The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029938	Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 chromosome, complete genome	4784615	868706	876018	4784615	integrase,protease	Dickeya_phage(16.67%)	6	869957:869971	881136:881150
AYR63784.1|868706_869825_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYR63785.1|869821_871768_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
869957:869971	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYR63786.1|871897_872119_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYR63787.1|872442_872763_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYR63788.1|872793_875070_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYR63789.1|875640_876018_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
881136:881150	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029938	Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 chromosome, complete genome	4784615	946961	1024273	4784615	terminase,transposase,tail,integrase,protease	Salmonella_phage(73.33%)	93	929027:929046	999634:999653
929027:929046	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYR63839.1|946961_948302_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYR63840.1|948298_948547_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYR63841.1|948587_948833_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYR63842.1|948832_949714_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYR63843.1|949710_950775_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYR63844.1|950852_951533_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYR63845.1|951529_952315_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYR63846.1|952320_952617_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYR63847.1|952707_952908_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYR63848.1|953196_953601_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYR63849.1|953932_954307_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYR63850.1|954391_955375_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYR63851.1|955377_956127_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYR63852.1|956137_956485_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYR63853.1|956481_957006_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYR63854.1|957005_957479_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYR63855.1|957482_958055_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYR63856.1|958148_958415_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYR63857.1|958496_958658_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR63858.1|959090_959588_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR63859.1|959772_960012_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYR63860.1|960001_960307_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYR63861.1|960346_960949_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYR63862.1|961157_961769_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYR63863.1|961901_962699_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYR63864.1|963097_963223_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR63865.1|963358_963808_-	lipoprotein	NA	NA	NA	NA	NA
AYR63866.1|964024_964414_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYR63867.1|964400_964682_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYR63868.1|964681_965296_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYR63869.1|965514_965769_+	hypothetical protein	NA	NA	NA	NA	NA
AYR63870.1|965873_966251_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYR63871.1|966314_966575_+	hypothetical protein	NA	NA	NA	NA	NA
AYR63872.1|966664_967417_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYR63873.1|967382_968786_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYR63874.1|968785_970255_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYR63875.1|970346_970877_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYR63876.1|970891_972124_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYR63877.1|972128_972626_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYR63878.1|972637_973579_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYR63879.1|973620_973989_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYR63880.1|973954_974362_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYR63881.1|974358_974913_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYR63882.1|974899_975289_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYR63883.1|975263_975827_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYR63884.1|975830_976976_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYR63885.1|976987_977428_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYR63886.1|977431_977884_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYR63887.1|978061_980014_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYR63888.1|980013_980664_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYR63889.1|980667_980970_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYR63890.1|980972_982004_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYR63891.1|982000_982336_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYR63892.1|982530_983262_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR63893.1|983261_983690_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR63894.1|983748_984504_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYR63895.1|984591_984729_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYR63896.1|984744_985098_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYR63897.1|985098_986298_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYR63898.1|986294_986975_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYR63899.1|986974_988486_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYR63900.1|988500_989019_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYR63901.1|989940_990642_-	hypothetical protein	NA	NA	NA	NA	NA
AYR63902.1|990954_991233_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYR63903.1|991658_994271_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYR63904.1|994478_995489_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYR63905.1|995651_996197_+	hypothetical protein	NA	NA	NA	NA	NA
AYR63906.1|996193_997303_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYR63907.1|997401_999510_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYR63908.1|999522_1001430_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
999634:999653	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYR63909.1|1001444_1002698_+	inner membrane protein	NA	NA	NA	NA	NA
AYR63910.1|1002702_1004343_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYR63911.1|1004339_1004903_+	lipoprotein	NA	NA	NA	NA	NA
AYR63912.1|1005156_1005324_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYR63913.1|1005423_1005942_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYR63914.1|1006010_1007771_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYR63915.1|1007956_1008409_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYR63916.1|1008480_1009533_-	outer membrane protein A	NA	NA	NA	NA	NA
AYR63917.1|1009887_1010397_-	cell division inhibitor	NA	NA	NA	NA	NA
AYR63918.1|1010613_1011219_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYR63919.1|1011205_1013359_-	inner membrane protein	NA	NA	NA	NA	NA
AYR63920.1|1013377_1013824_-	hypothetical protein	NA	NA	NA	NA	NA
AYR63921.1|1013947_1016002_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYR63922.1|1016037_1016496_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYR63923.1|1016590_1017253_-	hypothetical protein	NA	NA	NA	NA	NA
AYR63924.1|1017423_1017840_+	hypothetical protein	NA	NA	NA	NA	NA
AYR63925.1|1017884_1018202_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYR63926.1|1018259_1019471_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYR63927.1|1020602_1021061_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR63928.1|1021797_1022079_+	acylphosphatase	NA	NA	NA	NA	NA
AYR63929.1|1022075_1022405_-	sulfite reductase	NA	NA	NA	NA	NA
AYR63930.1|1022491_1023151_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYR63931.1|1023814_1024273_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029938	Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 chromosome, complete genome	4784615	1467091	1540662	4784615	transposase,tail,plate,tRNA,head,protease	Burkholderia_virus(43.24%)	80	NA	NA
AYR64331.1|1467091_1467550_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR64332.1|1468052_1468334_+	stress response protein	NA	NA	NA	NA	NA
AYR64333.1|1468602_1469424_+|protease	serine protease	protease	NA	NA	NA	NA
AYR64334.1|1469458_1469788_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYR64335.1|1469774_1470137_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYR64336.1|1470248_1470419_-	hypothetical protein	NA	NA	NA	NA	NA
AYR64337.1|1470553_1471588_+	hypothetical protein	NA	NA	NA	NA	NA
AYR64338.1|1471762_1473151_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYR64339.1|1473161_1474691_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYR64340.1|1475217_1476162_+	hypothetical protein	NA	NA	NA	NA	NA
AYR64341.1|1476343_1476733_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYR64342.1|1476704_1477157_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYR64343.1|1477351_1477582_-	hypothetical protein	NA	NA	NA	NA	NA
AYR64344.1|1477578_1478262_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYR64345.1|1478258_1478474_-	hypothetical protein	NA	NA	NA	NA	NA
AYR64346.1|1478466_1478850_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYR64347.1|1478846_1479149_-	hypothetical protein	NA	NA	NA	NA	NA
AYR64348.1|1479158_1479431_-	hypothetical protein	NA	NA	NA	NA	NA
AYR64349.1|1479719_1480250_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYR64350.1|1480277_1480547_-	hypothetical protein	NA	NA	NA	NA	NA
AYR64351.1|1480549_1481716_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYR64352.1|1481726_1483496_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYR64353.1|1483673_1484105_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYR64354.1|1484100_1484697_+	hypothetical protein	NA	NA	NA	NA	NA
AYR64355.1|1484940_1485291_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYR64356.1|1486005_1486656_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYR64357.1|1486652_1486979_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYR64358.1|1486978_1487290_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYR64359.1|1487289_1487835_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYR64360.1|1487831_1489427_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYR64361.1|1489426_1490923_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYR64362.1|1490903_1491725_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYR64363.1|1491727_1492186_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYR64364.1|1492400_1493516_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYR64365.1|1493530_1494484_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYR64366.1|1494493_1494832_+	hypothetical protein	NA	NA	NA	NA	NA
AYR64367.1|1494833_1495280_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYR64368.1|1495279_1495744_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYR64369.1|1495740_1495995_+	hypothetical protein	NA	NA	NA	NA	NA
AYR64370.1|1495984_1497412_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYR64371.1|1497411_1497933_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYR64372.1|1497935_1498217_+	hypothetical protein	NA	NA	NA	NA	NA
AYR64373.1|1498314_1498650_+	hypothetical protein	NA	NA	NA	NA	NA
AYR64374.1|1498825_1501291_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYR64375.1|1501290_1502175_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYR64376.1|1502171_1502387_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYR64377.1|1502374_1503529_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYR64378.1|1503525_1504053_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYR64379.1|1504109_1504457_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYR64380.1|1504447_1505551_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYR64381.1|1505543_1506122_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYR64382.1|1506124_1507150_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYR64383.1|1507636_1508254_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYR64384.1|1509764_1510337_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYR64385.1|1510617_1512000_+	amino acid permease	NA	NA	NA	NA	NA
AYR64386.1|1512061_1512397_-	hypothetical protein	NA	NA	NA	NA	NA
AYR64387.1|1512523_1513255_+	two-component response regulator	NA	NA	NA	NA	NA
AYR64388.1|1513735_1514887_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYR64389.1|1515039_1516746_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYR64390.1|1516853_1518158_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYR64391.1|1518233_1519163_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYR64392.1|1519159_1520563_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYR64393.1|1520730_1522377_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYR64394.1|1522576_1523752_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYR64395.1|1523854_1525363_+	hypothetical protein	NA	NA	NA	NA	NA
AYR64396.1|1526068_1527070_+	adenosine deaminase	NA	NA	NA	NA	NA
AYR64397.1|1527143_1528259_-	oxidoreductase	NA	NA	NA	NA	NA
AYR64398.1|1528361_1528517_+	hypothetical protein	NA	NA	NA	NA	NA
AYR64399.1|1528815_1529031_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYR64400.1|1529119_1529560_+	hypothetical protein	NA	NA	NA	NA	NA
AYR64401.1|1529636_1530218_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYR64402.1|1530217_1530796_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYR64403.1|1530788_1532810_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYR64404.1|1532810_1533869_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYR64405.1|1533872_1534493_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYR64406.1|1534495_1535188_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYR64407.1|1535187_1535823_+	endonuclease III	NA	NA	NA	NA	NA
AYR64408.1|1536423_1537929_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYR64409.1|1538033_1538639_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYR64410.1|1539387_1540662_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029938	Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 chromosome, complete genome	4784615	1721699	1726111	4784615		Escherichia_phage(50.0%)	6	NA	NA
AYR64594.1|1721699_1721939_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYR64595.1|1722811_1723621_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYR64596.1|1723693_1724071_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYR64597.1|1724218_1724761_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYR64598.1|1724952_1725681_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYR64599.1|1725697_1726111_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029938	Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 chromosome, complete genome	4784615	1929964	1937198	4784615		Morganella_phage(33.33%)	7	NA	NA
AYR64789.1|1929964_1931395_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYR64790.1|1931468_1932164_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYR64791.1|1932243_1932555_-	hypothetical protein	NA	NA	NA	NA	NA
AYR64792.1|1933205_1934390_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYR64793.1|1934849_1935062_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYR64794.1|1935507_1936776_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYR64795.1|1936778_1937198_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029938	Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 chromosome, complete genome	4784615	2043499	2054006	4784615		Enterobacteria_phage(37.5%)	10	NA	NA
AYR64892.1|2043499_2044813_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYR64893.1|2044839_2045919_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYR64894.1|2045923_2046697_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYR64895.1|2046712_2047687_-	reductase RfbI	NA	NA	NA	NA	NA
AYR64896.1|2047692_2048244_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYR64897.1|2048244_2049123_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYR64898.1|2049170_2050070_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYR64899.1|2050069_2051155_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYR64900.1|2051531_2052425_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYR64901.1|2052602_2054006_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029938	Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 chromosome, complete genome	4784615	2131235	2140406	4784615	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYR64961.1|2131235_2133269_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYR64962.1|2133509_2133968_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYR64963.1|2134139_2134670_+	lipoprotein	NA	NA	NA	NA	NA
AYR64964.1|2134726_2135194_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYR64965.1|2135240_2135960_-	two-component system response regulator	NA	NA	NA	NA	NA
AYR64966.1|2135956_2137642_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYR64967.1|2137864_2138596_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYR64968.1|2138655_2138763_+	hypothetical protein	NA	NA	NA	NA	NA
AYR64969.1|2138743_2139475_-	ABC transporter permease	NA	NA	NA	NA	NA
AYR64970.1|2139458_2140406_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029938	Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 chromosome, complete genome	4784615	2675859	2689251	4784615	tail	Salmonella_phage(70.0%)	11	NA	NA
AYR65399.1|2675859_2676078_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYR65400.1|2676168_2677269_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYR65401.1|2677265_2677751_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYR65402.1|2677747_2680825_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYR65403.1|2680817_2680937_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYR65404.1|2680951_2681254_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYR65405.1|2681308_2681824_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYR65406.1|2681833_2683006_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYR65407.1|2683148_2683721_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYR65408.1|2684398_2685514_+	glycosyltransferase	NA	NA	NA	NA	NA
AYR65409.1|2685594_2689251_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029938	Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 chromosome, complete genome	4784615	3006412	3050115	4784615	tRNA,transposase,bacteriocin,protease	Bacillus_virus(33.33%)	44	NA	NA
AYR65696.1|3006412_3006871_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR65697.1|3007060_3008140_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYR65698.1|3008241_3009405_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYR65699.1|3009426_3010473_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYR65700.1|3010846_3011272_+	hypothetical protein	NA	NA	NA	NA	NA
AYR65701.1|3011297_3011876_+	hypothetical protein	NA	NA	NA	NA	NA
AYR65702.1|3011909_3012584_+	hypothetical protein	NA	NA	NA	NA	NA
AYR65703.1|3012565_3013249_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYR65704.1|3013242_3013899_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYR65705.1|3014003_3014462_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR65706.1|3014650_3016642_-	transketolase	NA	NA	NA	NA	NA
AYR65707.1|3016917_3017676_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYR65708.1|3017776_3018697_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYR65709.1|3018924_3020901_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYR65710.1|3020909_3021041_-	hypothetical protein	NA	NA	NA	NA	NA
AYR65711.1|3021335_3021635_-	membrane protein	NA	NA	NA	NA	NA
AYR65712.1|3021690_3022845_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYR65713.1|3023337_3024732_+	galactose-proton symport	NA	NA	NA	NA	NA
AYR65714.1|3024810_3025308_+	hypothetical protein	NA	NA	NA	NA	NA
AYR65715.1|3025403_3026111_+	endonuclease I	NA	NA	NA	NA	NA
AYR65716.1|3026187_3026919_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYR65717.1|3026938_3027886_+	glutathione synthetase	NA	NA	NA	NA	NA
AYR65718.1|3028101_3028665_+	hypothetical protein	NA	NA	NA	NA	NA
AYR65719.1|3028664_3029081_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYR65720.1|3029127_3029814_-	global regulatory protein	NA	NA	NA	NA	NA
AYR65721.1|3029943_3030924_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYR65722.1|3030941_3031646_+	hypothetical protein	NA	NA	NA	NA	NA
AYR65723.1|3031664_3032231_+	hypothetical protein	NA	NA	NA	NA	NA
AYR65724.1|3032227_3032518_+	hypothetical protein	NA	NA	NA	NA	NA
AYR65725.1|3032525_3033119_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYR65726.1|3033111_3034248_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYR65727.1|3034338_3035346_-	hypothetical protein	NA	NA	NA	NA	NA
AYR65728.1|3035478_3036525_-	L-asparaginase	NA	NA	NA	NA	NA
AYR65729.1|3036843_3037302_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR65730.1|3037424_3038144_-	hypothetical protein	NA	NA	NA	NA	NA
AYR65731.1|3038193_3038520_-	hypothetical protein	NA	NA	NA	NA	NA
AYR65732.1|3038519_3039239_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYR65733.1|3039393_3040446_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYR65734.1|3040473_3040749_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYR65735.1|3040861_3041947_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYR65736.1|3042163_3043420_+	nucleoside permease	NA	NA	NA	NA	NA
AYR65737.1|3046030_3046738_+	hypothetical protein	NA	NA	NA	NA	NA
AYR65738.1|3049327_3049594_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYR65739.1|3049836_3050115_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029938	Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 chromosome, complete genome	4784615	3427434	3465492	4784615	terminase,transposase,tail,plate,integrase,capsid,portal	Salmonella_phage(82.05%)	46	3422398:3422412	3434564:3434578
3422398:3422412	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYR66067.1|3427434_3429081_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYR66068.1|3429220_3429319_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYR66069.1|3429574_3429904_+	hypothetical protein	NA	NA	NA	NA	NA
AYR66070.1|3429944_3430997_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYR66071.1|3431392_3431962_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYR66072.1|3432087_3432309_+	hypothetical protein	NA	NA	NA	NA	NA
AYR66073.1|3432341_3432851_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYR66074.1|3433025_3433250_+	hypothetical protein	NA	NA	NA	NA	NA
AYR66075.1|3433272_3433614_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYR66076.1|3433681_3433915_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYR66077.1|3433914_3434142_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYR66078.1|3434138_3434996_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3434564:3434578	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYR66079.1|3434992_3437407_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYR66080.1|3437560_3437749_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYR66081.1|3439716_3440631_+	hypothetical protein	NA	NA	NA	NA	NA
AYR66082.1|3440627_3441368_+	hypothetical protein	NA	NA	NA	NA	NA
AYR66083.1|3441402_3442440_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYR66084.1|3442439_3444206_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYR66085.1|3444348_3445182_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYR66086.1|3445198_3446257_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYR66087.1|3446260_3446911_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYR66088.1|3446943_3447471_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYR66089.1|3447470_3447674_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYR66090.1|3447677_3447893_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYR66091.1|3447912_3448386_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYR66092.1|3448387_3448765_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYR66093.1|3448761_3449190_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYR66094.1|3449285_3449717_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYR66095.1|3449709_3450156_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYR66096.1|3450224_3450803_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYR66097.1|3450799_3451159_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYR66098.1|3451145_3452054_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYR66099.1|3452046_3452652_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYR66100.1|3452648_3454163_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYR66101.1|3454162_3454756_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYR66102.1|3454727_3455168_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYR66103.1|3455590_3456163_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYR66104.1|3456305_3457478_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYR66105.1|3457487_3458003_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYR66106.1|3458057_3458360_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYR66107.1|3458374_3458494_+	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYR66108.1|3458486_3461564_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYR66109.1|3461560_3462046_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYR66110.1|3462042_3463143_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYR66111.1|3463233_3463452_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYR66112.1|3465033_3465492_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029938	Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 chromosome, complete genome	4784615	4381349	4455513	4784615	terminase,tail,plate,integrase,capsid,portal	Salmonella_phage(82.98%)	76	4442850:4442866	4455672:4455688
AYR66884.1|4381349_4383299_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYR66885.1|4383370_4384279_+	hypothetical protein	NA	NA	NA	NA	NA
AYR66886.1|4384352_4385252_+	hypothetical protein	NA	NA	NA	NA	NA
AYR66887.1|4385293_4385653_+	hypothetical protein	NA	NA	NA	NA	NA
AYR66888.1|4385752_4386022_-	hypothetical protein	NA	NA	NA	NA	NA
AYR66889.1|4386153_4387428_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYR66890.1|4387647_4388025_+	hypothetical protein	NA	NA	NA	NA	NA
AYR66891.1|4388111_4388330_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYR66892.1|4388397_4389498_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYR66893.1|4389494_4389980_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYR66894.1|4389979_4392760_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYR66895.1|4392752_4392872_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYR66896.1|4392886_4393189_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYR66897.1|4393243_4393759_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYR66898.1|4393768_4394941_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYR66899.1|4395475_4396198_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYR66900.1|4396395_4396803_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYR66901.1|4396809_4398429_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYR66902.1|4398425_4399031_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYR66903.1|4399023_4399932_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYR66904.1|4399918_4400278_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYR66905.1|4400274_4400853_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYR66906.1|4400921_4401368_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYR66907.1|4401360_4401792_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYR66908.1|4401887_4402313_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYR66909.1|4402312_4402690_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYR66910.1|4402694_4403165_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYR66911.1|4403184_4403400_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYR66912.1|4403403_4403607_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYR66913.1|4403606_4404071_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYR66914.1|4404164_4404815_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYR66915.1|4404818_4405883_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYR66916.1|4405899_4406733_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYR66917.1|4406875_4408642_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYR66918.1|4408638_4409685_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYR66919.1|4409733_4410429_-	hypothetical protein	NA	NA	NA	NA	NA
AYR66920.1|4410448_4411513_-	hypothetical protein	NA	NA	NA	NA	NA
AYR66921.1|4411509_4412574_-	hypothetical protein	NA	NA	NA	NA	NA
AYR66922.1|4413498_4413828_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYR66923.1|4413824_4415894_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYR66924.1|4415884_4416745_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYR66925.1|4416741_4417326_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYR66926.1|4417322_4417550_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYR66927.1|4417549_4417783_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYR66928.1|4417850_4418192_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYR66929.1|4418155_4418356_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYR66930.1|4418363_4418873_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYR66931.1|4418905_4419148_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYR66932.1|4419264_4419897_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYR66933.1|4419900_4420926_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYR66934.1|4421032_4421386_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYR66935.1|4422002_4422290_+	hypothetical protein	NA	NA	NA	NA	NA
AYR66936.1|4422300_4423191_+	methyltransferase	NA	NA	NA	NA	NA
AYR66937.1|4423190_4423937_+	hypothetical protein	NA	NA	NA	NA	NA
AYR66938.1|4424238_4426209_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYR66939.1|4426228_4427533_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYR66940.1|4427555_4428251_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYR66941.1|4428276_4429071_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYR66942.1|4429080_4430148_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYR66943.1|4430192_4431929_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYR66944.1|4431928_4434424_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYR66945.1|4434447_4435494_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYR66946.1|4435496_4436774_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYR66947.1|4437018_4437558_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYR66948.1|4438411_4439923_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYR66949.1|4439906_4441496_+	hypothetical protein	NA	NA	NA	NA	NA
AYR66950.1|4441659_4442673_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4442850:4442866	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYR66951.1|4443099_4443393_+	hypothetical protein	NA	NA	NA	NA	NA
AYR66952.1|4443389_4443878_+	hypothetical protein	NA	NA	NA	NA	NA
AYR66953.1|4444057_4444510_-	hypothetical protein	NA	NA	NA	NA	NA
AYR66954.1|4449732_4450194_+	hypothetical protein	NA	NA	NA	NA	NA
AYR66955.1|4450190_4450412_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYR66956.1|4451268_4452051_+	hypothetical protein	NA	NA	NA	NA	NA
AYR66957.1|4452677_4452902_-	hypothetical protein	NA	NA	NA	NA	NA
AYR66958.1|4453031_4453943_-	hypothetical protein	NA	NA	NA	NA	NA
AYR66959.1|4454253_4455513_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4455672:4455688	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029938	Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 chromosome, complete genome	4784615	4597765	4608024	4784615	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYR67096.1|4597765_4598842_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYR67097.1|4598838_4599912_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYR67098.1|4599886_4601050_-	hypothetical protein	NA	NA	NA	NA	NA
AYR67099.1|4601325_4601892_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYR67100.1|4601907_4602147_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYR67101.1|4602150_4603011_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYR67102.1|4603433_4603757_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYR67103.1|4603740_4604241_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYR67104.1|4604237_4604465_+	hypothetical protein	NA	NA	NA	NA	NA
AYR67105.1|4604461_4604782_+	P4 phage protein	NA	NA	NA	NA	NA
AYR67106.1|4604796_4605471_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYR67107.1|4605467_4607129_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYR67108.1|4607865_4608024_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029937	Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence	216810	3612	57130	216810	transposase,holin	Escherichia_phage(43.75%)	56	NA	NA
AYR62813.1|3612_3888_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR62814.1|3806_4310_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	6.3e-94
AYR62815.1|4636_4861_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62816.1|5516_5777_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62817.1|5865_6357_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62818.1|6361_6670_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62819.1|6877_7258_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62820.1|7343_7592_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62821.1|7629_7851_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	8.2e-06
AYR62822.1|8013_8397_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62823.1|8711_8936_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62824.1|9022_9487_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62825.1|9669_12099_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62826.1|12221_12668_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62827.1|12715_13522_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62828.1|13749_13992_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62829.1|14069_14402_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62830.1|14901_16083_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62831.1|16091_16388_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
AYR62832.1|16451_16919_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62833.1|17778_18555_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62834.1|18704_19481_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62835.1|19669_20011_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62836.1|20111_20375_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.1e-08
AYR62837.1|20608_21307_+	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	4.2e-11
AYR62838.1|21461_21758_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62839.1|21845_24230_-	periplasmic protein	NA	NA	NA	NA	NA
AYR62840.1|24480_25089_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62841.1|25201_25498_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62842.1|25502_26099_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62843.1|26490_27372_+	replication protein	NA	J9Q7H0	Salmonella_phage	41.3	6.5e-54
AYR62844.1|27957_28473_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62845.1|29123_31580_-	periplasmic protein	NA	NA	NA	NA	NA
AYR62846.1|32216_33971_-	DNA restriction methylase	NA	J9Q747	Salmonella_phage	30.9	1.1e-68
AYR62847.1|34156_35314_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.1e-19
AYR62848.1|35673_36498_+	DNA modification methylase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
AYR62849.1|36512_37334_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62850.1|37616_38324_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62851.1|38538_39615_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
AYR62852.1|40149_41025_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
AYR62853.1|41278_41860_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62854.1|42466_42820_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62855.1|42871_43189_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62856.1|43188_43986_+	pilus assembly protein	NA	NA	NA	NA	NA
AYR62857.1|43988_45221_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62858.1|45222_45663_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62859.1|45640_47011_+	TrhB	NA	NA	NA	NA	NA
AYR62860.1|47019_47532_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62861.1|47532_48390_+	plasmid transfer protein	NA	NA	NA	NA	NA
AYR62862.1|48399_49350_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62863.1|49358_52040_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62864.1|52673_52949_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	93.4	1.9e-44
AYR62865.1|53077_55081_+|holin	transporter, betaine/carnitine/choline family	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AYR62866.1|55143_56439_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62867.1|56432_56936_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR62868.1|56854_57130_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
>prophage 2
CP029937	Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence	216810	81694	134312	216810	integrase,transposase	Escherichia_phage(50.0%)	63	106598:106612	131098:131112
AYR62888.1|81694_82198_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR62889.1|82116_82392_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR62890.1|82433_84290_+	hypothetical protein	NA	S5MMD7	Bacillus_phage	26.4	2.2e-19
AYR62891.1|84687_85563_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62892.1|85621_85999_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62893.1|86059_87046_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62894.1|87105_88158_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62895.1|88196_88466_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62896.1|88536_89664_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62897.1|89741_91754_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62898.1|91825_92047_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62899.1|92161_93394_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
AYR62900.1|93668_94193_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62901.1|94183_95149_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62902.1|95219_96155_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62903.1|96232_97153_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62904.1|97225_98161_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62905.1|98337_99294_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62906.1|99706_99976_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62907.1|100030_100621_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62908.1|100628_100886_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62909.1|100959_101496_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62910.1|101512_101968_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62911.1|101951_102179_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62912.1|102227_102482_-	hypothetical protein	NA	NA	NA	NA	NA
AYR62913.1|102549_103509_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62914.1|103519_104428_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62915.1|104732_105914_-	recombinase	NA	NA	NA	NA	NA
AYR62916.1|106128_106341_+	regulatory protein	NA	NA	NA	NA	NA
106598:106612	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYR62917.1|106647_106923_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	7.7e-46
106598:106612	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYR62918.1|106841_107345_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR62919.1|107451_107886_-	transcriptional regulator MerR	NA	NA	NA	NA	NA
AYR62920.1|107903_108308_+	MerT	NA	NA	NA	NA	NA
AYR62921.1|108321_108597_+	mercuric transport protein	NA	NA	NA	NA	NA
AYR62922.1|108632_109055_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AYR62923.1|109106_110801_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYR62924.1|110818_111181_+	transcriptional regulator MerD	NA	NA	NA	NA	NA
AYR62925.1|111177_111414_+	mercury resistance protein	NA	NA	NA	NA	NA
AYR62926.1|111410_112118_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62927.1|112156_113461_+|integrase	integrase	integrase	NA	NA	NA	NA
AYR62928.1|113489_114212_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR62929.1|114967_115819_+	replication protein	NA	NA	NA	NA	NA
AYR62930.1|116126_116942_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AYR62931.1|117002_117806_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYR62932.1|117805_118642_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYR62933.1|118702_119425_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR62934.1|120004_120865_-	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
120459:120473	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYR62935.1|121047_121314_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
120459:120473	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYR62936.1|121346_122069_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR62937.1|122302_123229_-	sulfonamide-resistant dihydropteroate synthase sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	7.2e-11
AYR62938.1|123135_123516_-	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYR62939.1|123712_124312_-	dihydrofolate reductase	NA	A0A1B2IAU3	Erwinia_phage	32.8	5.3e-15
AYR62940.1|124343_125357_+|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYR62941.1|125346_125910_+	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYR62942.1|126035_126596_+	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYR62943.1|126598_129565_+|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYR62944.1|129631_130009_+	hypothetical protein	NA	NA	NA	NA	NA
AYR62945.1|130209_130869_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AYR62946.1|131147_131423_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR62947.1|131341_131845_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	1.1e-93
AYR62948.1|132426_133182_+	replication protein	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
AYR62949.1|133614_133890_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR62950.1|133808_134312_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	92.8	1.4e-88
