The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029946	Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 chromosome, complete genome	4785705	930368	937680	4785705	integrase,protease	Dickeya_phage(16.67%)	6	931619:931633	942798:942812
AYR85184.1|930368_931487_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYR85185.1|931483_933430_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931619:931633	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYR85186.1|933559_933781_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYR85187.1|934104_934425_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYR85188.1|934455_936732_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYR85189.1|937302_937680_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942798:942812	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029946	Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 chromosome, complete genome	4785705	1008623	1085935	4785705	integrase,protease,transposase,terminase,tail	Salmonella_phage(73.33%)	93	990689:990708	1061296:1061315
990689:990708	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYR85239.1|1008623_1009964_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYR85240.1|1009960_1010209_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYR85241.1|1010249_1010495_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYR85242.1|1010494_1011376_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYR85243.1|1011372_1012437_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYR85244.1|1012514_1013195_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYR85245.1|1013191_1013977_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYR85246.1|1013982_1014279_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYR85247.1|1014369_1014570_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYR85248.1|1014858_1015263_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYR85249.1|1015594_1015969_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYR85250.1|1016053_1017037_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYR85251.1|1017039_1017789_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYR85252.1|1017799_1018147_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYR85253.1|1018143_1018668_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYR85254.1|1018667_1019141_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYR85255.1|1019144_1019717_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYR85256.1|1019810_1020077_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYR85257.1|1020158_1020320_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR85258.1|1020752_1021250_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR85259.1|1021434_1021674_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYR85260.1|1021663_1021969_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYR85261.1|1022008_1022611_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYR85262.1|1022819_1023431_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYR85263.1|1023563_1024361_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYR85264.1|1024759_1024885_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR85265.1|1025020_1025470_-	lipoprotein	NA	NA	NA	NA	NA
AYR85266.1|1025686_1026076_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYR85267.1|1026062_1026344_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYR85268.1|1026343_1026958_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYR85269.1|1027176_1027431_+	hypothetical protein	NA	NA	NA	NA	NA
AYR85270.1|1027535_1027913_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYR85271.1|1027976_1028237_+	hypothetical protein	NA	NA	NA	NA	NA
AYR85272.1|1028326_1029079_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYR85273.1|1029044_1030448_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYR85274.1|1030447_1031917_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYR85275.1|1032008_1032539_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYR85276.1|1032553_1033786_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYR85277.1|1033790_1034288_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYR85278.1|1034299_1035241_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYR85279.1|1035282_1035651_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYR85280.1|1035616_1036024_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYR85281.1|1036020_1036575_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYR85282.1|1036561_1036951_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYR85283.1|1036925_1037489_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYR85284.1|1037492_1038638_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYR85285.1|1038649_1039090_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYR85286.1|1039093_1039546_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYR85287.1|1039723_1041676_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYR85288.1|1041675_1042326_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYR85289.1|1042329_1042632_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYR85290.1|1042634_1043666_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYR85291.1|1043662_1043998_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYR85292.1|1044192_1044924_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR85293.1|1044923_1045352_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR85294.1|1045410_1046166_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYR85295.1|1046253_1046391_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYR85296.1|1046406_1046760_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYR85297.1|1046760_1047960_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYR85298.1|1047956_1048637_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYR85299.1|1048636_1050148_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYR85300.1|1050162_1050681_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYR85301.1|1051602_1052304_-	hypothetical protein	NA	NA	NA	NA	NA
AYR85302.1|1052616_1052895_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYR85303.1|1053320_1055933_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYR85304.1|1056140_1057151_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYR85305.1|1057313_1057859_+	hypothetical protein	NA	NA	NA	NA	NA
AYR85306.1|1057855_1058965_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYR85307.1|1059063_1061172_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYR85308.1|1061184_1063092_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061296:1061315	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYR85309.1|1063106_1064360_+	inner membrane protein	NA	NA	NA	NA	NA
AYR85310.1|1064364_1066005_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYR85311.1|1066001_1066565_+	lipoprotein	NA	NA	NA	NA	NA
AYR85312.1|1066818_1066986_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYR85313.1|1067085_1067604_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYR85314.1|1067672_1069433_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYR85315.1|1069618_1070071_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYR85316.1|1070142_1071195_-	outer membrane protein A	NA	NA	NA	NA	NA
AYR85317.1|1071549_1072059_-	cell division inhibitor	NA	NA	NA	NA	NA
AYR85318.1|1072275_1072881_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYR85319.1|1072867_1075021_-	inner membrane protein	NA	NA	NA	NA	NA
AYR85320.1|1075039_1075486_-	hypothetical protein	NA	NA	NA	NA	NA
AYR85321.1|1075609_1077664_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYR85322.1|1077699_1078158_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYR85323.1|1078252_1078915_-	hypothetical protein	NA	NA	NA	NA	NA
AYR85324.1|1079085_1079502_+	hypothetical protein	NA	NA	NA	NA	NA
AYR85325.1|1079546_1079864_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYR85326.1|1079921_1081133_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYR85327.1|1082264_1082723_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR85328.1|1083459_1083741_+	acylphosphatase	NA	NA	NA	NA	NA
AYR85329.1|1083737_1084067_-	sulfite reductase	NA	NA	NA	NA	NA
AYR85330.1|1084153_1084813_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYR85331.1|1085476_1085935_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029946	Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 chromosome, complete genome	4785705	1528753	1602323	4785705	protease,transposase,tail,plate,head,tRNA	Burkholderia_virus(42.11%)	81	NA	NA
AYR85731.1|1528753_1529212_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR85732.1|1529714_1529996_+	stress response protein	NA	NA	NA	NA	NA
AYR85733.1|1530264_1531086_+|protease	serine protease	protease	NA	NA	NA	NA
AYR85734.1|1531120_1531450_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYR85735.1|1531436_1531799_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYR85736.1|1531910_1532081_-	hypothetical protein	NA	NA	NA	NA	NA
AYR85737.1|1532215_1533250_+	hypothetical protein	NA	NA	NA	NA	NA
AYR85738.1|1533424_1534813_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYR85739.1|1534823_1536353_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYR85740.1|1536879_1537824_+	hypothetical protein	NA	NA	NA	NA	NA
AYR85741.1|1538005_1538395_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYR85742.1|1538366_1538819_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYR85743.1|1539013_1539244_-	hypothetical protein	NA	NA	NA	NA	NA
AYR85744.1|1539240_1539924_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYR85745.1|1539920_1540136_-	hypothetical protein	NA	NA	NA	NA	NA
AYR85746.1|1540128_1540512_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYR85747.1|1540508_1540811_-	hypothetical protein	NA	NA	NA	NA	NA
AYR85748.1|1540820_1541093_-	hypothetical protein	NA	NA	NA	NA	NA
AYR85749.1|1541381_1541912_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYR85750.1|1541939_1542209_-	hypothetical protein	NA	NA	NA	NA	NA
AYR85751.1|1542211_1543378_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYR85752.1|1543388_1545158_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYR85753.1|1545335_1545767_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYR85754.1|1545762_1546359_+	hypothetical protein	NA	NA	NA	NA	NA
AYR85755.1|1546602_1546953_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYR85756.1|1547667_1548318_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYR85757.1|1548314_1548641_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYR85758.1|1548640_1548952_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYR85759.1|1548951_1549497_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYR85760.1|1549493_1551089_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYR85761.1|1551088_1552585_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYR85762.1|1552565_1553387_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYR85763.1|1553389_1553848_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYR85764.1|1554062_1555178_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYR85765.1|1555192_1556146_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYR85766.1|1556155_1556494_+	hypothetical protein	NA	NA	NA	NA	NA
AYR85767.1|1556495_1556942_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYR85768.1|1556941_1557406_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYR85769.1|1557402_1557657_+	hypothetical protein	NA	NA	NA	NA	NA
AYR85770.1|1557646_1559074_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYR85771.1|1559073_1559595_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYR85772.1|1559597_1559879_+	hypothetical protein	NA	NA	NA	NA	NA
AYR85773.1|1559976_1560312_+	hypothetical protein	NA	NA	NA	NA	NA
AYR85774.1|1560487_1562953_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYR85775.1|1562952_1563837_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYR85776.1|1563833_1564049_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYR85777.1|1564036_1565191_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYR85778.1|1565187_1565715_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYR85779.1|1565771_1566119_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYR85780.1|1566109_1567213_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYR85781.1|1567205_1567784_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYR85782.1|1567786_1568812_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYR85783.1|1569325_1569943_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYR85784.1|1570436_1570829_-	hypothetical protein	NA	Q9MCR6	Enterobacteria_phage	51.1	6.8e-19
AYR85785.1|1571425_1571998_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYR85786.1|1572278_1573661_+	amino acid permease	NA	NA	NA	NA	NA
AYR85787.1|1573722_1574058_-	hypothetical protein	NA	NA	NA	NA	NA
AYR85788.1|1574184_1574916_+	two-component response regulator	NA	NA	NA	NA	NA
AYR85789.1|1575396_1576548_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYR85790.1|1576700_1578407_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYR85791.1|1578514_1579819_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYR85792.1|1579894_1580824_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYR85793.1|1580820_1582224_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYR85794.1|1582391_1584038_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYR85795.1|1584237_1585413_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYR85796.1|1585515_1587024_+	hypothetical protein	NA	NA	NA	NA	NA
AYR85797.1|1587729_1588731_+	adenosine deaminase	NA	NA	NA	NA	NA
AYR85798.1|1588804_1589920_-	oxidoreductase	NA	NA	NA	NA	NA
AYR85799.1|1590022_1590178_+	hypothetical protein	NA	NA	NA	NA	NA
AYR85800.1|1590476_1590692_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYR85801.1|1590780_1591221_+	hypothetical protein	NA	NA	NA	NA	NA
AYR85802.1|1591297_1591879_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYR85803.1|1591878_1592457_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYR85804.1|1592449_1594471_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYR85805.1|1594471_1595530_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYR85806.1|1595533_1596154_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYR85807.1|1596156_1596849_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYR85808.1|1596848_1597484_+	endonuclease III	NA	NA	NA	NA	NA
AYR85809.1|1598084_1599590_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYR85810.1|1599694_1600300_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYR85811.1|1601048_1602323_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029946	Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 chromosome, complete genome	4785705	1783360	1787772	4785705		Escherichia_phage(50.0%)	6	NA	NA
AYR85995.1|1783360_1783600_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYR85996.1|1784472_1785282_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYR85997.1|1785354_1785732_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYR85998.1|1785879_1786422_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYR85999.1|1786613_1787342_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYR86000.1|1787358_1787772_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029946	Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 chromosome, complete genome	4785705	1991625	1998859	4785705		Morganella_phage(33.33%)	7	NA	NA
AYR86190.1|1991625_1993056_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYR86191.1|1993129_1993825_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYR86192.1|1993904_1994216_-	hypothetical protein	NA	NA	NA	NA	NA
AYR86193.1|1994866_1996051_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYR86194.1|1996510_1996723_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYR86195.1|1997168_1998437_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYR86196.1|1998439_1998859_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029946	Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 chromosome, complete genome	4785705	2105160	2115667	4785705		Enterobacteria_phage(37.5%)	10	NA	NA
AYR86293.1|2105160_2106474_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYR86294.1|2106500_2107580_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYR86295.1|2107584_2108358_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYR86296.1|2108373_2109348_-	reductase RfbI	NA	NA	NA	NA	NA
AYR86297.1|2109353_2109905_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYR86298.1|2109905_2110784_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYR86299.1|2110831_2111731_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYR86300.1|2111730_2112816_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYR86301.1|2113192_2114086_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYR86302.1|2114263_2115667_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029946	Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 chromosome, complete genome	4785705	2192896	2202067	4785705	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYR86362.1|2192896_2194930_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYR86363.1|2195170_2195629_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYR86364.1|2195800_2196331_+	lipoprotein	NA	NA	NA	NA	NA
AYR86365.1|2196387_2196855_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYR86366.1|2196901_2197621_-	two-component system response regulator	NA	NA	NA	NA	NA
AYR86367.1|2197617_2199303_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYR86368.1|2199525_2200257_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYR86369.1|2200316_2200424_+	hypothetical protein	NA	NA	NA	NA	NA
AYR86370.1|2200404_2201136_-	ABC transporter permease	NA	NA	NA	NA	NA
AYR86371.1|2201119_2202067_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029946	Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 chromosome, complete genome	4785705	2738842	2752234	4785705	tail	Salmonella_phage(70.0%)	11	NA	NA
AYR86801.1|2738842_2739061_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYR86802.1|2739151_2740252_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYR86803.1|2740248_2740734_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYR86804.1|2740730_2743808_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYR86805.1|2743800_2743920_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYR86806.1|2743934_2744237_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYR86807.1|2744291_2744807_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYR86808.1|2744816_2745989_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYR86809.1|2746131_2746704_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYR86810.1|2747381_2748497_+	glycosyltransferase	NA	NA	NA	NA	NA
AYR86811.1|2748577_2752234_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029946	Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 chromosome, complete genome	4785705	3069395	3113098	4785705	tRNA,bacteriocin,transposase,protease	Bacillus_virus(33.33%)	44	NA	NA
AYR87098.1|3069395_3069854_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR87099.1|3070043_3071123_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYR87100.1|3071224_3072388_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYR87101.1|3072409_3073456_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYR87102.1|3073829_3074255_+	hypothetical protein	NA	NA	NA	NA	NA
AYR87103.1|3074280_3074859_+	hypothetical protein	NA	NA	NA	NA	NA
AYR87104.1|3074892_3075567_+	hypothetical protein	NA	NA	NA	NA	NA
AYR87105.1|3075548_3076232_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYR87106.1|3076225_3076882_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYR87107.1|3076986_3077445_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR87108.1|3077633_3079625_-	transketolase	NA	NA	NA	NA	NA
AYR87109.1|3079900_3080659_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYR87110.1|3080759_3081680_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYR87111.1|3081907_3083884_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYR87112.1|3083892_3084024_-	hypothetical protein	NA	NA	NA	NA	NA
AYR87113.1|3084318_3084618_-	membrane protein	NA	NA	NA	NA	NA
AYR87114.1|3084673_3085828_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYR87115.1|3086320_3087715_+	galactose-proton symport	NA	NA	NA	NA	NA
AYR87116.1|3087793_3088291_+	hypothetical protein	NA	NA	NA	NA	NA
AYR87117.1|3088386_3089094_+	endonuclease I	NA	NA	NA	NA	NA
AYR87118.1|3089170_3089902_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYR87119.1|3089921_3090869_+	glutathione synthetase	NA	NA	NA	NA	NA
AYR87120.1|3091084_3091648_+	hypothetical protein	NA	NA	NA	NA	NA
AYR87121.1|3091647_3092064_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYR87122.1|3092110_3092797_-	global regulatory protein	NA	NA	NA	NA	NA
AYR87123.1|3092926_3093907_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYR87124.1|3093924_3094629_+	hypothetical protein	NA	NA	NA	NA	NA
AYR87125.1|3094647_3095214_+	hypothetical protein	NA	NA	NA	NA	NA
AYR87126.1|3095210_3095501_+	hypothetical protein	NA	NA	NA	NA	NA
AYR87127.1|3095508_3096102_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYR87128.1|3096094_3097231_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYR87129.1|3097321_3098329_-	hypothetical protein	NA	NA	NA	NA	NA
AYR87130.1|3098461_3099508_-	L-asparaginase	NA	NA	NA	NA	NA
AYR87131.1|3099826_3100285_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR87132.1|3100407_3101127_-	hypothetical protein	NA	NA	NA	NA	NA
AYR87133.1|3101176_3101503_-	hypothetical protein	NA	NA	NA	NA	NA
AYR87134.1|3101502_3102222_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYR87135.1|3102376_3103429_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYR87136.1|3103456_3103732_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYR87137.1|3103844_3104930_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYR87138.1|3105146_3106403_+	nucleoside permease	NA	NA	NA	NA	NA
AYR87139.1|3109013_3109721_+	hypothetical protein	NA	NA	NA	NA	NA
AYR87140.1|3112310_3112577_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYR87141.1|3112819_3113098_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029946	Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 chromosome, complete genome	4785705	3490437	3528495	4785705	integrase,capsid,transposase,portal,terminase,tail,plate	Salmonella_phage(82.05%)	46	3485401:3485415	3497567:3497581
3485401:3485415	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYR87469.1|3490437_3492084_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYR87470.1|3492223_3492322_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYR87471.1|3492577_3492907_+	hypothetical protein	NA	NA	NA	NA	NA
AYR87472.1|3492947_3494000_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYR87473.1|3494395_3494965_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYR87474.1|3495090_3495312_+	hypothetical protein	NA	NA	NA	NA	NA
AYR87475.1|3495344_3495854_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYR87476.1|3496028_3496253_+	hypothetical protein	NA	NA	NA	NA	NA
AYR87477.1|3496275_3496617_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYR87478.1|3496684_3496918_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYR87479.1|3496917_3497145_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYR87480.1|3497141_3497999_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3497567:3497581	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYR87481.1|3497995_3500410_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYR87482.1|3500563_3500752_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYR87483.1|3502719_3503634_+	hypothetical protein	NA	NA	NA	NA	NA
AYR87484.1|3503630_3504371_+	hypothetical protein	NA	NA	NA	NA	NA
AYR87485.1|3504405_3505443_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYR87486.1|3505442_3507209_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYR87487.1|3507351_3508185_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYR87488.1|3508201_3509260_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYR87489.1|3509263_3509914_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYR87490.1|3509946_3510474_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYR87491.1|3510473_3510677_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYR87492.1|3510680_3510896_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYR87493.1|3510915_3511389_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYR87494.1|3511390_3511768_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYR87495.1|3511764_3512193_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYR87496.1|3512288_3512720_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYR87497.1|3512712_3513159_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYR87498.1|3513227_3513806_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYR87499.1|3513802_3514162_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYR87500.1|3514148_3515057_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYR87501.1|3515049_3515655_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYR87502.1|3515651_3517166_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYR87503.1|3517165_3517759_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYR87504.1|3517730_3518171_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYR87505.1|3518593_3519166_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYR87506.1|3519308_3520481_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYR87507.1|3520490_3521006_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYR87508.1|3521060_3521363_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYR87509.1|3521377_3521497_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYR87510.1|3521489_3524567_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYR87511.1|3524563_3525049_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYR87512.1|3525045_3526146_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYR87513.1|3526236_3526455_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYR87514.1|3528036_3528495_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029946	Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 chromosome, complete genome	4785705	4444020	4518277	4785705	integrase,capsid,terminase,portal,tail,plate	Salmonella_phage(82.98%)	76	4505521:4505537	4518436:4518452
AYR88285.1|4444020_4445970_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYR88286.1|4446041_4446950_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88287.1|4447023_4447923_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88288.1|4447964_4448324_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88289.1|4448423_4448693_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88290.1|4448824_4450099_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYR88291.1|4450318_4450696_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88292.1|4450782_4451001_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYR88293.1|4451068_4452169_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYR88294.1|4452165_4452651_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYR88295.1|4452650_4455431_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYR88296.1|4455423_4455543_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYR88297.1|4455557_4455860_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYR88298.1|4455914_4456430_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYR88299.1|4456439_4457612_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYR88300.1|4458146_4458869_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYR88301.1|4459066_4459474_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYR88302.1|4459480_4461100_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYR88303.1|4461096_4461702_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYR88304.1|4461694_4462603_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	96.7	4.4e-154
AYR88305.1|4462589_4462949_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYR88306.1|4462945_4463524_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYR88307.1|4463592_4464039_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYR88308.1|4464031_4464463_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYR88309.1|4464558_4464984_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYR88310.1|4464983_4465361_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYR88311.1|4465365_4465836_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYR88312.1|4465855_4466071_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYR88313.1|4466074_4466278_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYR88314.1|4466277_4466742_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYR88315.1|4466835_4467486_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYR88316.1|4467489_4468554_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYR88317.1|4468570_4469404_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYR88318.1|4469546_4471313_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYR88319.1|4471309_4472356_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYR88320.1|4472404_4473100_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88321.1|4473119_4474184_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88322.1|4474180_4475245_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88323.1|4476169_4476499_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYR88324.1|4476495_4478565_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYR88325.1|4478555_4479416_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYR88326.1|4479412_4479997_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYR88327.1|4479993_4480221_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYR88328.1|4480220_4480454_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYR88329.1|4480521_4480863_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYR88330.1|4480826_4481027_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYR88331.1|4481034_4481544_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYR88332.1|4481576_4481819_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYR88333.1|4481935_4482568_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYR88334.1|4482571_4483597_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYR88335.1|4483703_4484057_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYR88336.1|4484673_4484961_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88337.1|4484971_4485862_+	methyltransferase	NA	NA	NA	NA	NA
AYR88338.1|4485861_4486608_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88339.1|4486909_4488880_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYR88340.1|4488899_4490204_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYR88341.1|4490226_4490922_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYR88342.1|4490947_4491742_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYR88343.1|4491751_4492819_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYR88344.1|4492863_4494600_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYR88345.1|4494599_4497095_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYR88346.1|4497118_4498165_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYR88347.1|4498167_4499445_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYR88348.1|4499689_4500229_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYR88349.1|4501082_4502594_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYR88350.1|4502577_4504167_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88351.1|4504330_4505344_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4505521:4505537	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYR88352.1|4505770_4506064_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88353.1|4506060_4506549_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88354.1|4506728_4507181_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88355.1|4512403_4512865_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88356.1|4512861_4513083_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYR88357.1|4513939_4514722_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88358.1|4515348_4515573_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88359.1|4515702_4516707_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYR88360.1|4517017_4518277_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4518436:4518452	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029946	Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 chromosome, complete genome	4785705	4660529	4670788	4785705	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYR88497.1|4660529_4661606_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYR88498.1|4661602_4662676_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYR88499.1|4662650_4663814_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88500.1|4664089_4664656_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYR88501.1|4664671_4664911_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYR88502.1|4664914_4665775_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYR88503.1|4666197_4666521_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYR88504.1|4666504_4667005_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYR88505.1|4667001_4667229_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88506.1|4667225_4667546_+	P4 phage protein	NA	NA	NA	NA	NA
AYR88507.1|4667560_4668235_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYR88508.1|4668231_4669893_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYR88509.1|4670629_4670788_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029947	Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence	218627	3612	57130	218627	transposase,holin	Escherichia_phage(43.75%)	56	NA	NA
AYR88606.1|3612_3888_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR88607.1|3806_4310_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	6.3e-94
AYR88608.1|4636_4861_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88609.1|5516_5777_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88610.1|5865_6357_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88611.1|6361_6670_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88612.1|6877_7258_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88613.1|7343_7592_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88614.1|7629_7851_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	8.2e-06
AYR88615.1|8013_8397_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88616.1|8711_8936_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88617.1|9022_9487_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88618.1|9669_12099_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88619.1|12221_12668_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88620.1|12715_13522_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88621.1|13749_13992_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88622.1|14069_14402_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88623.1|14901_16083_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88624.1|16091_16388_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
AYR88625.1|16451_16919_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88626.1|17778_18555_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88627.1|18704_19481_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88628.1|19669_20011_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88629.1|20111_20375_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.1e-08
AYR88630.1|20608_21307_+	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	4.2e-11
AYR88631.1|21461_21758_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88632.1|21845_24230_-	periplasmic protein	NA	NA	NA	NA	NA
AYR88633.1|24480_25089_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88634.1|25201_25498_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88635.1|25502_26099_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88636.1|26490_27372_+	replication protein	NA	J9Q7H0	Salmonella_phage	41.3	6.5e-54
AYR88637.1|27957_28473_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88638.1|29123_31580_-	periplasmic protein	NA	NA	NA	NA	NA
AYR88639.1|32216_33971_-	DNA restriction methylase	NA	J9Q747	Salmonella_phage	30.9	1.1e-68
AYR88640.1|34156_35314_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.1e-19
AYR88641.1|35673_36498_+	DNA modification methylase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
AYR88642.1|36512_37334_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88643.1|37616_38324_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88644.1|38538_39615_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
AYR88645.1|40149_41025_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
AYR88646.1|41278_41860_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88647.1|42466_42820_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88648.1|42871_43189_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88649.1|43188_43986_+	pilus assembly protein	NA	NA	NA	NA	NA
AYR88650.1|43988_45221_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88651.1|45222_45663_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88652.1|45640_47011_+	TrhB	NA	NA	NA	NA	NA
AYR88653.1|47019_47532_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88654.1|47532_48390_+	plasmid transfer protein	NA	NA	NA	NA	NA
AYR88655.1|48399_49350_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88656.1|49358_52040_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88657.1|52673_52949_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	93.4	1.9e-44
AYR88658.1|53077_55081_+|holin	transporter, betaine/carnitine/choline family	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AYR88659.1|55143_56439_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88660.1|56432_56936_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR88661.1|56854_57130_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
>prophage 2
CP029947	Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence	218627	83456	136129	218627	transposase,integrase	Escherichia_phage(50.0%)	63	108360:108374	132860:132874
AYR88682.1|83456_83960_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR88683.1|83878_84154_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR88684.1|84195_86052_+	hypothetical protein	NA	S5MMD7	Bacillus_phage	26.4	2.2e-19
AYR88685.1|86449_87325_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88686.1|87383_87761_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88687.1|87821_88808_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88688.1|88867_89920_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88689.1|89958_90228_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88690.1|90298_91426_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88691.1|91503_93516_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88692.1|93587_93809_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88693.1|93923_95156_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
AYR88694.1|95430_95955_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88695.1|95945_96911_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88696.1|96981_97917_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88697.1|97994_98915_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88698.1|98987_99923_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88699.1|100099_101056_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88700.1|101468_101738_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88701.1|101792_102383_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88702.1|102390_102648_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88703.1|102721_103258_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88704.1|103274_103730_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88705.1|103713_103941_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88706.1|103989_104244_-	hypothetical protein	NA	NA	NA	NA	NA
AYR88707.1|104311_105271_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88708.1|105281_106190_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88709.1|106494_107676_-	recombinase	NA	NA	NA	NA	NA
AYR88710.1|107890_108103_+	regulatory protein	NA	NA	NA	NA	NA
108360:108374	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYR88711.1|108409_108685_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	7.7e-46
108360:108374	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYR88712.1|108603_109107_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR88713.1|109213_109648_-	transcriptional regulator MerR	NA	NA	NA	NA	NA
AYR88714.1|109665_110070_+	MerT	NA	NA	NA	NA	NA
AYR88715.1|110083_110359_+	mercuric transport protein	NA	NA	NA	NA	NA
AYR88716.1|110394_110817_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AYR88717.1|110868_112563_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYR88718.1|112580_112943_+	transcriptional regulator MerD	NA	NA	NA	NA	NA
AYR88719.1|112939_113176_+	mercury resistance protein	NA	NA	NA	NA	NA
AYR88720.1|113172_113880_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88721.1|113918_115223_+|integrase	integrase	integrase	NA	NA	NA	NA
AYR88722.1|115251_115974_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR88723.1|116729_117581_+	replication protein	NA	NA	NA	NA	NA
AYR88724.1|117888_118704_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AYR88725.1|118764_119568_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYR88726.1|119567_120404_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYR88727.1|120464_121187_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR88728.1|121766_122627_-	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
122221:122235	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYR88729.1|122809_123076_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
122221:122235	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYR88730.1|123108_123831_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR88731.1|124064_124991_-	sulfonamide-resistant dihydropteroate synthase sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	7.2e-11
AYR88732.1|124897_125278_-	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYR88733.1|125474_126074_-	dihydrofolate reductase	NA	A0A1B2IAU3	Erwinia_phage	32.8	5.3e-15
AYR88734.1|126105_127119_+|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYR88735.1|127108_127672_+	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYR88736.1|127797_128358_+	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYR88737.1|128360_131327_+|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYR88738.1|131393_131771_+	hypothetical protein	NA	NA	NA	NA	NA
AYR88739.1|131971_132631_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AYR88740.1|132909_133185_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR88741.1|133103_133607_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	1.1e-93
AYR88742.1|134188_134944_+	replication protein	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
AYR88743.1|135431_135707_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR88744.1|135625_136129_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	92.8	1.4e-88
