The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029949	Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 chromosome, complete genome	4783337	930336	937648	4783337	protease,integrase	Dickeya_phage(16.67%)	6	931587:931601	942766:942780
AYR72489.1|930336_931455_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYR72490.1|931451_933398_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931587:931601	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYR72491.1|933527_933749_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYR72492.1|934072_934393_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYR72493.1|934423_936700_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYR72494.1|937270_937648_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942766:942780	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029949	Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 chromosome, complete genome	4783337	1008591	1085903	4783337	integrase,transposase,terminase,tail,protease	Salmonella_phage(73.33%)	93	990657:990676	1061264:1061283
990657:990676	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYR72544.1|1008591_1009932_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYR72545.1|1009928_1010177_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYR72546.1|1010217_1010463_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYR72547.1|1010462_1011344_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYR72548.1|1011340_1012405_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYR72549.1|1012482_1013163_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYR72550.1|1013159_1013945_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYR72551.1|1013950_1014247_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYR72552.1|1014337_1014538_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYR72553.1|1014826_1015231_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYR72554.1|1015562_1015937_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYR72555.1|1016021_1017005_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYR72556.1|1017007_1017757_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYR72557.1|1017767_1018115_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYR72558.1|1018111_1018636_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYR72559.1|1018635_1019109_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYR72560.1|1019112_1019685_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYR72561.1|1019778_1020045_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYR72562.1|1020126_1020288_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR72563.1|1020720_1021218_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR72564.1|1021402_1021642_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYR72565.1|1021631_1021937_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYR72566.1|1021976_1022579_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYR72567.1|1022787_1023399_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYR72568.1|1023531_1024329_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYR72569.1|1024727_1024853_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR72570.1|1024988_1025438_-	lipoprotein	NA	NA	NA	NA	NA
AYR72571.1|1025654_1026044_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYR72572.1|1026030_1026312_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYR72573.1|1026311_1026926_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYR72574.1|1027144_1027399_+	hypothetical protein	NA	NA	NA	NA	NA
AYR72575.1|1027503_1027881_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYR72576.1|1027944_1028205_+	hypothetical protein	NA	NA	NA	NA	NA
AYR72577.1|1028294_1029047_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYR72578.1|1029012_1030416_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYR72579.1|1030415_1031885_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYR72580.1|1031976_1032507_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYR72581.1|1032521_1033754_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYR72582.1|1033758_1034256_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYR72583.1|1034267_1035209_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYR72584.1|1035250_1035619_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYR72585.1|1035584_1035992_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYR72586.1|1035988_1036543_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYR72587.1|1036529_1036919_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYR72588.1|1036893_1037457_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYR72589.1|1037460_1038606_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYR72590.1|1038617_1039058_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYR72591.1|1039061_1039514_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYR72592.1|1039691_1041644_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYR72593.1|1041643_1042294_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYR72594.1|1042297_1042600_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYR72595.1|1042602_1043634_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYR72596.1|1043630_1043966_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYR72597.1|1044160_1044892_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR72598.1|1044891_1045320_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR72599.1|1045378_1046134_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYR72600.1|1046221_1046359_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYR72601.1|1046374_1046728_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYR72602.1|1046728_1047928_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYR72603.1|1047924_1048605_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYR72604.1|1048604_1050116_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYR72605.1|1050130_1050649_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYR72606.1|1051570_1052272_-	hypothetical protein	NA	NA	NA	NA	NA
AYR72607.1|1052584_1052863_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYR72608.1|1053288_1055901_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYR72609.1|1056108_1057119_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYR72610.1|1057281_1057827_+	hypothetical protein	NA	NA	NA	NA	NA
AYR72611.1|1057823_1058933_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYR72612.1|1059031_1061140_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYR72613.1|1061152_1063060_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061264:1061283	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYR72614.1|1063074_1064328_+	inner membrane protein	NA	NA	NA	NA	NA
AYR72615.1|1064332_1065973_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYR72616.1|1065969_1066533_+	lipoprotein	NA	NA	NA	NA	NA
AYR72617.1|1066786_1066954_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYR72618.1|1067053_1067572_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYR72619.1|1067640_1069401_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYR72620.1|1069586_1070039_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYR72621.1|1070110_1071163_-	outer membrane protein A	NA	NA	NA	NA	NA
AYR72622.1|1071517_1072027_-	cell division inhibitor	NA	NA	NA	NA	NA
AYR72623.1|1072243_1072849_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYR72624.1|1072835_1074989_-	inner membrane protein	NA	NA	NA	NA	NA
AYR72625.1|1075007_1075454_-	hypothetical protein	NA	NA	NA	NA	NA
AYR72626.1|1075577_1077632_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYR72627.1|1077667_1078126_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYR72628.1|1078220_1078883_-	hypothetical protein	NA	NA	NA	NA	NA
AYR72629.1|1079053_1079470_+	hypothetical protein	NA	NA	NA	NA	NA
AYR72630.1|1079514_1079832_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYR72631.1|1079889_1081101_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYR72632.1|1082232_1082691_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR72633.1|1083427_1083709_+	acylphosphatase	NA	NA	NA	NA	NA
AYR72634.1|1083705_1084035_-	sulfite reductase	NA	NA	NA	NA	NA
AYR72635.1|1084121_1084781_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYR72636.1|1085444_1085903_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029949	Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 chromosome, complete genome	4783337	1528721	1602319	4783337	tRNA,head,plate,transposase,tail,protease	Burkholderia_virus(44.12%)	72	NA	NA
AYR73036.1|1528721_1529180_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR73037.1|1529682_1529964_+	stress response protein	NA	NA	NA	NA	NA
AYR73038.1|1530232_1531054_+|protease	serine protease	protease	NA	NA	NA	NA
AYR73039.1|1531088_1531418_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYR73040.1|1531404_1531767_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYR73041.1|1531878_1532049_-	hypothetical protein	NA	NA	NA	NA	NA
AYR73042.1|1532183_1533218_+	hypothetical protein	NA	NA	NA	NA	NA
AYR73043.1|1533392_1534781_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYR73044.1|1534791_1536321_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYR73045.1|1536847_1537792_+	hypothetical protein	NA	NA	NA	NA	NA
AYR73046.1|1537973_1538363_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYR73047.1|1538334_1538787_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYR73048.1|1538981_1539212_-	hypothetical protein	NA	NA	NA	NA	NA
AYR73049.1|1539208_1539892_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYR73050.1|1540476_1540779_-	hypothetical protein	NA	NA	NA	NA	NA
AYR73051.1|1541349_1541880_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYR73052.1|1542179_1543346_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYR73053.1|1543356_1545126_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYR73054.1|1546570_1546921_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYR73055.1|1547635_1548286_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYR73056.1|1548608_1548920_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYR73057.1|1548919_1549465_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYR73058.1|1549461_1551057_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYR73059.1|1551056_1552553_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYR73060.1|1552533_1553355_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYR73061.1|1553357_1553816_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYR73062.1|1554030_1555146_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYR73063.1|1555160_1556114_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYR73064.1|1556123_1556462_+	hypothetical protein	NA	NA	NA	NA	NA
AYR73065.1|1556463_1556910_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYR73066.1|1556909_1557374_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYR73067.1|1557614_1559042_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYR73068.1|1559041_1559563_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYR73069.1|1559565_1559847_+	hypothetical protein	NA	NA	NA	NA	NA
AYR73070.1|1559944_1560280_+	hypothetical protein	NA	NA	NA	NA	NA
AYR73071.1|1560455_1562921_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYR73072.1|1562920_1563805_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYR73073.1|1563801_1564017_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYR73074.1|1564004_1565159_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYR73075.1|1565155_1565683_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYR73076.1|1565739_1566087_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYR73077.1|1566077_1567181_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYR73078.1|1567173_1567752_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYR73079.1|1567754_1568780_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYR73080.1|1569293_1569911_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYR73081.1|1571421_1571994_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYR73082.1|1572274_1573657_+	amino acid permease	NA	NA	NA	NA	NA
AYR73083.1|1573718_1574054_-	hypothetical protein	NA	NA	NA	NA	NA
AYR73084.1|1574180_1574912_+	two-component response regulator	NA	NA	NA	NA	NA
AYR73085.1|1575392_1576544_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYR73086.1|1576696_1578403_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYR73087.1|1578510_1579815_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYR73088.1|1579890_1580820_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYR73089.1|1580816_1582220_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYR73090.1|1582387_1584034_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYR73091.1|1584233_1585409_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYR73092.1|1585511_1587020_+	hypothetical protein	NA	NA	NA	NA	NA
AYR73093.1|1587725_1588727_+	adenosine deaminase	NA	NA	NA	NA	NA
AYR73094.1|1588800_1589916_-	oxidoreductase	NA	NA	NA	NA	NA
AYR73095.1|1590018_1590174_+	hypothetical protein	NA	NA	NA	NA	NA
AYR73096.1|1590472_1590688_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYR73097.1|1590776_1591217_+	hypothetical protein	NA	NA	NA	NA	NA
AYR73098.1|1591293_1591875_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYR73099.1|1591874_1592453_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYR73100.1|1592445_1594467_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYR73101.1|1594467_1595526_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYR73102.1|1595529_1596150_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYR73103.1|1596152_1596845_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYR73104.1|1596844_1597480_+	endonuclease III	NA	NA	NA	NA	NA
AYR73105.1|1598080_1599586_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYR73106.1|1599690_1600296_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYR73107.1|1601044_1602319_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029949	Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 chromosome, complete genome	4783337	1783356	1787768	4783337		Escherichia_phage(50.0%)	6	NA	NA
AYR73291.1|1783356_1783596_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYR73292.1|1784468_1785278_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYR73293.1|1785350_1785728_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYR73294.1|1785875_1786418_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYR73295.1|1786609_1787338_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYR73296.1|1787354_1787768_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029949	Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 chromosome, complete genome	4783337	1991621	1998855	4783337		Morganella_phage(33.33%)	7	NA	NA
AYR73486.1|1991621_1993052_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYR73487.1|1993125_1993821_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYR73488.1|1993900_1994212_-	hypothetical protein	NA	NA	NA	NA	NA
AYR73489.1|1994862_1996047_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYR73490.1|1996506_1996719_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYR73491.1|1997164_1998433_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYR73492.1|1998435_1998855_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029949	Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 chromosome, complete genome	4783337	2105156	2115663	4783337		Enterobacteria_phage(37.5%)	10	NA	NA
AYR73589.1|2105156_2106470_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYR73590.1|2106496_2107576_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYR73591.1|2107580_2108354_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYR73592.1|2108369_2109344_-	reductase RfbI	NA	NA	NA	NA	NA
AYR73593.1|2109349_2109901_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYR73594.1|2109901_2110780_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYR73595.1|2110827_2111727_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYR73596.1|2111726_2112812_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYR73597.1|2113188_2114082_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYR73598.1|2114259_2115663_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029949	Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 chromosome, complete genome	4783337	2192892	2202063	4783337	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYR73658.1|2192892_2194926_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYR73659.1|2195166_2195625_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYR73660.1|2195796_2196327_+	lipoprotein	NA	NA	NA	NA	NA
AYR73661.1|2196383_2196851_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYR73662.1|2196897_2197617_-	two-component system response regulator	NA	NA	NA	NA	NA
AYR73663.1|2197613_2199299_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYR73664.1|2199521_2200253_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYR73665.1|2200312_2200420_+	hypothetical protein	NA	NA	NA	NA	NA
AYR73666.1|2200400_2201132_-	ABC transporter permease	NA	NA	NA	NA	NA
AYR73667.1|2201115_2202063_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029949	Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 chromosome, complete genome	4783337	2737508	2750900	4783337	tail	Salmonella_phage(70.0%)	11	NA	NA
AYR74096.1|2737508_2737727_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYR74097.1|2737817_2738918_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYR74098.1|2738914_2739400_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYR74099.1|2739396_2742474_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYR74100.1|2742466_2742586_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYR74101.1|2742600_2742903_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYR74102.1|2742957_2743473_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYR74103.1|2743482_2744655_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYR74104.1|2744797_2745370_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYR74105.1|2746047_2747163_+	glycosyltransferase	NA	NA	NA	NA	NA
AYR74106.1|2747243_2750900_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029949	Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 chromosome, complete genome	4783337	3067927	3111630	4783337	protease,bacteriocin,tRNA,transposase	Bacillus_virus(33.33%)	44	NA	NA
AYR74393.1|3067927_3068386_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR74394.1|3068575_3069655_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYR74395.1|3069756_3070920_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYR74396.1|3070941_3071988_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYR74397.1|3072361_3072787_+	hypothetical protein	NA	NA	NA	NA	NA
AYR74398.1|3072812_3073391_+	hypothetical protein	NA	NA	NA	NA	NA
AYR74399.1|3073424_3074099_+	hypothetical protein	NA	NA	NA	NA	NA
AYR74400.1|3074080_3074764_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYR74401.1|3074757_3075414_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYR74402.1|3075518_3075977_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR74403.1|3076165_3078157_-	transketolase	NA	NA	NA	NA	NA
AYR74404.1|3078432_3079191_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYR74405.1|3079291_3080212_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYR74406.1|3080439_3082416_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYR74407.1|3082424_3082556_-	hypothetical protein	NA	NA	NA	NA	NA
AYR74408.1|3082850_3083150_-	membrane protein	NA	NA	NA	NA	NA
AYR74409.1|3083205_3084360_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYR74410.1|3084852_3086247_+	galactose-proton symport	NA	NA	NA	NA	NA
AYR74411.1|3086325_3086823_+	hypothetical protein	NA	NA	NA	NA	NA
AYR74412.1|3086918_3087626_+	endonuclease I	NA	NA	NA	NA	NA
AYR74413.1|3087702_3088434_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYR74414.1|3088453_3089401_+	glutathione synthetase	NA	NA	NA	NA	NA
AYR74415.1|3089616_3090180_+	hypothetical protein	NA	NA	NA	NA	NA
AYR74416.1|3090179_3090596_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYR74417.1|3090642_3091329_-	global regulatory protein	NA	NA	NA	NA	NA
AYR74418.1|3091458_3092439_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYR74419.1|3092456_3093161_+	hypothetical protein	NA	NA	NA	NA	NA
AYR74420.1|3093179_3093746_+	hypothetical protein	NA	NA	NA	NA	NA
AYR74421.1|3093742_3094033_+	hypothetical protein	NA	NA	NA	NA	NA
AYR74422.1|3094040_3094634_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYR74423.1|3094626_3095763_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYR74424.1|3095853_3096861_-	hypothetical protein	NA	NA	NA	NA	NA
AYR74425.1|3096993_3098040_-	L-asparaginase	NA	NA	NA	NA	NA
AYR74426.1|3098358_3098817_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR74427.1|3098939_3099659_-	hypothetical protein	NA	NA	NA	NA	NA
AYR74428.1|3099708_3100035_-	hypothetical protein	NA	NA	NA	NA	NA
AYR74429.1|3100034_3100754_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYR74430.1|3100908_3101961_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYR74431.1|3101988_3102264_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYR74432.1|3102376_3103462_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYR74433.1|3103678_3104935_+	nucleoside permease	NA	NA	NA	NA	NA
AYR74434.1|3107545_3108253_+	hypothetical protein	NA	NA	NA	NA	NA
AYR74435.1|3110842_3111109_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYR74436.1|3111351_3111630_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029949	Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 chromosome, complete genome	4783337	3489330	3527388	4783337	integrase,capsid,plate,transposase,terminase,portal,tail	Salmonella_phage(82.05%)	46	3484294:3484308	3496460:3496474
3484294:3484308	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYR74764.1|3489330_3490977_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYR74765.1|3491116_3491215_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYR74766.1|3491470_3491800_+	hypothetical protein	NA	NA	NA	NA	NA
AYR74767.1|3491840_3492893_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYR74768.1|3493288_3493858_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYR74769.1|3493983_3494205_+	hypothetical protein	NA	NA	NA	NA	NA
AYR74770.1|3494237_3494747_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYR74771.1|3494921_3495146_+	hypothetical protein	NA	NA	NA	NA	NA
AYR74772.1|3495168_3495510_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYR74773.1|3495577_3495811_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYR74774.1|3495810_3496038_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYR74775.1|3496034_3496892_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3496460:3496474	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYR74776.1|3496888_3499303_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYR74777.1|3499456_3499645_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYR74778.1|3501612_3502527_+	hypothetical protein	NA	NA	NA	NA	NA
AYR74779.1|3502523_3503264_+	hypothetical protein	NA	NA	NA	NA	NA
AYR74780.1|3503298_3504336_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYR74781.1|3504335_3506102_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYR74782.1|3506244_3507078_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYR74783.1|3507094_3508153_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYR74784.1|3508156_3508807_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYR74785.1|3508839_3509367_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYR74786.1|3509366_3509570_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYR74787.1|3509573_3509789_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYR74788.1|3509808_3510282_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYR74789.1|3510283_3510661_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYR74790.1|3510657_3511086_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYR74791.1|3511181_3511613_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYR74792.1|3511605_3512052_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYR74793.1|3512120_3512699_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYR74794.1|3512695_3513055_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYR74795.1|3513041_3513950_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYR74796.1|3513942_3514548_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYR74797.1|3514544_3516059_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYR74798.1|3516058_3516652_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYR74799.1|3516623_3517064_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYR74800.1|3517486_3518059_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYR74801.1|3518201_3519374_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYR74802.1|3519383_3519899_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYR74803.1|3519953_3520256_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYR74804.1|3520270_3520390_+	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYR74805.1|3520382_3523460_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYR74806.1|3523456_3523942_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYR74807.1|3523938_3525039_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYR74808.1|3525129_3525348_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYR74809.1|3526929_3527388_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029949	Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 chromosome, complete genome	4783337	4443083	4517247	4783337	integrase,capsid,plate,terminase,portal,tail	Salmonella_phage(82.98%)	76	4504584:4504600	4517406:4517422
AYR75580.1|4443083_4445033_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYR75581.1|4445104_4446013_+	hypothetical protein	NA	NA	NA	NA	NA
AYR75582.1|4446086_4446986_+	hypothetical protein	NA	NA	NA	NA	NA
AYR75583.1|4447027_4447387_+	hypothetical protein	NA	NA	NA	NA	NA
AYR75584.1|4447486_4447756_-	hypothetical protein	NA	NA	NA	NA	NA
AYR75585.1|4447887_4449162_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYR75586.1|4449381_4449759_+	hypothetical protein	NA	NA	NA	NA	NA
AYR75587.1|4449845_4450064_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYR75588.1|4450131_4451232_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYR75589.1|4451228_4451714_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYR75590.1|4451713_4454494_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYR75591.1|4454486_4454606_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYR75592.1|4454620_4454923_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYR75593.1|4454977_4455493_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYR75594.1|4455502_4456675_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYR75595.1|4457209_4457932_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYR75596.1|4458129_4458537_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYR75597.1|4458543_4460163_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYR75598.1|4460159_4460765_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYR75599.1|4460757_4461666_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYR75600.1|4461652_4462012_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYR75601.1|4462008_4462587_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYR75602.1|4462655_4463102_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYR75603.1|4463094_4463526_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYR75604.1|4463621_4464047_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYR75605.1|4464046_4464424_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYR75606.1|4464428_4464899_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYR75607.1|4464918_4465134_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYR75608.1|4465137_4465341_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYR75609.1|4465340_4465805_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYR75610.1|4465898_4466549_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYR75611.1|4466552_4467617_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYR75612.1|4467633_4468467_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYR75613.1|4468609_4470376_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYR75614.1|4470372_4471419_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYR75615.1|4471467_4472163_-	hypothetical protein	NA	NA	NA	NA	NA
AYR75616.1|4472182_4473247_-	hypothetical protein	NA	NA	NA	NA	NA
AYR75617.1|4473243_4474308_-	hypothetical protein	NA	NA	NA	NA	NA
AYR75618.1|4475232_4475562_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYR75619.1|4475558_4477628_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYR75620.1|4477618_4478479_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYR75621.1|4478475_4479060_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYR75622.1|4479056_4479284_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYR75623.1|4479283_4479517_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYR75624.1|4479584_4479926_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYR75625.1|4479889_4480090_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYR75626.1|4480097_4480607_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYR75627.1|4480639_4480882_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYR75628.1|4480998_4481631_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYR75629.1|4481634_4482660_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYR75630.1|4482766_4483120_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYR75631.1|4483736_4484024_+	hypothetical protein	NA	NA	NA	NA	NA
AYR75632.1|4484034_4484925_+	methyltransferase	NA	NA	NA	NA	NA
AYR75633.1|4484924_4485671_+	hypothetical protein	NA	NA	NA	NA	NA
AYR75634.1|4485972_4487943_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYR75635.1|4487962_4489267_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYR75636.1|4489289_4489985_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYR75637.1|4490010_4490805_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYR75638.1|4490814_4491882_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYR75639.1|4491926_4493663_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYR75640.1|4493662_4496158_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYR75641.1|4496181_4497228_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYR75642.1|4497230_4498508_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYR75643.1|4498752_4499292_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYR75644.1|4500145_4501657_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYR75645.1|4501640_4503230_+	hypothetical protein	NA	NA	NA	NA	NA
AYR75646.1|4503393_4504407_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4504584:4504600	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYR75647.1|4504833_4505127_+	hypothetical protein	NA	NA	NA	NA	NA
AYR75648.1|4505123_4505612_+	hypothetical protein	NA	NA	NA	NA	NA
AYR75649.1|4505791_4506244_-	hypothetical protein	NA	NA	NA	NA	NA
AYR75650.1|4511466_4511928_+	hypothetical protein	NA	NA	NA	NA	NA
AYR75651.1|4511924_4512146_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYR75652.1|4513002_4513785_+	hypothetical protein	NA	NA	NA	NA	NA
AYR75653.1|4514411_4514636_-	hypothetical protein	NA	NA	NA	NA	NA
AYR75654.1|4514765_4515677_-	hypothetical protein	NA	NA	NA	NA	NA
AYR75655.1|4515987_4517247_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4517406:4517422	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029949	Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 chromosome, complete genome	4783337	4659499	4669758	4783337	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYR75792.1|4659499_4660576_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYR75793.1|4660572_4661646_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYR75794.1|4661620_4662784_-	hypothetical protein	NA	NA	NA	NA	NA
AYR75795.1|4663059_4663626_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYR75796.1|4663641_4663881_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYR75797.1|4663884_4664745_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYR75798.1|4665167_4665491_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYR75799.1|4665474_4665975_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYR75800.1|4665971_4666199_+	hypothetical protein	NA	NA	NA	NA	NA
AYR75801.1|4666195_4666516_+	P4 phage protein	NA	NA	NA	NA	NA
AYR75802.1|4666530_4667205_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYR75803.1|4667201_4668863_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYR75804.1|4669599_4669758_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029948	Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence	217284	3612	57130	217284	transposase,holin	Escherichia_phage(43.75%)	56	NA	NA
AYR71470.1|3612_3888_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR71471.1|3806_4310_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	6.3e-94
AYR71472.1|4636_4861_-	hypothetical protein	NA	NA	NA	NA	NA
AYR71473.1|5516_5777_-	hypothetical protein	NA	NA	NA	NA	NA
AYR71474.1|5865_6357_-	hypothetical protein	NA	NA	NA	NA	NA
AYR71475.1|6361_6670_-	hypothetical protein	NA	NA	NA	NA	NA
AYR71476.1|6877_7258_-	hypothetical protein	NA	NA	NA	NA	NA
AYR71477.1|7343_7592_-	hypothetical protein	NA	NA	NA	NA	NA
AYR71478.1|7629_7851_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	8.2e-06
AYR71479.1|8013_8397_-	hypothetical protein	NA	NA	NA	NA	NA
AYR71480.1|8711_8936_-	hypothetical protein	NA	NA	NA	NA	NA
AYR71481.1|9022_9487_-	hypothetical protein	NA	NA	NA	NA	NA
AYR71482.1|9669_12099_-	hypothetical protein	NA	NA	NA	NA	NA
AYR71483.1|12221_12668_-	hypothetical protein	NA	NA	NA	NA	NA
AYR71484.1|12715_13522_-	hypothetical protein	NA	NA	NA	NA	NA
AYR71485.1|13749_13992_-	hypothetical protein	NA	NA	NA	NA	NA
AYR71486.1|14069_14402_-	hypothetical protein	NA	NA	NA	NA	NA
AYR71487.1|14901_16083_-	hypothetical protein	NA	NA	NA	NA	NA
AYR71488.1|16091_16388_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
AYR71489.1|16451_16919_-	hypothetical protein	NA	NA	NA	NA	NA
AYR71490.1|17778_18555_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71491.1|18704_19481_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71492.1|19669_20011_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71493.1|20111_20375_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.1e-08
AYR71494.1|20608_21307_+	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	4.2e-11
AYR71495.1|21461_21758_-	hypothetical protein	NA	NA	NA	NA	NA
AYR71496.1|21845_24230_-	periplasmic protein	NA	NA	NA	NA	NA
AYR71497.1|24480_25089_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71498.1|25201_25498_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71499.1|25502_26099_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71500.1|26490_27372_+	replication protein	NA	J9Q7H0	Salmonella_phage	41.3	6.5e-54
AYR71501.1|27957_28473_-	hypothetical protein	NA	NA	NA	NA	NA
AYR71502.1|29123_31580_-	periplasmic protein	NA	NA	NA	NA	NA
AYR71503.1|32216_33971_-	DNA restriction methylase	NA	J9Q747	Salmonella_phage	30.9	1.1e-68
AYR71504.1|34156_35314_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.1e-19
AYR71505.1|35673_36498_+	DNA modification methylase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
AYR71506.1|36512_37334_-	hypothetical protein	NA	NA	NA	NA	NA
AYR71507.1|37616_38324_-	hypothetical protein	NA	NA	NA	NA	NA
AYR71508.1|38538_39615_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
AYR71509.1|40149_41025_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
AYR71510.1|41278_41860_-	hypothetical protein	NA	NA	NA	NA	NA
AYR71511.1|42466_42820_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71512.1|42871_43189_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71513.1|43188_43986_+	pilus assembly protein	NA	NA	NA	NA	NA
AYR71514.1|43988_45221_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71515.1|45222_45663_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71516.1|45640_47011_+	TrhB	NA	NA	NA	NA	NA
AYR71517.1|47019_47532_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71518.1|47532_48390_+	plasmid transfer protein	NA	NA	NA	NA	NA
AYR71519.1|48399_49350_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71520.1|49358_52040_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71521.1|52673_52949_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	93.4	1.9e-44
AYR71522.1|53077_55081_+|holin	transporter, betaine/carnitine/choline family	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AYR71523.1|55143_56439_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71524.1|56432_56936_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR71525.1|56854_57130_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
>prophage 2
CP029948	Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence	217284	82223	134786	217284	transposase,integrase	Escherichia_phage(50.0%)	63	107127:107141	131627:131641
AYR71545.1|82223_82727_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	6.3e-94
AYR71546.1|82645_82921_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR71547.1|82962_84819_+	hypothetical protein	NA	S5MMD7	Bacillus_phage	26.4	2.2e-19
AYR71548.1|85216_86092_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71549.1|86150_86528_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71550.1|86588_87575_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71551.1|87634_88687_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71552.1|88725_88995_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71553.1|89065_90193_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71554.1|90270_92283_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71555.1|92354_92576_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71556.1|92690_93923_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
AYR71557.1|94197_94722_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71558.1|94712_95678_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71559.1|95748_96684_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71560.1|96761_97682_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71561.1|97754_98690_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71562.1|98866_99823_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71563.1|100235_100505_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71564.1|100559_101150_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71565.1|101157_101415_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71566.1|101488_102025_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71567.1|102041_102497_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71568.1|102480_102708_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71569.1|102756_103011_-	hypothetical protein	NA	NA	NA	NA	NA
AYR71570.1|103078_104038_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71571.1|104048_104957_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71572.1|105261_106443_-	recombinase	NA	NA	NA	NA	NA
AYR71573.1|106657_106870_+	regulatory protein	NA	NA	NA	NA	NA
107127:107141	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYR71574.1|107176_107452_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	7.7e-46
107127:107141	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYR71575.1|107370_107874_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR71576.1|107980_108415_-	transcriptional regulator MerR	NA	NA	NA	NA	NA
AYR71577.1|108432_108837_+	MerT	NA	NA	NA	NA	NA
AYR71578.1|108850_109126_+	mercuric transport protein	NA	NA	NA	NA	NA
AYR71579.1|109161_109584_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AYR71580.1|109635_111330_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYR71581.1|111347_111710_+	transcriptional regulator MerD	NA	NA	NA	NA	NA
AYR71582.1|111706_111943_+	mercury resistance protein	NA	NA	NA	NA	NA
AYR71583.1|111939_112647_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71584.1|112685_113990_+|integrase	integrase	integrase	NA	NA	NA	NA
AYR71585.1|114018_114741_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR71586.1|115496_116348_+	replication protein	NA	NA	NA	NA	NA
AYR71587.1|116655_117471_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AYR71588.1|117531_118335_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYR71589.1|118334_119171_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYR71590.1|119231_119954_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR71591.1|120533_121394_-	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
120988:121002	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYR71592.1|121576_121843_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
120988:121002	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYR71593.1|121875_122598_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR71594.1|122831_123758_-	sulfonamide-resistant dihydropteroate synthase sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	7.2e-11
AYR71595.1|123664_124045_-	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYR71596.1|124241_124841_-	dihydrofolate reductase	NA	A0A1B2IAU3	Erwinia_phage	32.8	5.3e-15
AYR71597.1|124872_125886_+|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYR71598.1|125875_126439_+	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYR71599.1|126564_127125_+	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYR71600.1|127127_130094_+|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYR71601.1|130160_130538_+	hypothetical protein	NA	NA	NA	NA	NA
AYR71602.1|130738_131398_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AYR71603.1|131676_131952_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR71604.1|131870_132374_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.4	1.3e-94
AYR71605.1|132955_133711_+	replication protein	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
AYR71606.1|134088_134364_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR71607.1|134282_134786_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	94.0	3.6e-89
