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYR42288.1|1592210_1592651_+	hypothetical protein	NA	NA	NA	NA	NA
AYR42289.1|1592727_1593309_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYR42290.1|1593308_1593887_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYR42291.1|1595808_1596867_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYR42292.1|1596870_1597491_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYR42293.1|1597493_1598186_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYR42294.1|1598185_1598821_+	endonuclease III	NA	NA	NA	NA	NA
AYR42295.1|1599421_1600927_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYR42296.1|1601031_1601637_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYR42297.1|1602385_1603660_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029956	Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 chromosome, complete genome	4799946	1691166	1755031	4799946	terminase,capsid,tRNA,tail,plate,portal,transposase	Enterobacteria_phage(75.0%)	74	NA	NA
AYR42385.1|1691166_1691916_-	vitamin B12 ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	4.6e-08
AYR42386.1|1691915_1692467_-	glutathione peroxidase	NA	NA	NA	NA	NA
AYR42387.1|1692558_1693539_-	vitamin B12 ABC transporter permease	NA	NA	NA	NA	NA
AYR42388.1|1693746_1694076_-	hypothetical protein	NA	NA	NA	NA	NA
AYR42389.1|1694183_1694546_-	hypothetical protein	NA	NA	NA	NA	NA
AYR42390.1|1694548_1695676_-	Integrase	NA	A0A0M4RTQ0	Salmonella_phage	51.4	7.0e-85
AYR42391.1|1695978_1696257_+	DNA-binding protein	NA	NA	NA	NA	NA
AYR42392.1|1696271_1696610_+	hypothetical protein	NA	A0A0A7NV42	Enterobacteria_phage	82.8	1.1e-46
AYR42393.1|1696620_1696899_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	4.5e-33
AYR42394.1|1696910_1697153_+	hypothetical protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AYR42395.1|1697149_1697263_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	94.6	3.6e-10
AYR42396.1|1697350_1697554_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	82.1	3.3e-25
AYR42397.1|1697550_1697769_+	hypothetical protein	NA	NA	NA	NA	NA
AYR42398.1|1697877_1698267_+	hypothetical protein	NA	NA	NA	NA	NA
AYR42399.1|1698263_1701104_+	Phage replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
AYR42400.1|1701180_1702140_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	1.3e-177
AYR42401.1|1702144_1702459_+	Plasmid stability protein	NA	A0A0A7NPT5	Enterobacteria_phage	51.4	9.2e-19
AYR42402.1|1702542_1703385_-	hypothetical protein	NA	NA	NA	NA	NA
AYR42403.1|1703424_1703922_-	hypothetical protein	NA	NA	NA	NA	NA
AYR42404.1|1704570_1705617_-|portal	Presumed portal vertex protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
AYR42405.1|1705616_1707368_-|terminase	Phage terminase ATPase subunit	terminase	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
AYR42406.1|1707522_1708359_+|capsid	Phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.2	7.2e-119
AYR42407.1|1708382_1709435_+|capsid	Phage major capsid protein	capsid	A0A0A7NQ82	Enterobacteria_phage	99.7	1.5e-198
AYR42408.1|1709480_1710281_+|terminase	Phage terminase endonuclease subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	98.1	7.8e-139
AYR42409.1|1710382_1710877_+	Head completion/stabilization protein	NA	A0A0A7NPU2	Enterobacteria_phage	98.8	3.0e-88
AYR42410.1|1710876_1711077_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
AYR42411.1|1711079_1711403_+	hypothetical protein	NA	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
AYR42412.1|1711399_1711792_+	peptidase M15	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
AYR42413.1|1711788_1712196_+	hypothetical protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.0	6.5e-65
AYR42414.1|1712333_1712801_+|tail	tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
AYR42415.1|1712784_1713429_+|tail	Phage tail completion protein	tail	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
AYR42416.1|1713425_1714007_+|plate	Baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	8.6e-103
AYR42417.1|1714003_1714354_+|plate	Phage baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
AYR42418.1|1714357_1715254_+|plate	Baseplate assembly protein J	plate	A0A0A7NPY5	Enterobacteria_phage	99.0	1.2e-156
AYR42419.1|1715246_1715777_+|tail	Phage tail fiber	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	2.1e-92
AYR42420.1|1715779_1717945_+	hypothetical protein	NA	A0A0A7NV63	Enterobacteria_phage	82.7	0.0e+00
AYR42421.1|1717946_1718474_+|tail	Phage tail fiber	tail	A0A0C4UR05	Shigella_phage	94.9	8.9e-91
AYR42422.1|1718502_1719036_-|tail	Phage tail fiber	tail	C9DGR0	Escherichia_phage	98.9	3.2e-96
AYR42423.1|1719038_1719932_-	hypothetical protein	NA	C9DGR1	Escherichia_phage	99.3	1.1e-178
AYR42424.1|1720063_1720651_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	97.9	2.3e-103
AYR42425.1|1720686_1721175_-|tail	tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
AYR42426.1|1721187_1723995_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	98.1	0.0e+00
AYR42427.1|1724145_1724520_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
AYR42428.1|1724575_1725088_-|tail	tail protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
AYR42429.1|1725087_1726272_-|tail	tail protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	3.4e-223
AYR42430.1|1726429_1727533_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.8	1.1e-194
AYR42431.1|1727697_1728333_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
AYR42432.1|1728329_1729442_-	molybdenum cofactor biosynthesis protein A	NA	NA	NA	NA	NA
AYR42433.1|1729434_1730823_-	Chondro-6-sulfatase	NA	S5VT21	Leptospira_phage	27.4	1.3e-48
AYR42434.1|1730822_1731095_-	His-Xaa-Ser system protein HsxD	NA	NA	NA	NA	NA
AYR42435.1|1731347_1731608_+	hypothetical protein	NA	NA	NA	NA	NA
AYR42436.1|1731798_1731939_+	hok/gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
AYR42437.1|1732347_1732647_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AYR42438.1|1732651_1735039_-|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AYR42439.1|1735054_1736038_-|tRNA	phenylalanyl-tRNA synthetase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
AYR42440.1|1736339_1736696_-	50S ribosomal subunit protein L20	NA	NA	NA	NA	NA
AYR42441.1|1736746_1736944_-	50S ribosomal subunit protein L35	NA	NA	NA	NA	NA
AYR42442.1|1737039_1737582_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	6.3e-15
AYR42443.1|1737585_1739514_-|tRNA	threonyl-tRNA synthetase	tRNA	A0A2K9L297	Tupanvirus	37.6	1.6e-129
AYR42444.1|1740096_1740225_+	hypothetical protein	NA	NA	NA	NA	NA
AYR42445.1|1740405_1741629_+	O-antigen polymerase	NA	NA	NA	NA	NA
AYR42446.1|1743182_1743497_-	hypothetical protein	NA	NA	NA	NA	NA
AYR42447.1|1743639_1744599_+	outer membrane protein	NA	NA	NA	NA	NA
AYR42448.1|1744647_1745406_-	outer membrane protein	NA	NA	NA	NA	NA
AYR42449.1|1745694_1746627_+	6-phosphofructokinase isozyme	NA	NA	NA	NA	NA
AYR42450.1|1746723_1747014_+	hypothetical protein	NA	NA	NA	NA	NA
AYR42451.1|1747120_1747981_+	hypothetical protein	NA	NA	NA	NA	NA
AYR42452.1|1748023_1748560_-	hypothetical protein	NA	NA	NA	NA	NA
AYR42453.1|1748708_1749377_+	hydrolase	NA	NA	NA	NA	NA
AYR42454.1|1749514_1750114_+	hypothetical protein	NA	NA	NA	NA	NA
AYR42455.1|1750250_1751642_+	sodium:dicarboxylate symporter	NA	NA	NA	NA	NA
AYR42456.1|1751744_1751987_-	cell division activator CedA	NA	NA	NA	NA	NA
AYR42457.1|1752203_1754456_+	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	50.0	1.3e-143
AYR42458.1|1754572_1755031_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 5
CP029956	Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 chromosome, complete genome	4799946	1823304	1827716	4799946		Escherichia_phage(50.0%)	6	NA	NA
AYR42529.1|1823304_1823544_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYR42530.1|1824416_1825226_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYR42531.1|1825298_1825676_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYR42532.1|1825823_1826366_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYR42533.1|1826557_1827286_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYR42534.1|1827302_1827716_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 6
CP029956	Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 chromosome, complete genome	4799946	2031548	2038782	4799946		Morganella_phage(33.33%)	7	NA	NA
AYR42724.1|2031548_2032979_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYR42725.1|2033052_2033748_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYR42726.1|2033827_2034139_-	hypothetical protein	NA	NA	NA	NA	NA
AYR42727.1|2034789_2035974_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYR42728.1|2036433_2036646_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYR42729.1|2037091_2038360_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYR42730.1|2038362_2038782_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 7
CP029956	Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 chromosome, complete genome	4799946	2122524	2133031	4799946		Enterobacteria_phage(37.5%)	10	NA	NA
AYR42807.1|2122524_2123838_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYR42808.1|2123864_2124944_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYR42809.1|2124948_2125722_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYR42810.1|2125737_2126712_-	reductase RfbI	NA	NA	NA	NA	NA
AYR42811.1|2126717_2127269_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYR42812.1|2127269_2128148_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYR42813.1|2128195_2129095_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYR42814.1|2129094_2130180_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYR42815.1|2130556_2131450_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYR42816.1|2131627_2133031_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 8
CP029956	Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 chromosome, complete genome	4799946	2753538	2766930	4799946	tail	Salmonella_phage(70.0%)	11	NA	NA
AYR43313.1|2753538_2753757_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYR43314.1|2753847_2754948_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYR43315.1|2754944_2755430_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYR43316.1|2755426_2758504_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYR43317.1|2758496_2758616_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYR43318.1|2758630_2758933_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYR43319.1|2758987_2759503_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYR43320.1|2759512_2760685_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYR43321.1|2760827_2761400_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYR43322.1|2762077_2763193_+	glycosyltransferase	NA	NA	NA	NA	NA
AYR43323.1|2763273_2766930_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029956	Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 chromosome, complete genome	4799946	3084384	3128087	4799946	transposase,tRNA,bacteriocin,protease	Bacillus_virus(33.33%)	44	NA	NA
AYR43612.1|3084384_3084843_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR43613.1|3085032_3086112_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYR43614.1|3086213_3087377_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYR43615.1|3087398_3088445_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYR43616.1|3088818_3089244_+	hypothetical protein	NA	NA	NA	NA	NA
AYR43617.1|3089269_3089848_+	hypothetical protein	NA	NA	NA	NA	NA
AYR43618.1|3089881_3090556_+	hypothetical protein	NA	NA	NA	NA	NA
AYR43619.1|3090537_3091221_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYR43620.1|3091214_3091871_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYR43621.1|3091975_3092434_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR43622.1|3092622_3094614_-	transketolase	NA	NA	NA	NA	NA
AYR43623.1|3094889_3095648_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYR43624.1|3095748_3096669_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYR43625.1|3096896_3098873_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYR43626.1|3098881_3099013_-	hypothetical protein	NA	NA	NA	NA	NA
AYR43627.1|3099307_3099607_-	membrane protein	NA	NA	NA	NA	NA
AYR43628.1|3099662_3100817_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYR43629.1|3101309_3102704_+	galactose-proton symport	NA	NA	NA	NA	NA
AYR43630.1|3102782_3103280_+	hypothetical protein	NA	NA	NA	NA	NA
AYR43631.1|3103375_3104083_+	endonuclease I	NA	NA	NA	NA	NA
AYR43632.1|3104159_3104891_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYR43633.1|3104910_3105858_+	glutathione synthetase	NA	NA	NA	NA	NA
AYR43634.1|3106073_3106637_+	hypothetical protein	NA	NA	NA	NA	NA
AYR43635.1|3106636_3107053_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYR43636.1|3107099_3107786_-	global regulatory protein	NA	NA	NA	NA	NA
AYR43637.1|3107915_3108896_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYR43638.1|3108913_3109618_+	hypothetical protein	NA	NA	NA	NA	NA
AYR43639.1|3109636_3110203_+	hypothetical protein	NA	NA	NA	NA	NA
AYR43640.1|3110199_3110490_+	hypothetical protein	NA	NA	NA	NA	NA
AYR43641.1|3110497_3111091_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYR43642.1|3111083_3112220_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYR43643.1|3112310_3113318_-	hypothetical protein	NA	NA	NA	NA	NA
AYR43644.1|3113450_3114497_-	L-asparaginase	NA	NA	NA	NA	NA
AYR43645.1|3114815_3115274_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR43646.1|3115396_3116116_-	hypothetical protein	NA	NA	NA	NA	NA
AYR43647.1|3116165_3116492_-	hypothetical protein	NA	NA	NA	NA	NA
AYR43648.1|3116491_3117211_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYR43649.1|3117365_3118418_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYR43650.1|3118445_3118721_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYR43651.1|3118833_3119919_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYR43652.1|3120135_3121392_+	nucleoside permease	NA	NA	NA	NA	NA
AYR43653.1|3124002_3124710_+	hypothetical protein	NA	NA	NA	NA	NA
AYR43654.1|3127299_3127566_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYR43655.1|3127808_3128087_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029956	Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 chromosome, complete genome	4799946	3505787	3543845	4799946	terminase,capsid,integrase,tail,plate,portal,transposase	Salmonella_phage(82.05%)	46	3500751:3500765	3512917:3512931
3500751:3500765	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYR43983.1|3505787_3507434_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYR43984.1|3507573_3507672_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYR43985.1|3507927_3508257_+	hypothetical protein	NA	NA	NA	NA	NA
AYR43986.1|3508297_3509350_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYR43987.1|3509745_3510315_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYR43988.1|3510440_3510662_+	hypothetical protein	NA	NA	NA	NA	NA
AYR43989.1|3510694_3511204_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYR43990.1|3511378_3511603_+	hypothetical protein	NA	NA	NA	NA	NA
AYR43991.1|3511625_3511967_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYR43992.1|3512034_3512268_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYR43993.1|3512267_3512495_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYR43994.1|3512491_3513349_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3512917:3512931	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYR43995.1|3513345_3515760_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYR43996.1|3515913_3516102_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYR43997.1|3518069_3518984_+	hypothetical protein	NA	NA	NA	NA	NA
AYR43998.1|3518980_3519721_+	hypothetical protein	NA	NA	NA	NA	NA
AYR43999.1|3519755_3520793_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYR44000.1|3520792_3522559_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYR44001.1|3522701_3523535_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYR44002.1|3523551_3524610_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYR44003.1|3524613_3525264_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYR44004.1|3525296_3525824_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYR44005.1|3525823_3526027_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYR44006.1|3526030_3526246_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYR44007.1|3526265_3526739_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYR44008.1|3526740_3527118_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYR44009.1|3527114_3527543_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYR44010.1|3527638_3528070_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYR44011.1|3528062_3528509_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYR44012.1|3528577_3529156_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYR44013.1|3529152_3529512_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYR44014.1|3529498_3530407_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYR44015.1|3530399_3531005_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYR44016.1|3531001_3532516_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYR44017.1|3532515_3533109_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYR44018.1|3533080_3533521_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYR44019.1|3533943_3534516_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYR44020.1|3534658_3535831_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYR44021.1|3535840_3536356_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYR44022.1|3536410_3536713_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYR44023.1|3536727_3536847_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYR44024.1|3536839_3539917_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYR44025.1|3539913_3540399_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYR44026.1|3540395_3541496_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYR44027.1|3541586_3541805_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYR44028.1|3543386_3543845_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029956	Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 chromosome, complete genome	4799946	4459623	4533973	4799946	terminase,capsid,integrase,tail,plate,portal	Salmonella_phage(82.98%)	76	4521124:4521140	4534132:4534148
AYR44799.1|4459623_4461573_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYR44800.1|4461644_4462553_+	hypothetical protein	NA	NA	NA	NA	NA
AYR44801.1|4462626_4463526_+	hypothetical protein	NA	NA	NA	NA	NA
AYR44802.1|4463567_4463927_+	hypothetical protein	NA	NA	NA	NA	NA
AYR44803.1|4464026_4464296_-	hypothetical protein	NA	NA	NA	NA	NA
AYR44804.1|4464427_4465702_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYR44805.1|4465921_4466299_+	hypothetical protein	NA	NA	NA	NA	NA
AYR44806.1|4466385_4466604_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYR44807.1|4466671_4467772_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYR44808.1|4467768_4468254_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYR44809.1|4468253_4471034_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYR44810.1|4471026_4471146_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYR44811.1|4471160_4471463_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYR44812.1|4471517_4472033_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYR44813.1|4472042_4473215_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYR44814.1|4473749_4474472_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYR44815.1|4474669_4475077_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYR44816.1|4475083_4476703_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYR44817.1|4476699_4477305_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYR44818.1|4477297_4478206_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	96.7	4.4e-154
AYR44819.1|4478192_4478552_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYR44820.1|4478548_4479127_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYR44821.1|4479195_4479642_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYR44822.1|4479634_4480066_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYR44823.1|4480161_4480587_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYR44824.1|4480586_4480964_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYR44825.1|4480968_4481439_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYR44826.1|4481458_4481674_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYR44827.1|4481677_4481881_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYR44828.1|4481880_4482345_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYR44829.1|4482438_4483089_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYR44830.1|4483092_4484157_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYR44831.1|4484173_4485007_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYR44832.1|4485149_4486916_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYR44833.1|4486912_4487959_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYR44834.1|4488007_4488703_-	hypothetical protein	NA	NA	NA	NA	NA
AYR44835.1|4488722_4489787_-	hypothetical protein	NA	NA	NA	NA	NA
AYR44836.1|4489783_4490848_-	hypothetical protein	NA	NA	NA	NA	NA
AYR44837.1|4491772_4492102_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYR44838.1|4492098_4494168_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYR44839.1|4494158_4495019_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYR44840.1|4495015_4495600_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYR44841.1|4495596_4495824_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYR44842.1|4495823_4496057_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYR44843.1|4496124_4496466_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYR44844.1|4496429_4496630_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYR44845.1|4496637_4497147_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYR44846.1|4497179_4497422_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYR44847.1|4497538_4498171_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYR44848.1|4498174_4499200_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYR44849.1|4499306_4499660_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYR44850.1|4500276_4500564_+	hypothetical protein	NA	NA	NA	NA	NA
AYR44851.1|4500574_4501465_+	methyltransferase	NA	NA	NA	NA	NA
AYR44852.1|4501464_4502211_+	hypothetical protein	NA	NA	NA	NA	NA
AYR44853.1|4502512_4504483_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYR44854.1|4504502_4505807_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYR44855.1|4505829_4506525_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYR44856.1|4506550_4507345_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYR44857.1|4507354_4508422_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYR44858.1|4508466_4510203_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYR44859.1|4510202_4512698_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYR44860.1|4512721_4513768_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYR44861.1|4513770_4515048_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYR44862.1|4515292_4515832_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYR44863.1|4516685_4518197_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYR44864.1|4518180_4519770_+	hypothetical protein	NA	NA	NA	NA	NA
AYR44865.1|4519933_4520947_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4521124:4521140	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYR44866.1|4521373_4521667_+	hypothetical protein	NA	NA	NA	NA	NA
AYR44867.1|4521663_4522152_+	hypothetical protein	NA	NA	NA	NA	NA
AYR44868.1|4522331_4522784_-	hypothetical protein	NA	NA	NA	NA	NA
AYR44869.1|4528006_4528468_+	hypothetical protein	NA	NA	NA	NA	NA
AYR44870.1|4528464_4528686_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYR44871.1|4529542_4530325_+	hypothetical protein	NA	NA	NA	NA	NA
AYR44872.1|4530951_4531176_-	hypothetical protein	NA	NA	NA	NA	NA
AYR44873.1|4531305_4532403_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYR44874.1|4532713_4533973_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4534132:4534148	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029956	Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 chromosome, complete genome	4799946	4676225	4682701	4799946	capsid	Enterobacteria_phage(66.67%)	8	NA	NA
AYR45011.1|4676225_4677302_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYR45012.1|4677298_4678372_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYR45013.1|4678346_4679510_-	hypothetical protein	NA	NA	NA	NA	NA
AYR45014.1|4679785_4680352_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYR45015.1|4680367_4680607_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYR45016.1|4680610_4681471_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYR45017.1|4681893_4682217_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYR45018.1|4682200_4682701_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
>prophage 1
CP029955	Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence	217339	3612	57130	217339	holin,transposase	Escherichia_phage(43.75%)	56	NA	NA
AYR40649.1|3612_3888_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR40650.1|3806_4310_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	6.3e-94
AYR40651.1|4636_4861_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40652.1|5516_5777_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40653.1|5865_6357_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40654.1|6361_6670_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40655.1|6877_7258_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40656.1|7343_7592_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40657.1|7629_7851_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	8.2e-06
AYR40658.1|8013_8397_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40659.1|8711_8936_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40660.1|9022_9487_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40661.1|9669_12099_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40662.1|12221_12668_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40663.1|12715_13522_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40664.1|13749_13992_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40665.1|14069_14402_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40666.1|14901_16083_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40667.1|16091_16388_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
AYR40668.1|16451_16919_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40669.1|17778_18555_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40670.1|18704_19481_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40671.1|19669_20011_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40672.1|20111_20375_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.1e-08
AYR40673.1|20608_21307_+	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	4.2e-11
AYR40674.1|21461_21758_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40675.1|21845_24230_-	periplasmic protein	NA	NA	NA	NA	NA
AYR40676.1|24480_25089_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40677.1|25201_25498_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40678.1|25502_26099_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40679.1|26490_27372_+	replication protein	NA	J9Q7H0	Salmonella_phage	41.3	6.5e-54
AYR40680.1|27957_28473_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40681.1|29123_31580_-	periplasmic protein	NA	NA	NA	NA	NA
AYR40682.1|32216_33971_-	DNA restriction methylase	NA	J9Q747	Salmonella_phage	30.9	1.1e-68
AYR40683.1|34156_35314_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.1e-19
AYR40684.1|35673_36498_+	DNA modification methylase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
AYR40685.1|36512_37334_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40686.1|37616_38324_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40687.1|38538_39615_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
AYR40688.1|40149_41025_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
AYR40689.1|41278_41860_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40690.1|42466_42820_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40691.1|42871_43189_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40692.1|43188_43986_+	pilus assembly protein	NA	NA	NA	NA	NA
AYR40693.1|43988_45221_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40694.1|45222_45663_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40695.1|45640_47011_+	TrhB	NA	NA	NA	NA	NA
AYR40696.1|47019_47532_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40697.1|47532_48390_+	plasmid transfer protein	NA	NA	NA	NA	NA
AYR40698.1|48399_49350_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40699.1|49358_52040_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40700.1|52673_52949_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	93.4	1.9e-44
AYR40701.1|53077_55081_+|holin	transporter, betaine/carnitine/choline family	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AYR40702.1|55143_56439_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40703.1|56432_56936_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.4	9.7e-95
AYR40704.1|56854_57130_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
>prophage 2
CP029955	Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence	217339	82223	134841	217339	integrase,transposase	Escherichia_phage(50.0%)	63	107127:107141	131627:131641
AYR40724.1|82223_82727_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR40725.1|82645_82921_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR40726.1|82962_84819_+	hypothetical protein	NA	S5MMD7	Bacillus_phage	26.4	2.2e-19
AYR40727.1|85216_86092_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40728.1|86150_86528_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40729.1|86588_87575_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40730.1|87634_88687_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40731.1|88725_88995_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40732.1|89065_90193_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40733.1|90270_92283_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40734.1|92354_92576_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40735.1|92690_93923_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
AYR40736.1|94197_94722_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40737.1|94712_95678_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40738.1|95748_96684_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40739.1|96761_97682_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40740.1|97754_98690_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40741.1|98866_99823_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40742.1|100235_100505_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40743.1|100559_101150_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40744.1|101157_101415_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40745.1|101488_102025_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40746.1|102041_102497_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40747.1|102480_102708_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40748.1|102756_103011_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40749.1|103078_104038_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40750.1|104048_104957_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40751.1|105261_106443_-	recombinase	NA	NA	NA	NA	NA
AYR40752.1|106657_106870_+	regulatory protein	NA	NA	NA	NA	NA
107127:107141	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYR40753.1|107176_107452_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	7.7e-46
107127:107141	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYR40754.1|107370_107874_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR40755.1|107980_108415_-	transcriptional regulator MerR	NA	NA	NA	NA	NA
AYR40756.1|108432_108837_+	MerT	NA	NA	NA	NA	NA
AYR40757.1|108850_109126_+	mercuric transport protein	NA	NA	NA	NA	NA
AYR40758.1|109161_109584_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AYR40759.1|109635_111330_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYR40760.1|111347_111710_+	transcriptional regulator MerD	NA	NA	NA	NA	NA
AYR40761.1|111706_111943_+	mercury resistance protein	NA	NA	NA	NA	NA
AYR40762.1|111939_112647_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40763.1|112685_113990_+|integrase	integrase	integrase	NA	NA	NA	NA
AYR40764.1|114018_114741_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR40765.1|115496_116348_+	replication protein	NA	NA	NA	NA	NA
AYR40766.1|116655_117471_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AYR40767.1|117531_118335_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYR40768.1|118334_119171_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYR40769.1|119231_119954_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR40770.1|120533_121394_-	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
120988:121002	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYR40771.1|121576_121843_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
120988:121002	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYR40772.1|121875_122598_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR40773.1|122831_123758_-	sulfonamide-resistant dihydropteroate synthase sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	7.2e-11
AYR40774.1|123664_124045_-	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYR40775.1|124241_124841_-	dihydrofolate reductase	NA	A0A1B2IAU3	Erwinia_phage	32.8	5.3e-15
AYR40776.1|124872_125886_+|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYR40777.1|125875_126439_+	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYR40778.1|126564_127125_+	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYR40779.1|127127_130094_+|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYR40780.1|130160_130538_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40781.1|130738_131398_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AYR40782.1|131676_131952_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR40783.1|131870_132374_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.4	1.3e-94
AYR40784.1|132955_133711_+	replication protein	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
AYR40785.1|134143_134419_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR40786.1|134337_134841_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	92.8	1.4e-88
