The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029954	Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 chromosome, complete genome	4784767	930136	937448	4784767	protease,integrase	Dickeya_phage(16.67%)	6	931387:931401	942566:942580
AYR50580.1|930136_931255_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYR50581.1|931251_933198_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931387:931401	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYR50582.1|933327_933549_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYR50583.1|933872_934193_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYR50584.1|934223_936500_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYR50585.1|937070_937448_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942566:942580	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029954	Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 chromosome, complete genome	4784767	1008352	1085664	4784767	tail,transposase,protease,terminase,integrase	Salmonella_phage(73.33%)	93	990418:990437	1061025:1061044
990418:990437	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYR50635.1|1008352_1009693_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYR50636.1|1009689_1009938_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYR50637.1|1009978_1010224_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYR50638.1|1010223_1011105_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYR50639.1|1011101_1012166_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYR50640.1|1012243_1012924_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYR50641.1|1012920_1013706_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYR50642.1|1013711_1014008_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYR50643.1|1014098_1014299_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYR50644.1|1014587_1014992_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYR50645.1|1015323_1015698_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYR50646.1|1015782_1016766_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYR50647.1|1016768_1017518_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYR50648.1|1017528_1017876_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYR50649.1|1017872_1018397_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYR50650.1|1018396_1018870_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYR50651.1|1018873_1019446_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYR50652.1|1019539_1019806_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYR50653.1|1019887_1020049_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR50654.1|1020481_1020979_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR50655.1|1021163_1021403_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYR50656.1|1021392_1021698_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYR50657.1|1021737_1022340_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYR50658.1|1022548_1023160_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYR50659.1|1023292_1024090_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYR50660.1|1024488_1024614_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR50661.1|1024749_1025199_-	lipoprotein	NA	NA	NA	NA	NA
AYR50662.1|1025415_1025805_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYR50663.1|1025791_1026073_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYR50664.1|1026072_1026687_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYR50665.1|1026905_1027160_+	hypothetical protein	NA	NA	NA	NA	NA
AYR50666.1|1027264_1027642_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYR50667.1|1027705_1027966_+	hypothetical protein	NA	NA	NA	NA	NA
AYR50668.1|1028055_1028808_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYR50669.1|1028773_1030177_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYR50670.1|1030176_1031646_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYR50671.1|1031737_1032268_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYR50672.1|1032282_1033515_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYR50673.1|1033519_1034017_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYR50674.1|1034028_1034970_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYR50675.1|1035011_1035380_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYR50676.1|1035345_1035753_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYR50677.1|1035749_1036304_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYR50678.1|1036290_1036680_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYR50679.1|1036654_1037218_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYR50680.1|1037221_1038367_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYR50681.1|1038378_1038819_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYR50682.1|1038822_1039275_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYR50683.1|1039452_1041405_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYR50684.1|1041404_1042055_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYR50685.1|1042058_1042361_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYR50686.1|1042363_1043395_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYR50687.1|1043391_1043727_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYR50688.1|1043921_1044653_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR50689.1|1044652_1045081_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR50690.1|1045139_1045895_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYR50691.1|1045982_1046120_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYR50692.1|1046135_1046489_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYR50693.1|1046489_1047689_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYR50694.1|1047685_1048366_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYR50695.1|1048365_1049877_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYR50696.1|1049891_1050410_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYR50697.1|1051331_1052033_-	hypothetical protein	NA	NA	NA	NA	NA
AYR50698.1|1052345_1052624_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYR50699.1|1053049_1055662_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYR50700.1|1055869_1056880_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYR50701.1|1057042_1057588_+	hypothetical protein	NA	NA	NA	NA	NA
AYR50702.1|1057584_1058694_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYR50703.1|1058792_1060901_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYR50704.1|1060913_1062821_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061025:1061044	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYR50705.1|1062835_1064089_+	inner membrane protein	NA	NA	NA	NA	NA
AYR50706.1|1064093_1065734_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYR50707.1|1065730_1066294_+	lipoprotein	NA	NA	NA	NA	NA
AYR50708.1|1066547_1066715_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYR50709.1|1066814_1067333_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYR50710.1|1067401_1069162_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYR50711.1|1069347_1069800_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYR50712.1|1069871_1070924_-	outer membrane protein A	NA	NA	NA	NA	NA
AYR50713.1|1071278_1071788_-	cell division inhibitor	NA	NA	NA	NA	NA
AYR50714.1|1072004_1072610_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYR50715.1|1072596_1074750_-	inner membrane protein	NA	NA	NA	NA	NA
AYR50716.1|1074768_1075215_-	hypothetical protein	NA	NA	NA	NA	NA
AYR50717.1|1075338_1077393_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYR50718.1|1077428_1077887_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYR50719.1|1077981_1078644_-	hypothetical protein	NA	NA	NA	NA	NA
AYR50720.1|1078814_1079231_+	hypothetical protein	NA	NA	NA	NA	NA
AYR50721.1|1079275_1079593_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYR50722.1|1079650_1080862_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYR50723.1|1081993_1082452_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR50724.1|1083188_1083470_+	acylphosphatase	NA	NA	NA	NA	NA
AYR50725.1|1083466_1083796_-	sulfite reductase	NA	NA	NA	NA	NA
AYR50726.1|1083882_1084542_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYR50727.1|1085205_1085664_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029954	Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 chromosome, complete genome	4784767	1528663	1602261	4784767	tRNA,tail,transposase,head,protease,plate	Burkholderia_virus(44.12%)	72	NA	NA
AYR51127.1|1528663_1529122_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR51128.1|1529624_1529906_+	stress response protein	NA	NA	NA	NA	NA
AYR51129.1|1530174_1530996_+|protease	serine protease	protease	NA	NA	NA	NA
AYR51130.1|1531030_1531360_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYR51131.1|1531346_1531709_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYR51132.1|1531820_1531991_-	hypothetical protein	NA	NA	NA	NA	NA
AYR51133.1|1532125_1533160_+	hypothetical protein	NA	NA	NA	NA	NA
AYR51134.1|1533334_1534723_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYR51135.1|1534733_1536263_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYR51136.1|1536789_1537734_+	hypothetical protein	NA	NA	NA	NA	NA
AYR51137.1|1537915_1538305_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYR51138.1|1538276_1538729_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYR51139.1|1538923_1539154_-	hypothetical protein	NA	NA	NA	NA	NA
AYR51140.1|1539150_1539834_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYR51141.1|1540418_1540721_-	hypothetical protein	NA	NA	NA	NA	NA
AYR51142.1|1541291_1541822_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYR51143.1|1542121_1543288_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYR51144.1|1543298_1545068_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYR51145.1|1546512_1546863_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYR51146.1|1547577_1548228_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYR51147.1|1548550_1548862_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYR51148.1|1548861_1549407_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYR51149.1|1549403_1550999_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYR51150.1|1550998_1552495_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYR51151.1|1552475_1553297_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYR51152.1|1553299_1553758_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYR51153.1|1553972_1555088_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYR51154.1|1555102_1556056_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYR51155.1|1556065_1556404_+	hypothetical protein	NA	NA	NA	NA	NA
AYR51156.1|1556405_1556852_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYR51157.1|1556851_1557316_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYR51158.1|1557556_1558984_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYR51159.1|1558983_1559505_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYR51160.1|1559507_1559789_+	hypothetical protein	NA	NA	NA	NA	NA
AYR51161.1|1559886_1560222_+	hypothetical protein	NA	NA	NA	NA	NA
AYR51162.1|1560397_1562863_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYR51163.1|1562862_1563747_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYR51164.1|1563743_1563959_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYR51165.1|1563946_1565101_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYR51166.1|1565097_1565625_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYR51167.1|1565681_1566029_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYR51168.1|1566019_1567123_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYR51169.1|1567115_1567694_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYR51170.1|1567696_1568722_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYR51171.1|1569235_1569853_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYR51172.1|1571363_1571936_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYR51173.1|1572216_1573599_+	amino acid permease	NA	NA	NA	NA	NA
AYR51174.1|1573660_1573996_-	hypothetical protein	NA	NA	NA	NA	NA
AYR51175.1|1574122_1574854_+	two-component response regulator	NA	NA	NA	NA	NA
AYR51176.1|1575334_1576486_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYR51177.1|1576638_1578345_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYR51178.1|1578452_1579757_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYR51179.1|1579832_1580762_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYR51180.1|1580758_1582162_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYR51181.1|1582329_1583976_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYR51182.1|1584175_1585351_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYR51183.1|1585453_1586962_+	hypothetical protein	NA	NA	NA	NA	NA
AYR51184.1|1587667_1588669_+	adenosine deaminase	NA	NA	NA	NA	NA
AYR51185.1|1588742_1589858_-	oxidoreductase	NA	NA	NA	NA	NA
AYR51186.1|1589960_1590116_+	hypothetical protein	NA	NA	NA	NA	NA
AYR51187.1|1590414_1590630_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYR51188.1|1590718_1591159_+	hypothetical protein	NA	NA	NA	NA	NA
AYR51189.1|1591235_1591817_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYR51190.1|1591816_1592395_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYR51191.1|1592387_1594409_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYR51192.1|1594409_1595468_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYR51193.1|1595471_1596092_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYR51194.1|1596094_1596787_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYR51195.1|1596786_1597422_+	endonuclease III	NA	NA	NA	NA	NA
AYR51196.1|1598022_1599528_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYR51197.1|1599632_1600238_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYR51198.1|1600986_1602261_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029954	Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 chromosome, complete genome	4784767	1783298	1787710	4784767		Escherichia_phage(50.0%)	6	NA	NA
AYR51382.1|1783298_1783538_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYR51383.1|1784410_1785220_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYR51384.1|1785292_1785670_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYR51385.1|1785817_1786360_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYR51386.1|1786551_1787280_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYR51387.1|1787296_1787710_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029954	Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 chromosome, complete genome	4784767	1991563	1998797	4784767		Morganella_phage(33.33%)	7	NA	NA
AYR51577.1|1991563_1992994_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYR51578.1|1993067_1993763_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYR51579.1|1993842_1994154_-	hypothetical protein	NA	NA	NA	NA	NA
AYR51580.1|1994804_1995989_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYR51581.1|1996448_1996661_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYR51582.1|1997106_1998375_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYR51583.1|1998377_1998797_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029954	Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 chromosome, complete genome	4784767	2105098	2115605	4784767		Enterobacteria_phage(37.5%)	10	NA	NA
AYR51680.1|2105098_2106412_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYR51681.1|2106438_2107518_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYR51682.1|2107522_2108296_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYR51683.1|2108311_2109286_-	reductase RfbI	NA	NA	NA	NA	NA
AYR51684.1|2109291_2109843_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYR51685.1|2109843_2110722_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYR51686.1|2110769_2111669_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYR51687.1|2111668_2112754_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYR51688.1|2113130_2114024_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYR51689.1|2114201_2115605_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029954	Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 chromosome, complete genome	4784767	2192834	2202005	4784767	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYR51749.1|2192834_2194868_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYR51750.1|2195108_2195567_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYR51751.1|2195738_2196269_+	lipoprotein	NA	NA	NA	NA	NA
AYR51752.1|2196325_2196793_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYR51753.1|2196839_2197559_-	two-component system response regulator	NA	NA	NA	NA	NA
AYR51754.1|2197555_2199241_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYR51755.1|2199463_2200195_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYR51756.1|2200254_2200362_+	hypothetical protein	NA	NA	NA	NA	NA
AYR51757.1|2200342_2201074_-	ABC transporter permease	NA	NA	NA	NA	NA
AYR51758.1|2201057_2202005_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029954	Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 chromosome, complete genome	4784767	2737497	2750889	4784767	tail	Salmonella_phage(70.0%)	11	NA	NA
AYR52187.1|2737497_2737716_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYR52188.1|2737806_2738907_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYR52189.1|2738903_2739389_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYR52190.1|2739385_2742463_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYR52191.1|2742455_2742575_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYR52192.1|2742589_2742892_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYR52193.1|2742946_2743462_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYR52194.1|2743471_2744644_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYR52195.1|2744786_2745359_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYR52196.1|2746036_2747152_+	glycosyltransferase	NA	NA	NA	NA	NA
AYR52197.1|2747232_2750889_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029954	Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 chromosome, complete genome	4784767	3068187	3111890	4784767	tRNA,protease,bacteriocin,transposase	Bacillus_virus(33.33%)	44	NA	NA
AYR52484.1|3068187_3068646_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR52485.1|3068835_3069915_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYR52486.1|3070016_3071180_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYR52487.1|3071201_3072248_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYR52488.1|3072621_3073047_+	hypothetical protein	NA	NA	NA	NA	NA
AYR52489.1|3073072_3073651_+	hypothetical protein	NA	NA	NA	NA	NA
AYR52490.1|3073684_3074359_+	hypothetical protein	NA	NA	NA	NA	NA
AYR52491.1|3074340_3075024_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYR52492.1|3075017_3075674_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYR52493.1|3075778_3076237_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR52494.1|3076425_3078417_-	transketolase	NA	NA	NA	NA	NA
AYR52495.1|3078692_3079451_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYR52496.1|3079551_3080472_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYR52497.1|3080699_3082676_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYR52498.1|3082684_3082816_-	hypothetical protein	NA	NA	NA	NA	NA
AYR52499.1|3083110_3083410_-	membrane protein	NA	NA	NA	NA	NA
AYR52500.1|3083465_3084620_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYR52501.1|3085112_3086507_+	galactose-proton symport	NA	NA	NA	NA	NA
AYR52502.1|3086585_3087083_+	hypothetical protein	NA	NA	NA	NA	NA
AYR52503.1|3087178_3087886_+	endonuclease I	NA	NA	NA	NA	NA
AYR52504.1|3087962_3088694_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYR52505.1|3088713_3089661_+	glutathione synthetase	NA	NA	NA	NA	NA
AYR52506.1|3089876_3090440_+	hypothetical protein	NA	NA	NA	NA	NA
AYR52507.1|3090439_3090856_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYR52508.1|3090902_3091589_-	global regulatory protein	NA	NA	NA	NA	NA
AYR52509.1|3091718_3092699_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYR52510.1|3092716_3093421_+	hypothetical protein	NA	NA	NA	NA	NA
AYR52511.1|3093439_3094006_+	hypothetical protein	NA	NA	NA	NA	NA
AYR52512.1|3094002_3094293_+	hypothetical protein	NA	NA	NA	NA	NA
AYR52513.1|3094300_3094894_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYR52514.1|3094886_3096023_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYR52515.1|3096113_3097121_-	hypothetical protein	NA	NA	NA	NA	NA
AYR52516.1|3097253_3098300_-	L-asparaginase	NA	NA	NA	NA	NA
AYR52517.1|3098618_3099077_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR52518.1|3099199_3099919_-	hypothetical protein	NA	NA	NA	NA	NA
AYR52519.1|3099968_3100295_-	hypothetical protein	NA	NA	NA	NA	NA
AYR52520.1|3100294_3101014_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYR52521.1|3101168_3102221_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYR52522.1|3102248_3102524_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYR52523.1|3102636_3103722_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYR52524.1|3103938_3105195_+	nucleoside permease	NA	NA	NA	NA	NA
AYR52525.1|3107805_3108513_+	hypothetical protein	NA	NA	NA	NA	NA
AYR52526.1|3111102_3111369_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYR52527.1|3111611_3111890_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029954	Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 chromosome, complete genome	4784767	3489073	3527131	4784767	tail,portal,plate,capsid,transposase,terminase,integrase	Salmonella_phage(82.05%)	46	3484037:3484051	3496203:3496217
3484037:3484051	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYR52855.1|3489073_3490720_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYR52856.1|3490859_3490958_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYR52857.1|3491213_3491543_+	hypothetical protein	NA	NA	NA	NA	NA
AYR52858.1|3491583_3492636_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYR52859.1|3493031_3493601_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYR52860.1|3493726_3493948_+	hypothetical protein	NA	NA	NA	NA	NA
AYR52861.1|3493980_3494490_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYR52862.1|3494664_3494889_+	hypothetical protein	NA	NA	NA	NA	NA
AYR52863.1|3494911_3495253_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYR52864.1|3495320_3495554_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYR52865.1|3495553_3495781_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYR52866.1|3495777_3496635_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3496203:3496217	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYR52867.1|3496631_3499046_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYR52868.1|3499199_3499388_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYR52869.1|3501355_3502270_+	hypothetical protein	NA	NA	NA	NA	NA
AYR52870.1|3502266_3503007_+	hypothetical protein	NA	NA	NA	NA	NA
AYR52871.1|3503041_3504079_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYR52872.1|3504078_3505845_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYR52873.1|3505987_3506821_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYR52874.1|3506837_3507896_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYR52875.1|3507899_3508550_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYR52876.1|3508582_3509110_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYR52877.1|3509109_3509313_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYR52878.1|3509316_3509532_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYR52879.1|3509551_3510025_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYR52880.1|3510026_3510404_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYR52881.1|3510400_3510829_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYR52882.1|3510924_3511356_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYR52883.1|3511348_3511795_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYR52884.1|3511863_3512442_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYR52885.1|3512438_3512798_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYR52886.1|3512784_3513693_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYR52887.1|3513685_3514291_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYR52888.1|3514287_3515802_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYR52889.1|3515801_3516395_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYR52890.1|3516366_3516807_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYR52891.1|3517229_3517802_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYR52892.1|3517944_3519117_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYR52893.1|3519126_3519642_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYR52894.1|3519696_3519999_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYR52895.1|3520013_3520133_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYR52896.1|3520125_3523203_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYR52897.1|3523199_3523685_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYR52898.1|3523681_3524782_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYR52899.1|3524872_3525091_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYR52900.1|3526672_3527131_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029954	Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 chromosome, complete genome	4784767	4443996	4518253	4784767	tail,portal,terminase,capsid,plate,integrase	Salmonella_phage(82.98%)	76	4505497:4505513	4518412:4518428
AYR53672.1|4443996_4445946_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYR53673.1|4446017_4446926_+	hypothetical protein	NA	NA	NA	NA	NA
AYR53674.1|4446999_4447899_+	hypothetical protein	NA	NA	NA	NA	NA
AYR53675.1|4447940_4448300_+	hypothetical protein	NA	NA	NA	NA	NA
AYR53676.1|4448399_4448669_-	hypothetical protein	NA	NA	NA	NA	NA
AYR53677.1|4448800_4450075_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYR53678.1|4450294_4450672_+	hypothetical protein	NA	NA	NA	NA	NA
AYR53679.1|4450758_4450977_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYR53680.1|4451044_4452145_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYR53681.1|4452141_4452627_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYR53682.1|4452626_4455407_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYR53683.1|4455399_4455519_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYR53684.1|4455533_4455836_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYR53685.1|4455890_4456406_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYR53686.1|4456415_4457588_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYR53687.1|4458122_4458845_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYR53688.1|4459042_4459450_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYR53689.1|4459456_4461076_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYR53690.1|4461072_4461678_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYR53691.1|4461670_4462579_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYR53692.1|4462565_4462925_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYR53693.1|4462921_4463500_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYR53694.1|4463568_4464015_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYR53695.1|4464007_4464439_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYR53696.1|4464534_4464960_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYR53697.1|4464959_4465337_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYR53698.1|4465341_4465812_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYR53699.1|4465831_4466047_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYR53700.1|4466050_4466254_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYR53701.1|4466253_4466718_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYR53702.1|4466811_4467462_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYR53703.1|4467465_4468530_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYR53704.1|4468546_4469380_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYR53705.1|4469522_4471289_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYR53706.1|4471285_4472332_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYR53707.1|4472380_4473076_-	hypothetical protein	NA	NA	NA	NA	NA
AYR53708.1|4473095_4474160_-	hypothetical protein	NA	NA	NA	NA	NA
AYR53709.1|4474156_4475221_-	hypothetical protein	NA	NA	NA	NA	NA
AYR53710.1|4476145_4476475_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYR53711.1|4476471_4478541_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYR53712.1|4478531_4479392_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYR53713.1|4479388_4479973_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYR53714.1|4479969_4480197_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYR53715.1|4480196_4480430_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYR53716.1|4480497_4480839_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYR53717.1|4480802_4481003_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYR53718.1|4481010_4481520_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYR53719.1|4481552_4481795_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYR53720.1|4481911_4482544_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYR53721.1|4482547_4483573_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYR53722.1|4483679_4484033_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYR53723.1|4484649_4484937_+	hypothetical protein	NA	NA	NA	NA	NA
AYR53724.1|4484947_4485838_+	methyltransferase	NA	NA	NA	NA	NA
AYR53725.1|4485837_4486584_+	hypothetical protein	NA	NA	NA	NA	NA
AYR53726.1|4486885_4488856_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYR53727.1|4488875_4490180_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYR53728.1|4490202_4490898_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYR53729.1|4490923_4491718_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYR53730.1|4491727_4492795_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYR53731.1|4492839_4494576_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYR53732.1|4494575_4497071_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYR53733.1|4497094_4498141_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYR53734.1|4498143_4499421_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYR53735.1|4499665_4500205_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYR53736.1|4501058_4502570_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYR53737.1|4502553_4504143_+	hypothetical protein	NA	NA	NA	NA	NA
AYR53738.1|4504306_4505320_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4505497:4505513	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYR53739.1|4505746_4506040_+	hypothetical protein	NA	NA	NA	NA	NA
AYR53740.1|4506036_4506525_+	hypothetical protein	NA	NA	NA	NA	NA
AYR53741.1|4506704_4507157_-	hypothetical protein	NA	NA	NA	NA	NA
AYR53742.1|4512379_4512841_+	hypothetical protein	NA	NA	NA	NA	NA
AYR53743.1|4512837_4513059_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYR53744.1|4513915_4514698_+	hypothetical protein	NA	NA	NA	NA	NA
AYR53745.1|4515324_4515549_-	hypothetical protein	NA	NA	NA	NA	NA
AYR53746.1|4515678_4516683_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYR53747.1|4516993_4518253_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4518412:4518428	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029954	Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 chromosome, complete genome	4784767	4660505	4670764	4784767	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYR53884.1|4660505_4661582_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYR53885.1|4661578_4662652_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYR53886.1|4662626_4663790_-	hypothetical protein	NA	NA	NA	NA	NA
AYR53887.1|4664065_4664632_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYR53888.1|4664647_4664887_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYR53889.1|4664890_4665751_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYR53890.1|4666173_4666497_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYR53891.1|4666480_4666981_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYR53892.1|4666977_4667205_+	hypothetical protein	NA	NA	NA	NA	NA
AYR53893.1|4667201_4667522_+	P4 phage protein	NA	NA	NA	NA	NA
AYR53894.1|4667536_4668211_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYR53895.1|4668207_4669869_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYR53896.1|4670605_4670764_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029953	Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence	217395	3612	57130	217395	transposase,holin	Escherichia_phage(43.75%)	56	NA	NA
AYR49563.1|3612_3888_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR49564.1|3806_4310_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	6.3e-94
AYR49565.1|4636_4861_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49566.1|5516_5777_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49567.1|5865_6357_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49568.1|6361_6670_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49569.1|6877_7258_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49570.1|7343_7592_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49571.1|7629_7851_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	8.2e-06
AYR49572.1|8013_8397_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49573.1|8711_8936_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49574.1|9022_9487_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49575.1|9669_12099_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49576.1|12221_12668_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49577.1|12715_13522_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49578.1|13749_13992_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49579.1|14069_14402_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49580.1|14901_16083_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49581.1|16091_16388_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
AYR49582.1|16451_16919_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49583.1|17778_18555_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49584.1|18704_19481_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49585.1|19669_20011_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49586.1|20111_20375_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.1e-08
AYR49587.1|20608_21307_+	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	4.2e-11
AYR49588.1|21461_21758_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49589.1|21845_24230_-	periplasmic protein	NA	NA	NA	NA	NA
AYR49590.1|24480_25089_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49591.1|25201_25498_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49592.1|25502_26099_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49593.1|26490_27372_+	replication protein	NA	J9Q7H0	Salmonella_phage	41.3	6.5e-54
AYR49594.1|27957_28473_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49595.1|29123_31580_-	periplasmic protein	NA	NA	NA	NA	NA
AYR49596.1|32216_33971_-	DNA restriction methylase	NA	J9Q747	Salmonella_phage	30.9	1.1e-68
AYR49597.1|34156_35314_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.1e-19
AYR49598.1|35673_36498_+	DNA modification methylase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
AYR49599.1|36512_37334_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49600.1|37616_38324_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49601.1|38538_39615_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
AYR49602.1|40149_41025_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
AYR49603.1|41278_41860_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49604.1|42466_42820_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49605.1|42871_43189_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49606.1|43188_43986_+	pilus assembly protein	NA	NA	NA	NA	NA
AYR49607.1|43988_45221_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49608.1|45222_45663_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49609.1|45640_47011_+	TrhB	NA	NA	NA	NA	NA
AYR49610.1|47019_47532_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49611.1|47532_48390_+	plasmid transfer protein	NA	NA	NA	NA	NA
AYR49612.1|48399_49350_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49613.1|49358_52040_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49614.1|52673_52949_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	93.4	1.9e-44
AYR49615.1|53077_55081_+|holin	transporter, betaine/carnitine/choline family	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AYR49616.1|55143_56439_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49617.1|56432_56936_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR49618.1|56854_57130_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
>prophage 2
CP029953	Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence	217395	82223	134896	217395	transposase,integrase	Escherichia_phage(50.0%)	63	107127:107141	131627:131641
AYR49638.1|82223_82727_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR49639.1|82645_82921_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR49640.1|82962_84819_+	hypothetical protein	NA	S5MMD7	Bacillus_phage	26.4	2.2e-19
AYR49641.1|85216_86092_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49642.1|86150_86528_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49643.1|86588_87575_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49644.1|87634_88687_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49645.1|88725_88995_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49646.1|89065_90193_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49647.1|90270_92283_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49648.1|92354_92576_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49649.1|92690_93923_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
AYR49650.1|94197_94722_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49651.1|94712_95678_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49652.1|95748_96684_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49653.1|96761_97682_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49654.1|97754_98690_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49655.1|98866_99823_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49656.1|100235_100505_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49657.1|100559_101150_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49658.1|101157_101415_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49659.1|101488_102025_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49660.1|102041_102497_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49661.1|102480_102708_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49662.1|102756_103011_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49663.1|103078_104038_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49664.1|104048_104957_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49665.1|105261_106443_-	recombinase	NA	NA	NA	NA	NA
AYR49666.1|106657_106870_+	regulatory protein	NA	NA	NA	NA	NA
107127:107141	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYR49667.1|107176_107452_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	7.7e-46
107127:107141	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYR49668.1|107370_107874_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR49669.1|107980_108415_-	transcriptional regulator MerR	NA	NA	NA	NA	NA
AYR49670.1|108432_108837_+	MerT	NA	NA	NA	NA	NA
AYR49671.1|108850_109126_+	mercuric transport protein	NA	NA	NA	NA	NA
AYR49672.1|109161_109584_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AYR49673.1|109635_111330_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYR49674.1|111347_111710_+	transcriptional regulator MerD	NA	NA	NA	NA	NA
AYR49675.1|111706_111943_+	mercury resistance protein	NA	NA	NA	NA	NA
AYR49676.1|111939_112647_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49677.1|112685_113990_+|integrase	integrase	integrase	NA	NA	NA	NA
AYR49678.1|114018_114741_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR49679.1|115496_116348_+	replication protein	NA	NA	NA	NA	NA
AYR49680.1|116655_117471_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AYR49681.1|117531_118335_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYR49682.1|118334_119171_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYR49683.1|119231_119954_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR49684.1|120533_121394_-	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
120988:121002	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYR49685.1|121576_121843_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
120988:121002	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYR49686.1|121875_122598_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR49687.1|122831_123758_-	sulfonamide-resistant dihydropteroate synthase sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	7.2e-11
AYR49688.1|123664_124045_-	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYR49689.1|124241_124841_-	dihydrofolate reductase	NA	A0A1B2IAU3	Erwinia_phage	32.8	5.3e-15
AYR49690.1|124872_125886_+|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYR49691.1|125875_126439_+	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYR49692.1|126564_127125_+	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYR49693.1|127127_130094_+|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYR49694.1|130160_130538_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49695.1|130738_131398_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AYR49696.1|131676_131952_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR49697.1|131870_132374_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	1.1e-93
AYR49698.1|132955_133711_+	replication protein	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
AYR49699.1|134198_134474_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR49700.1|134392_134896_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	92.8	1.4e-88
