The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029940	Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 chromosome, complete genome	4786487	930316	937628	4786487	integrase,protease	Dickeya_phage(16.67%)	6	931567:931581	942746:942760
AYR59388.1|930316_931435_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYR59389.1|931431_933378_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931567:931581	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYR59390.1|933507_933729_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYR59391.1|934052_934373_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYR59392.1|934403_936680_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYR59393.1|937250_937628_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942746:942760	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029940	Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 chromosome, complete genome	4786487	1008571	1085883	4786487	integrase,tail,transposase,terminase,protease	Salmonella_phage(73.33%)	93	990637:990656	1061244:1061263
990637:990656	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYR59443.1|1008571_1009912_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYR59444.1|1009908_1010157_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYR59445.1|1010197_1010443_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYR59446.1|1010442_1011324_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYR59447.1|1011320_1012385_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYR59448.1|1012462_1013143_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYR59449.1|1013139_1013925_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYR59450.1|1013930_1014227_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYR59451.1|1014317_1014518_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYR59452.1|1014806_1015211_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYR59453.1|1015542_1015917_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYR59454.1|1016001_1016985_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYR59455.1|1016987_1017737_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYR59456.1|1017747_1018095_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYR59457.1|1018091_1018616_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYR59458.1|1018615_1019089_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYR59459.1|1019092_1019665_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYR59460.1|1019758_1020025_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYR59461.1|1020106_1020268_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR59462.1|1020700_1021198_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR59463.1|1021382_1021622_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYR59464.1|1021611_1021917_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYR59465.1|1021956_1022559_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYR59466.1|1022767_1023379_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYR59467.1|1023511_1024309_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYR59468.1|1024707_1024833_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR59469.1|1024968_1025418_-	lipoprotein	NA	NA	NA	NA	NA
AYR59470.1|1025634_1026024_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYR59471.1|1026010_1026292_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYR59472.1|1026291_1026906_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYR59473.1|1027124_1027379_+	hypothetical protein	NA	NA	NA	NA	NA
AYR59474.1|1027483_1027861_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYR59475.1|1027924_1028185_+	hypothetical protein	NA	NA	NA	NA	NA
AYR59476.1|1028274_1029027_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYR59477.1|1028992_1030396_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYR59478.1|1030395_1031865_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYR59479.1|1031956_1032487_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYR59480.1|1032501_1033734_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYR59481.1|1033738_1034236_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYR59482.1|1034247_1035189_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYR59483.1|1035230_1035599_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYR59484.1|1035564_1035972_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYR59485.1|1035968_1036523_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYR59486.1|1036509_1036899_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYR59487.1|1036873_1037437_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYR59488.1|1037440_1038586_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYR59489.1|1038597_1039038_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYR59490.1|1039041_1039494_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYR59491.1|1039671_1041624_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYR59492.1|1041623_1042274_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYR59493.1|1042277_1042580_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYR59494.1|1042582_1043614_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYR59495.1|1043610_1043946_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYR59496.1|1044140_1044872_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR59497.1|1044871_1045300_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR59498.1|1045358_1046114_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYR59499.1|1046201_1046339_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYR59500.1|1046354_1046708_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYR59501.1|1046708_1047908_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYR59502.1|1047904_1048585_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYR59503.1|1048584_1050096_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYR59504.1|1050110_1050629_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYR59505.1|1051550_1052252_-	hypothetical protein	NA	NA	NA	NA	NA
AYR59506.1|1052564_1052843_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYR59507.1|1053268_1055881_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYR59508.1|1056088_1057099_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYR59509.1|1057261_1057807_+	hypothetical protein	NA	NA	NA	NA	NA
AYR59510.1|1057803_1058913_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYR59511.1|1059011_1061120_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYR59512.1|1061132_1063040_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061244:1061263	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYR59513.1|1063054_1064308_+	inner membrane protein	NA	NA	NA	NA	NA
AYR59514.1|1064312_1065953_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYR59515.1|1065949_1066513_+	lipoprotein	NA	NA	NA	NA	NA
AYR59516.1|1066766_1066934_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYR59517.1|1067033_1067552_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYR59518.1|1067620_1069381_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYR59519.1|1069566_1070019_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYR59520.1|1070090_1071143_-	outer membrane protein A	NA	NA	NA	NA	NA
AYR59521.1|1071497_1072007_-	cell division inhibitor	NA	NA	NA	NA	NA
AYR59522.1|1072223_1072829_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYR59523.1|1072815_1074969_-	inner membrane protein	NA	NA	NA	NA	NA
AYR59524.1|1074987_1075434_-	hypothetical protein	NA	NA	NA	NA	NA
AYR59525.1|1075557_1077612_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYR59526.1|1077647_1078106_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYR59527.1|1078200_1078863_-	hypothetical protein	NA	NA	NA	NA	NA
AYR59528.1|1079033_1079450_+	hypothetical protein	NA	NA	NA	NA	NA
AYR59529.1|1079494_1079812_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYR59530.1|1079869_1081081_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYR59531.1|1082212_1082671_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR59532.1|1083407_1083689_+	acylphosphatase	NA	NA	NA	NA	NA
AYR59533.1|1083685_1084015_-	sulfite reductase	NA	NA	NA	NA	NA
AYR59534.1|1084101_1084761_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYR59535.1|1085424_1085883_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029940	Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 chromosome, complete genome	4786487	1528701	1602243	4786487	tail,head,transposase,tRNA,plate,protease	Burkholderia_virus(41.03%)	82	NA	NA
AYR59935.1|1528701_1529160_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR59936.1|1529662_1529944_+	stress response protein	NA	NA	NA	NA	NA
AYR59937.1|1530212_1531034_+|protease	serine protease	protease	NA	NA	NA	NA
AYR59938.1|1531068_1531398_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYR59939.1|1531384_1531747_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYR59940.1|1531858_1532029_-	hypothetical protein	NA	NA	NA	NA	NA
AYR59941.1|1532163_1533198_+	hypothetical protein	NA	NA	NA	NA	NA
AYR59942.1|1533372_1534761_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYR59943.1|1534771_1536301_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYR59944.1|1536827_1537772_+	hypothetical protein	NA	NA	NA	NA	NA
AYR59945.1|1537953_1538343_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYR59946.1|1538314_1538767_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYR59947.1|1538961_1539192_-	hypothetical protein	NA	NA	NA	NA	NA
AYR59948.1|1539188_1539872_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYR59949.1|1539868_1540084_-	hypothetical protein	NA	NA	NA	NA	NA
AYR59950.1|1540076_1540460_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYR59951.1|1540456_1540759_-	hypothetical protein	NA	NA	NA	NA	NA
AYR59952.1|1540768_1541041_-	hypothetical protein	NA	NA	NA	NA	NA
AYR59953.1|1541329_1541860_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYR59954.1|1541887_1542157_-	hypothetical protein	NA	NA	NA	NA	NA
AYR59955.1|1542159_1543326_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYR59956.1|1543336_1545106_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYR59957.1|1545283_1545715_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYR59958.1|1545710_1546307_+	hypothetical protein	NA	NA	NA	NA	NA
AYR59959.1|1546550_1546901_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYR59960.1|1547615_1548266_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYR59961.1|1548262_1548589_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYR59962.1|1548588_1548900_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYR59963.1|1548899_1549445_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYR59964.1|1549441_1551037_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYR59965.1|1551036_1552533_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYR59966.1|1552513_1553335_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYR59967.1|1553337_1553796_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYR59968.1|1554010_1555126_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYR59969.1|1555140_1556094_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYR59970.1|1556103_1556442_+	hypothetical protein	NA	NA	NA	NA	NA
AYR59971.1|1556443_1556890_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYR59972.1|1556889_1557354_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYR59973.1|1557350_1557605_+	hypothetical protein	NA	NA	NA	NA	NA
AYR59974.1|1557594_1559022_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYR59975.1|1559021_1559543_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYR59976.1|1559545_1559827_+	hypothetical protein	NA	NA	NA	NA	NA
AYR59977.1|1559924_1560260_+	hypothetical protein	NA	NA	NA	NA	NA
AYR59978.1|1560435_1562901_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYR59979.1|1562900_1563785_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYR59980.1|1563781_1563997_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYR59981.1|1563984_1565139_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYR59982.1|1565135_1565663_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYR59983.1|1565719_1566067_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYR59984.1|1566057_1567161_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYR59985.1|1567153_1567732_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYR59986.1|1567734_1568760_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYR59987.1|1568811_1569246_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	44.9	1.3e-23
AYR59988.1|1569245_1569863_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYR59989.1|1570356_1570749_-	hypothetical protein	NA	Q9MCR6	Enterobacteria_phage	51.1	6.8e-19
AYR59990.1|1571345_1571918_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYR59991.1|1572198_1573581_+	amino acid permease	NA	NA	NA	NA	NA
AYR59992.1|1573642_1573978_-	hypothetical protein	NA	NA	NA	NA	NA
AYR59993.1|1574104_1574836_+	two-component response regulator	NA	NA	NA	NA	NA
AYR59994.1|1575316_1576468_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYR59995.1|1576620_1578327_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYR59996.1|1578434_1579739_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYR59997.1|1579814_1580744_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYR59998.1|1580740_1582144_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYR59999.1|1582311_1583958_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYR60000.1|1584157_1585333_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYR60001.1|1585435_1586944_+	hypothetical protein	NA	NA	NA	NA	NA
AYR60002.1|1587649_1588651_+	adenosine deaminase	NA	NA	NA	NA	NA
AYR60003.1|1588724_1589840_-	oxidoreductase	NA	NA	NA	NA	NA
AYR60004.1|1589942_1590098_+	hypothetical protein	NA	NA	NA	NA	NA
AYR60005.1|1590396_1590612_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYR60006.1|1590700_1591141_+	hypothetical protein	NA	NA	NA	NA	NA
AYR60007.1|1591217_1591799_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYR60008.1|1591798_1592377_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYR60009.1|1592369_1594391_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYR60010.1|1594391_1595450_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYR60011.1|1595453_1596074_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYR60012.1|1596076_1596769_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYR60013.1|1596768_1597404_+	endonuclease III	NA	NA	NA	NA	NA
AYR60014.1|1598004_1599510_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYR60015.1|1599614_1600220_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYR60016.1|1600968_1602243_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029940	Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 chromosome, complete genome	4786487	1784617	1789029	4786487		Escherichia_phage(50.0%)	6	NA	NA
AYR60201.1|1784617_1784857_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYR60202.1|1785729_1786539_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYR60203.1|1786611_1786989_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYR60204.1|1787136_1787679_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYR60205.1|1787870_1788599_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYR60206.1|1788615_1789029_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029940	Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 chromosome, complete genome	4786487	1992882	2000116	4786487		Morganella_phage(33.33%)	7	NA	NA
AYR60396.1|1992882_1994313_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYR60397.1|1994386_1995082_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYR60398.1|1995161_1995473_-	hypothetical protein	NA	NA	NA	NA	NA
AYR60399.1|1996123_1997308_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYR60400.1|1997767_1997980_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYR60401.1|1998425_1999694_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYR60402.1|1999696_2000116_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029940	Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 chromosome, complete genome	4786487	2106417	2116924	4786487		Enterobacteria_phage(37.5%)	10	NA	NA
AYR60499.1|2106417_2107731_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYR60500.1|2107757_2108837_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYR60501.1|2108841_2109615_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYR60502.1|2109630_2110605_-	reductase RfbI	NA	NA	NA	NA	NA
AYR60503.1|2110610_2111162_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYR60504.1|2111162_2112041_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYR60505.1|2112088_2112988_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYR60506.1|2112987_2114073_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYR60507.1|2114449_2115343_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYR60508.1|2115520_2116924_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029940	Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 chromosome, complete genome	4786487	2194153	2203324	4786487	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYR60568.1|2194153_2196187_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYR60569.1|2196427_2196886_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYR60570.1|2197057_2197588_+	lipoprotein	NA	NA	NA	NA	NA
AYR60571.1|2197644_2198112_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYR60572.1|2198158_2198878_-	two-component system response regulator	NA	NA	NA	NA	NA
AYR60573.1|2198874_2200560_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYR60574.1|2200782_2201514_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYR60575.1|2201573_2201681_+	hypothetical protein	NA	NA	NA	NA	NA
AYR60576.1|2201661_2202393_-	ABC transporter permease	NA	NA	NA	NA	NA
AYR60577.1|2202376_2203324_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029940	Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 chromosome, complete genome	4786487	2738841	2752233	4786487	tail	Salmonella_phage(70.0%)	11	NA	NA
AYR61006.1|2738841_2739060_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYR61007.1|2739150_2740251_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYR61008.1|2740247_2740733_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYR61009.1|2740729_2743807_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYR61010.1|2743799_2743919_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYR61011.1|2743933_2744236_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYR61012.1|2744290_2744806_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYR61013.1|2744815_2745988_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYR61014.1|2746130_2746703_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYR61015.1|2747380_2748496_+	glycosyltransferase	NA	NA	NA	NA	NA
AYR61016.1|2748576_2752233_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029940	Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 chromosome, complete genome	4786487	3070027	3113730	4786487	protease,transposase,bacteriocin,tRNA	Bacillus_virus(33.33%)	44	NA	NA
AYR61305.1|3070027_3070486_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR61306.1|3070675_3071755_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYR61307.1|3071856_3073020_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYR61308.1|3073041_3074088_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYR61309.1|3074461_3074887_+	hypothetical protein	NA	NA	NA	NA	NA
AYR61310.1|3074912_3075491_+	hypothetical protein	NA	NA	NA	NA	NA
AYR61311.1|3075524_3076199_+	hypothetical protein	NA	NA	NA	NA	NA
AYR61312.1|3076180_3076864_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYR61313.1|3076857_3077514_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYR61314.1|3077618_3078077_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR61315.1|3078265_3080257_-	transketolase	NA	NA	NA	NA	NA
AYR61316.1|3080532_3081291_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYR61317.1|3081391_3082312_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYR61318.1|3082539_3084516_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYR61319.1|3084524_3084656_-	hypothetical protein	NA	NA	NA	NA	NA
AYR61320.1|3084950_3085250_-	membrane protein	NA	NA	NA	NA	NA
AYR61321.1|3085305_3086460_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYR61322.1|3086952_3088347_+	galactose-proton symport	NA	NA	NA	NA	NA
AYR61323.1|3088425_3088923_+	hypothetical protein	NA	NA	NA	NA	NA
AYR61324.1|3089018_3089726_+	endonuclease I	NA	NA	NA	NA	NA
AYR61325.1|3089802_3090534_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYR61326.1|3090553_3091501_+	glutathione synthetase	NA	NA	NA	NA	NA
AYR61327.1|3091716_3092280_+	hypothetical protein	NA	NA	NA	NA	NA
AYR61328.1|3092279_3092696_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYR61329.1|3092742_3093429_-	global regulatory protein	NA	NA	NA	NA	NA
AYR61330.1|3093558_3094539_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYR61331.1|3094556_3095261_+	hypothetical protein	NA	NA	NA	NA	NA
AYR61332.1|3095279_3095846_+	hypothetical protein	NA	NA	NA	NA	NA
AYR61333.1|3095842_3096133_+	hypothetical protein	NA	NA	NA	NA	NA
AYR61334.1|3096140_3096734_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYR61335.1|3096726_3097863_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYR61336.1|3097953_3098961_-	hypothetical protein	NA	NA	NA	NA	NA
AYR61337.1|3099093_3100140_-	L-asparaginase	NA	NA	NA	NA	NA
AYR61338.1|3100458_3100917_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR61339.1|3101039_3101759_-	hypothetical protein	NA	NA	NA	NA	NA
AYR61340.1|3101808_3102135_-	hypothetical protein	NA	NA	NA	NA	NA
AYR61341.1|3102134_3102854_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYR61342.1|3103008_3104061_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYR61343.1|3104088_3104364_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYR61344.1|3104476_3105562_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYR61345.1|3105778_3107035_+	nucleoside permease	NA	NA	NA	NA	NA
AYR61346.1|3109645_3110353_+	hypothetical protein	NA	NA	NA	NA	NA
AYR61347.1|3112942_3113209_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYR61348.1|3113451_3113730_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029940	Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 chromosome, complete genome	4786487	3491049	3529107	4786487	integrase,tail,transposase,plate,terminase,portal,capsid	Salmonella_phage(82.05%)	46	3486013:3486027	3498179:3498193
3486013:3486027	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYR61676.1|3491049_3492696_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYR61677.1|3492835_3492934_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYR61678.1|3493189_3493519_+	hypothetical protein	NA	NA	NA	NA	NA
AYR61679.1|3493559_3494612_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYR61680.1|3495007_3495577_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYR61681.1|3495702_3495924_+	hypothetical protein	NA	NA	NA	NA	NA
AYR61682.1|3495956_3496466_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYR61683.1|3496640_3496865_+	hypothetical protein	NA	NA	NA	NA	NA
AYR61684.1|3496887_3497229_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYR61685.1|3497296_3497530_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYR61686.1|3497529_3497757_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYR61687.1|3497753_3498611_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3498179:3498193	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYR61688.1|3498607_3501022_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYR61689.1|3501175_3501364_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYR61690.1|3503331_3504246_+	hypothetical protein	NA	NA	NA	NA	NA
AYR61691.1|3504242_3504983_+	hypothetical protein	NA	NA	NA	NA	NA
AYR61692.1|3505017_3506055_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYR61693.1|3506054_3507821_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYR61694.1|3507963_3508797_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYR61695.1|3508813_3509872_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYR61696.1|3509875_3510526_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYR61697.1|3510558_3511086_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYR61698.1|3511085_3511289_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYR61699.1|3511292_3511508_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYR61700.1|3511527_3512001_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYR61701.1|3512002_3512380_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYR61702.1|3512376_3512805_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYR61703.1|3512900_3513332_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYR61704.1|3513324_3513771_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYR61705.1|3513839_3514418_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYR61706.1|3514414_3514774_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYR61707.1|3514760_3515669_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYR61708.1|3515661_3516267_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYR61709.1|3516263_3517778_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYR61710.1|3517777_3518371_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYR61711.1|3518342_3518783_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYR61712.1|3519205_3519778_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYR61713.1|3519920_3521093_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYR61714.1|3521102_3521618_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYR61715.1|3521672_3521975_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYR61716.1|3521989_3522109_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYR61717.1|3522101_3525179_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYR61718.1|3525175_3525661_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYR61719.1|3525657_3526758_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYR61720.1|3526848_3527067_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYR61721.1|3528648_3529107_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029940	Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 chromosome, complete genome	4786487	4444802	4519059	4786487	integrase,tail,plate,terminase,portal,capsid	Salmonella_phage(82.98%)	76	4506303:4506319	4519218:4519234
AYR62492.1|4444802_4446752_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYR62493.1|4446823_4447732_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62494.1|4447805_4448705_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62495.1|4448746_4449106_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62496.1|4449205_4449475_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62497.1|4449606_4450881_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYR62498.1|4451100_4451478_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62499.1|4451564_4451783_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYR62500.1|4451850_4452951_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYR62501.1|4452947_4453433_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYR62502.1|4453432_4456213_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYR62503.1|4456205_4456325_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYR62504.1|4456339_4456642_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYR62505.1|4456696_4457212_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYR62506.1|4457221_4458394_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYR62507.1|4458928_4459651_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYR62508.1|4459848_4460256_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYR62509.1|4460262_4461882_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYR62510.1|4461878_4462484_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYR62511.1|4462476_4463385_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	96.7	4.4e-154
AYR62512.1|4463371_4463731_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYR62513.1|4463727_4464306_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYR62514.1|4464374_4464821_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYR62515.1|4464813_4465245_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYR62516.1|4465340_4465766_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYR62517.1|4465765_4466143_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYR62518.1|4466147_4466618_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYR62519.1|4466637_4466853_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYR62520.1|4466856_4467060_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYR62521.1|4467059_4467524_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYR62522.1|4467617_4468268_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYR62523.1|4468271_4469336_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYR62524.1|4469352_4470186_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYR62525.1|4470328_4472095_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYR62526.1|4472091_4473138_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYR62527.1|4473186_4473882_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62528.1|4473901_4474966_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62529.1|4474962_4476027_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62530.1|4476951_4477281_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYR62531.1|4477277_4479347_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYR62532.1|4479337_4480198_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYR62533.1|4480194_4480779_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYR62534.1|4480775_4481003_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYR62535.1|4481002_4481236_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYR62536.1|4481303_4481645_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYR62537.1|4481608_4481809_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYR62538.1|4481816_4482326_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYR62539.1|4482358_4482601_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYR62540.1|4482717_4483350_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYR62541.1|4483353_4484379_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYR62542.1|4484485_4484839_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYR62543.1|4485455_4485743_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62544.1|4485753_4486644_+	methyltransferase	NA	NA	NA	NA	NA
AYR62545.1|4486643_4487390_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62546.1|4487691_4489662_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYR62547.1|4489681_4490986_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYR62548.1|4491008_4491704_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYR62549.1|4491729_4492524_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYR62550.1|4492533_4493601_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYR62551.1|4493645_4495382_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYR62552.1|4495381_4497877_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYR62553.1|4497900_4498947_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYR62554.1|4498949_4500227_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYR62555.1|4500471_4501011_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYR62556.1|4501864_4503376_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYR62557.1|4503359_4504949_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62558.1|4505112_4506126_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4506303:4506319	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYR62559.1|4506552_4506846_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62560.1|4506842_4507331_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62561.1|4507510_4507963_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62562.1|4513185_4513647_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62563.1|4513643_4513865_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYR62564.1|4514721_4515504_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62565.1|4516130_4516355_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62566.1|4516484_4517489_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYR62567.1|4517799_4519059_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4519218:4519234	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029940	Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 chromosome, complete genome	4786487	4661311	4671570	4786487	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYR62704.1|4661311_4662388_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYR62705.1|4662384_4663458_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYR62706.1|4663432_4664596_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62707.1|4664871_4665438_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYR62708.1|4665453_4665693_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYR62709.1|4665696_4666557_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYR62710.1|4666979_4667303_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYR62711.1|4667286_4667787_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYR62712.1|4667783_4668011_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62713.1|4668007_4668328_+	P4 phage protein	NA	NA	NA	NA	NA
AYR62714.1|4668342_4669017_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYR62715.1|4669013_4670675_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYR62716.1|4671411_4671570_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029939	Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence	215792	3612	57130	215792	holin,transposase	Escherichia_phage(43.75%)	56	NA	NA
AYR58369.1|3612_3888_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR58370.1|3806_4310_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	6.3e-94
AYR58371.1|4636_4861_-	hypothetical protein	NA	NA	NA	NA	NA
AYR58372.1|5516_5777_-	hypothetical protein	NA	NA	NA	NA	NA
AYR58373.1|5865_6357_-	hypothetical protein	NA	NA	NA	NA	NA
AYR58374.1|6361_6670_-	hypothetical protein	NA	NA	NA	NA	NA
AYR58375.1|6877_7258_-	hypothetical protein	NA	NA	NA	NA	NA
AYR58376.1|7343_7592_-	hypothetical protein	NA	NA	NA	NA	NA
AYR58377.1|7629_7851_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	8.2e-06
AYR58378.1|8013_8397_-	hypothetical protein	NA	NA	NA	NA	NA
AYR58379.1|8711_8936_-	hypothetical protein	NA	NA	NA	NA	NA
AYR58380.1|9022_9487_-	hypothetical protein	NA	NA	NA	NA	NA
AYR58381.1|9669_12099_-	hypothetical protein	NA	NA	NA	NA	NA
AYR58382.1|12221_12668_-	hypothetical protein	NA	NA	NA	NA	NA
AYR58383.1|12715_13522_-	hypothetical protein	NA	NA	NA	NA	NA
AYR58384.1|13749_13992_-	hypothetical protein	NA	NA	NA	NA	NA
AYR58385.1|14069_14402_-	hypothetical protein	NA	NA	NA	NA	NA
AYR58386.1|14901_16083_-	hypothetical protein	NA	NA	NA	NA	NA
AYR58387.1|16091_16388_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
AYR58388.1|16451_16919_-	hypothetical protein	NA	NA	NA	NA	NA
AYR58389.1|17778_18555_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58390.1|18704_19481_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58391.1|19669_20011_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58392.1|20111_20375_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.1e-08
AYR58393.1|20608_21307_+	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	4.2e-11
AYR58394.1|21461_21758_-	hypothetical protein	NA	NA	NA	NA	NA
AYR58395.1|21845_24230_-	periplasmic protein	NA	NA	NA	NA	NA
AYR58396.1|24480_25089_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58397.1|25201_25498_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58398.1|25502_26099_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58399.1|26490_27372_+	replication protein	NA	J9Q7H0	Salmonella_phage	41.3	6.5e-54
AYR58400.1|27957_28473_-	hypothetical protein	NA	NA	NA	NA	NA
AYR58401.1|29123_31580_-	periplasmic protein	NA	NA	NA	NA	NA
AYR58402.1|32216_33971_-	DNA restriction methylase	NA	J9Q747	Salmonella_phage	30.9	1.1e-68
AYR58403.1|34156_35314_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.1e-19
AYR58404.1|35673_36498_+	DNA modification methylase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
AYR58405.1|36512_37334_-	hypothetical protein	NA	NA	NA	NA	NA
AYR58406.1|37616_38324_-	hypothetical protein	NA	NA	NA	NA	NA
AYR58407.1|38538_39615_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
AYR58408.1|40149_41025_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
AYR58409.1|41278_41860_-	hypothetical protein	NA	NA	NA	NA	NA
AYR58410.1|42466_42820_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58411.1|42871_43189_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58412.1|43188_43986_+	pilus assembly protein	NA	NA	NA	NA	NA
AYR58413.1|43988_45221_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58414.1|45222_45663_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58415.1|45640_47011_+	TrhB	NA	NA	NA	NA	NA
AYR58416.1|47019_47532_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58417.1|47532_48390_+	plasmid transfer protein	NA	NA	NA	NA	NA
AYR58418.1|48399_49350_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58419.1|49358_52040_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58420.1|52673_52949_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	93.4	1.9e-44
AYR58421.1|53077_55081_+|holin	transporter, betaine/carnitine/choline family	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AYR58422.1|55143_56439_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58423.1|56432_56936_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR58424.1|56854_57130_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
>prophage 2
CP029939	Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence	215792	80841	133294	215792	integrase,transposase	Escherichia_phage(50.0%)	63	105745:105759	130245:130259
AYR58444.1|80841_81345_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR58445.1|81263_81539_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR58446.1|81580_83437_+	hypothetical protein	NA	S5MMD7	Bacillus_phage	26.4	2.2e-19
AYR58447.1|83834_84710_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58448.1|84768_85146_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58449.1|85206_86193_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58450.1|86252_87305_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58451.1|87343_87613_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58452.1|87683_88811_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58453.1|88888_90901_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58454.1|90972_91194_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58455.1|91308_92541_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
AYR58456.1|92815_93340_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58457.1|93330_94296_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58458.1|94366_95302_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58459.1|95379_96300_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58460.1|96372_97308_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58461.1|97484_98441_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58462.1|98853_99123_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58463.1|99177_99768_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58464.1|99775_100033_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58465.1|100106_100643_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58466.1|100659_101115_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58467.1|101098_101326_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58468.1|101374_101629_-	hypothetical protein	NA	NA	NA	NA	NA
AYR58469.1|101696_102656_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58470.1|102666_103575_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58471.1|103879_105061_-	recombinase	NA	NA	NA	NA	NA
AYR58472.1|105275_105488_+	regulatory protein	NA	NA	NA	NA	NA
105745:105759	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYR58473.1|105794_106070_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	7.7e-46
105745:105759	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYR58474.1|105988_106492_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR58475.1|106598_107033_-	transcriptional regulator MerR	NA	NA	NA	NA	NA
AYR58476.1|107050_107455_+	MerT	NA	NA	NA	NA	NA
AYR58477.1|107468_107744_+	mercuric transport protein	NA	NA	NA	NA	NA
AYR58478.1|107779_108202_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AYR58479.1|108253_109948_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYR58480.1|109965_110328_+	transcriptional regulator MerD	NA	NA	NA	NA	NA
AYR58481.1|110324_110561_+	mercury resistance protein	NA	NA	NA	NA	NA
AYR58482.1|110557_111265_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58483.1|111303_112608_+|integrase	integrase	integrase	NA	NA	NA	NA
AYR58484.1|112636_113359_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR58485.1|114114_114966_+	replication protein	NA	NA	NA	NA	NA
AYR58486.1|115273_116089_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AYR58487.1|116149_116953_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYR58488.1|116952_117789_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYR58489.1|117849_118572_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR58490.1|119151_120012_-	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
119606:119620	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYR58491.1|120194_120461_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
119606:119620	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYR58492.1|120493_121216_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR58493.1|121449_122376_-	sulfonamide-resistant dihydropteroate synthase sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	7.2e-11
AYR58494.1|122282_122663_-	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYR58495.1|122859_123459_-	dihydrofolate reductase	NA	A0A1B2IAU3	Erwinia_phage	32.8	5.3e-15
AYR58496.1|123490_124504_+|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYR58497.1|124493_125057_+	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYR58498.1|125182_125743_+	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYR58499.1|125745_128712_+|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYR58500.1|128778_129156_+	hypothetical protein	NA	NA	NA	NA	NA
AYR58501.1|129356_130016_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AYR58502.1|130294_130570_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR58503.1|130488_130992_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.4	1.3e-94
AYR58504.1|131573_132329_+	replication protein	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
AYR58505.1|132596_132872_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR58506.1|132790_133294_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	92.8	1.4e-88
