The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029944	Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 chromosome, complete genome	4784815	930600	937912	4784815	integrase,protease	Dickeya_phage(16.67%)	6	931851:931865	943030:943044
AYR94065.1|930600_931719_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYR94066.1|931715_933662_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931851:931865	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYR94067.1|933791_934013_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYR94068.1|934336_934657_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYR94069.1|934687_936964_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYR94070.1|937534_937912_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
943030:943044	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029944	Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 chromosome, complete genome	4784815	1008855	1086167	4784815	transposase,protease,integrase,terminase,tail	Salmonella_phage(73.33%)	93	990921:990940	1061528:1061547
990921:990940	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYR94120.1|1008855_1010196_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYR94121.1|1010192_1010441_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYR94122.1|1010481_1010727_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYR94123.1|1010726_1011608_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYR94124.1|1011604_1012669_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYR94125.1|1012746_1013427_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYR94126.1|1013423_1014209_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYR94127.1|1014214_1014511_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYR94128.1|1014601_1014802_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYR94129.1|1015090_1015495_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYR94130.1|1015826_1016201_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYR94131.1|1016285_1017269_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYR94132.1|1017271_1018021_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYR94133.1|1018031_1018379_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYR94134.1|1018375_1018900_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYR94135.1|1018899_1019373_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYR94136.1|1019376_1019949_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYR94137.1|1020042_1020309_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYR94138.1|1020390_1020552_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR94139.1|1020984_1021482_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR94140.1|1021666_1021906_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYR94141.1|1021895_1022201_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYR94142.1|1022240_1022843_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYR94143.1|1023051_1023663_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYR94144.1|1023795_1024593_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYR94145.1|1024991_1025117_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR94146.1|1025252_1025702_-	lipoprotein	NA	NA	NA	NA	NA
AYR94147.1|1025918_1026308_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYR94148.1|1026294_1026576_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYR94149.1|1026575_1027190_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYR94150.1|1027408_1027663_+	hypothetical protein	NA	NA	NA	NA	NA
AYR94151.1|1027767_1028145_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYR94152.1|1028208_1028469_+	hypothetical protein	NA	NA	NA	NA	NA
AYR94153.1|1028558_1029311_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYR94154.1|1029276_1030680_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYR94155.1|1030679_1032149_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYR94156.1|1032240_1032771_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYR94157.1|1032785_1034018_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYR94158.1|1034022_1034520_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYR94159.1|1034531_1035473_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYR94160.1|1035514_1035883_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYR94161.1|1035848_1036256_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYR94162.1|1036252_1036807_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYR94163.1|1036793_1037183_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYR94164.1|1037157_1037721_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYR94165.1|1037724_1038870_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYR94166.1|1038881_1039322_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYR94167.1|1039325_1039778_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYR94168.1|1039955_1041908_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYR94169.1|1041907_1042558_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYR94170.1|1042561_1042864_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYR94171.1|1042866_1043898_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYR94172.1|1043894_1044230_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYR94173.1|1044424_1045156_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR94174.1|1045155_1045584_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR94175.1|1045642_1046398_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYR94176.1|1046485_1046623_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYR94177.1|1046638_1046992_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYR94178.1|1046992_1048192_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYR94179.1|1048188_1048869_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYR94180.1|1048868_1050380_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYR94181.1|1050394_1050913_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYR94182.1|1051834_1052536_-	hypothetical protein	NA	NA	NA	NA	NA
AYR94183.1|1052848_1053127_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYR94184.1|1053552_1056165_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYR94185.1|1056372_1057383_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYR94186.1|1057545_1058091_+	hypothetical protein	NA	NA	NA	NA	NA
AYR94187.1|1058087_1059197_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYR94188.1|1059295_1061404_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYR94189.1|1061416_1063324_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061528:1061547	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYR94190.1|1063338_1064592_+	inner membrane protein	NA	NA	NA	NA	NA
AYR94191.1|1064596_1066237_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYR94192.1|1066233_1066797_+	lipoprotein	NA	NA	NA	NA	NA
AYR94193.1|1067050_1067218_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYR94194.1|1067317_1067836_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYR94195.1|1067904_1069665_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYR94196.1|1069850_1070303_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYR94197.1|1070374_1071427_-	outer membrane protein A	NA	NA	NA	NA	NA
AYR94198.1|1071781_1072291_-	cell division inhibitor	NA	NA	NA	NA	NA
AYR94199.1|1072507_1073113_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYR94200.1|1073099_1075253_-	inner membrane protein	NA	NA	NA	NA	NA
AYR94201.1|1075271_1075718_-	hypothetical protein	NA	NA	NA	NA	NA
AYR94202.1|1075841_1077896_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYR94203.1|1077931_1078390_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYR94204.1|1078484_1079147_-	hypothetical protein	NA	NA	NA	NA	NA
AYR94205.1|1079317_1079734_+	hypothetical protein	NA	NA	NA	NA	NA
AYR94206.1|1079778_1080096_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYR94207.1|1080153_1081365_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYR94208.1|1082496_1082955_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR94209.1|1083691_1083973_+	acylphosphatase	NA	NA	NA	NA	NA
AYR94210.1|1083969_1084299_-	sulfite reductase	NA	NA	NA	NA	NA
AYR94211.1|1084385_1085045_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYR94212.1|1085708_1086167_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029944	Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 chromosome, complete genome	4784815	1528985	1602555	4784815	transposase,protease,plate,head,tRNA,tail	Burkholderia_virus(42.11%)	81	NA	NA
AYR94612.1|1528985_1529444_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR94613.1|1529946_1530228_+	stress response protein	NA	NA	NA	NA	NA
AYR94614.1|1530496_1531318_+|protease	serine protease	protease	NA	NA	NA	NA
AYR94615.1|1531352_1531682_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYR94616.1|1531668_1532031_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYR94617.1|1532142_1532313_-	hypothetical protein	NA	NA	NA	NA	NA
AYR94618.1|1532447_1533482_+	hypothetical protein	NA	NA	NA	NA	NA
AYR94619.1|1533656_1535045_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYR94620.1|1535055_1536585_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYR94621.1|1537111_1538056_+	hypothetical protein	NA	NA	NA	NA	NA
AYR94622.1|1538237_1538627_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYR94623.1|1538598_1539051_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYR94624.1|1539245_1539476_-	hypothetical protein	NA	NA	NA	NA	NA
AYR94625.1|1539472_1540156_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYR94626.1|1540152_1540368_-	hypothetical protein	NA	NA	NA	NA	NA
AYR94627.1|1540360_1540744_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYR94628.1|1540740_1541043_-	hypothetical protein	NA	NA	NA	NA	NA
AYR94629.1|1541052_1541325_-	hypothetical protein	NA	NA	NA	NA	NA
AYR94630.1|1541613_1542144_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYR94631.1|1542171_1542441_-	hypothetical protein	NA	NA	NA	NA	NA
AYR94632.1|1542443_1543610_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYR94633.1|1543620_1545390_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYR94634.1|1545567_1545999_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYR94635.1|1545994_1546591_+	hypothetical protein	NA	NA	NA	NA	NA
AYR94636.1|1546834_1547185_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYR94637.1|1547899_1548550_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYR94638.1|1548546_1548873_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYR94639.1|1548872_1549184_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYR94640.1|1549183_1549729_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYR94641.1|1549725_1551321_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYR94642.1|1551320_1552817_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYR94643.1|1552797_1553619_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYR94644.1|1553621_1554080_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYR94645.1|1554294_1555410_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYR94646.1|1555424_1556378_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYR94647.1|1556387_1556726_+	hypothetical protein	NA	NA	NA	NA	NA
AYR94648.1|1556727_1557174_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYR94649.1|1557173_1557638_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYR94650.1|1557634_1557889_+	hypothetical protein	NA	NA	NA	NA	NA
AYR94651.1|1557878_1559306_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYR94652.1|1559305_1559827_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYR94653.1|1559829_1560111_+	hypothetical protein	NA	NA	NA	NA	NA
AYR94654.1|1560208_1560544_+	hypothetical protein	NA	NA	NA	NA	NA
AYR94655.1|1560719_1563185_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYR94656.1|1563184_1564069_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYR94657.1|1564065_1564281_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYR94658.1|1564268_1565423_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYR94659.1|1565419_1565947_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYR94660.1|1566003_1566351_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYR94661.1|1566341_1567445_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYR94662.1|1567437_1568016_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYR94663.1|1568018_1569044_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYR94664.1|1569095_1569530_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	44.9	1.3e-23
AYR94665.1|1569529_1570147_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYR94666.1|1571657_1572230_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYR94667.1|1572510_1573893_+	amino acid permease	NA	NA	NA	NA	NA
AYR94668.1|1573954_1574290_-	hypothetical protein	NA	NA	NA	NA	NA
AYR94669.1|1574416_1575148_+	two-component response regulator	NA	NA	NA	NA	NA
AYR94670.1|1575628_1576780_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYR94671.1|1576932_1578639_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYR94672.1|1578746_1580051_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYR94673.1|1580126_1581056_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYR94674.1|1581052_1582456_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYR94675.1|1582623_1584270_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYR94676.1|1584469_1585645_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYR94677.1|1585747_1587256_+	hypothetical protein	NA	NA	NA	NA	NA
AYR94678.1|1587961_1588963_+	adenosine deaminase	NA	NA	NA	NA	NA
AYR94679.1|1589036_1590152_-	oxidoreductase	NA	NA	NA	NA	NA
AYR94680.1|1590254_1590410_+	hypothetical protein	NA	NA	NA	NA	NA
AYR94681.1|1590708_1590924_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYR94682.1|1591012_1591453_+	hypothetical protein	NA	NA	NA	NA	NA
AYR94683.1|1591529_1592111_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYR94684.1|1592110_1592689_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYR94685.1|1592681_1594703_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYR94686.1|1594703_1595762_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYR94687.1|1595765_1596386_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYR94688.1|1596388_1597081_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYR94689.1|1597080_1597716_+	endonuclease III	NA	NA	NA	NA	NA
AYR94690.1|1598316_1599822_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYR94691.1|1599926_1600532_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYR94692.1|1601280_1602555_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029944	Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 chromosome, complete genome	4784815	1783592	1788004	4784815		Escherichia_phage(50.0%)	6	NA	NA
AYR94876.1|1783592_1783832_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYR94877.1|1784704_1785514_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYR94878.1|1785586_1785964_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYR94879.1|1786111_1786654_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYR94880.1|1786845_1787574_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYR94881.1|1787590_1788004_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029944	Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 chromosome, complete genome	4784815	1991857	1999091	4784815		Morganella_phage(33.33%)	7	NA	NA
AYR95071.1|1991857_1993288_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYR95072.1|1993361_1994057_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYR95073.1|1994136_1994448_-	hypothetical protein	NA	NA	NA	NA	NA
AYR95074.1|1995098_1996283_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYR95075.1|1996742_1996955_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYR95076.1|1997400_1998669_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYR95077.1|1998671_1999091_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029944	Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 chromosome, complete genome	4784815	2105392	2115899	4784815		Enterobacteria_phage(37.5%)	10	NA	NA
AYR95174.1|2105392_2106706_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYR95175.1|2106732_2107812_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYR95176.1|2107816_2108590_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYR95177.1|2108605_2109580_-	reductase RfbI	NA	NA	NA	NA	NA
AYR95178.1|2109585_2110137_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYR95179.1|2110137_2111016_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYR95180.1|2111063_2111963_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYR95181.1|2111962_2113048_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYR95182.1|2113424_2114318_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYR95183.1|2114495_2115899_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029944	Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 chromosome, complete genome	4784815	2193128	2202299	4784815	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYR95243.1|2193128_2195162_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYR95244.1|2195402_2195861_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYR95245.1|2196032_2196563_+	lipoprotein	NA	NA	NA	NA	NA
AYR95246.1|2196619_2197087_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYR95247.1|2197133_2197853_-	two-component system response regulator	NA	NA	NA	NA	NA
AYR95248.1|2197849_2199535_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYR95249.1|2199757_2200489_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYR95250.1|2200548_2200656_+	hypothetical protein	NA	NA	NA	NA	NA
AYR95251.1|2200636_2201368_-	ABC transporter permease	NA	NA	NA	NA	NA
AYR95252.1|2201351_2202299_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029944	Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 chromosome, complete genome	4784815	2737799	2751191	4784815	tail	Salmonella_phage(70.0%)	11	NA	NA
AYR95682.1|2737799_2738018_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYR95683.1|2738108_2739209_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYR95684.1|2739205_2739691_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYR95685.1|2739687_2742765_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYR95686.1|2742757_2742877_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYR95687.1|2742891_2743194_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYR95688.1|2743248_2743764_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYR95689.1|2743773_2744946_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYR95690.1|2745088_2745661_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYR95691.1|2746338_2747454_+	glycosyltransferase	NA	NA	NA	NA	NA
AYR95692.1|2747534_2751191_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029944	Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 chromosome, complete genome	4784815	3068352	3112055	4784815	tRNA,bacteriocin,transposase,protease	Bacillus_virus(33.33%)	44	NA	NA
AYR95980.1|3068352_3068811_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR95981.1|3069000_3070080_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYR95982.1|3070181_3071345_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYR95983.1|3071366_3072413_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYR95984.1|3072786_3073212_+	hypothetical protein	NA	NA	NA	NA	NA
AYR95985.1|3073237_3073816_+	hypothetical protein	NA	NA	NA	NA	NA
AYR95986.1|3073849_3074524_+	hypothetical protein	NA	NA	NA	NA	NA
AYR95987.1|3074505_3075189_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYR95988.1|3075182_3075839_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYR95989.1|3075943_3076402_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR95990.1|3076590_3078582_-	transketolase	NA	NA	NA	NA	NA
AYR95991.1|3078857_3079616_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYR95992.1|3079716_3080637_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYR95993.1|3080864_3082841_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYR95994.1|3082849_3082981_-	hypothetical protein	NA	NA	NA	NA	NA
AYR95995.1|3083275_3083575_-	membrane protein	NA	NA	NA	NA	NA
AYR95996.1|3083630_3084785_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYR95997.1|3085277_3086672_+	galactose-proton symport	NA	NA	NA	NA	NA
AYR95998.1|3086750_3087248_+	hypothetical protein	NA	NA	NA	NA	NA
AYR95999.1|3087343_3088051_+	endonuclease I	NA	NA	NA	NA	NA
AYR96000.1|3088127_3088859_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYR96001.1|3088878_3089826_+	glutathione synthetase	NA	NA	NA	NA	NA
AYR96002.1|3090041_3090605_+	hypothetical protein	NA	NA	NA	NA	NA
AYR96003.1|3090604_3091021_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYR96004.1|3091067_3091754_-	global regulatory protein	NA	NA	NA	NA	NA
AYR96005.1|3091883_3092864_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYR96006.1|3092881_3093586_+	hypothetical protein	NA	NA	NA	NA	NA
AYR96007.1|3093604_3094171_+	hypothetical protein	NA	NA	NA	NA	NA
AYR96008.1|3094167_3094458_+	hypothetical protein	NA	NA	NA	NA	NA
AYR96009.1|3094465_3095059_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYR96010.1|3095051_3096188_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYR96011.1|3096278_3097286_-	hypothetical protein	NA	NA	NA	NA	NA
AYR96012.1|3097418_3098465_-	L-asparaginase	NA	NA	NA	NA	NA
AYR96013.1|3098783_3099242_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR96014.1|3099364_3100084_-	hypothetical protein	NA	NA	NA	NA	NA
AYR96015.1|3100133_3100460_-	hypothetical protein	NA	NA	NA	NA	NA
AYR96016.1|3100459_3101179_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYR96017.1|3101333_3102386_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYR96018.1|3102413_3102689_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYR96019.1|3102801_3103887_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYR96020.1|3104103_3105360_+	nucleoside permease	NA	NA	NA	NA	NA
AYR96021.1|3107970_3108678_+	hypothetical protein	NA	NA	NA	NA	NA
AYR96022.1|3111267_3111534_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYR96023.1|3111776_3112055_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029944	Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 chromosome, complete genome	4784815	3489378	3527436	4784815	transposase,capsid,portal,plate,integrase,terminase,tail	Salmonella_phage(82.05%)	46	3484342:3484356	3496508:3496522
3484342:3484356	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYR96351.1|3489378_3491025_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYR96352.1|3491164_3491263_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYR96353.1|3491518_3491848_+	hypothetical protein	NA	NA	NA	NA	NA
AYR96354.1|3491888_3492941_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYR96355.1|3493336_3493906_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYR96356.1|3494031_3494253_+	hypothetical protein	NA	NA	NA	NA	NA
AYR96357.1|3494285_3494795_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYR96358.1|3494969_3495194_+	hypothetical protein	NA	NA	NA	NA	NA
AYR96359.1|3495216_3495558_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYR96360.1|3495625_3495859_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYR96361.1|3495858_3496086_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYR96362.1|3496082_3496940_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3496508:3496522	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYR96363.1|3496936_3499351_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYR96364.1|3499504_3499693_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYR96365.1|3501660_3502575_+	hypothetical protein	NA	NA	NA	NA	NA
AYR96366.1|3502571_3503312_+	hypothetical protein	NA	NA	NA	NA	NA
AYR96367.1|3503346_3504384_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYR96368.1|3504383_3506150_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYR96369.1|3506292_3507126_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYR96370.1|3507142_3508201_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYR96371.1|3508204_3508855_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYR96372.1|3508887_3509415_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYR96373.1|3509414_3509618_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYR96374.1|3509621_3509837_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYR96375.1|3509856_3510330_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYR96376.1|3510331_3510709_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYR96377.1|3510705_3511134_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYR96378.1|3511229_3511661_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYR96379.1|3511653_3512100_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYR96380.1|3512168_3512747_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYR96381.1|3512743_3513103_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYR96382.1|3513089_3513998_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYR96383.1|3513990_3514596_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYR96384.1|3514592_3516107_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYR96385.1|3516106_3516700_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYR96386.1|3516671_3517112_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYR96387.1|3517534_3518107_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYR96388.1|3518249_3519422_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYR96389.1|3519431_3519947_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYR96390.1|3520001_3520304_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYR96391.1|3520318_3520438_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYR96392.1|3520430_3523508_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYR96393.1|3523504_3523990_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYR96394.1|3523986_3525087_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYR96395.1|3525177_3525396_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYR96396.1|3526977_3527436_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029944	Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 chromosome, complete genome	4784815	4443130	4517387	4784815	capsid,portal,plate,integrase,terminase,tail	Salmonella_phage(82.98%)	76	4504631:4504647	4517546:4517562
AYR97168.1|4443130_4445080_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYR97169.1|4445151_4446060_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97170.1|4446133_4447033_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97171.1|4447074_4447434_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97172.1|4447533_4447803_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97173.1|4447934_4449209_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYR97174.1|4449428_4449806_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97175.1|4449892_4450111_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYR97176.1|4450178_4451279_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYR97177.1|4451275_4451761_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYR97178.1|4451760_4454541_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYR97179.1|4454533_4454653_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYR97180.1|4454667_4454970_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYR97181.1|4455024_4455540_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYR97182.1|4455549_4456722_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYR97183.1|4457256_4457979_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYR97184.1|4458176_4458584_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYR97185.1|4458590_4460210_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYR97186.1|4460206_4460812_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYR97187.1|4460804_4461713_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYR97188.1|4461699_4462059_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYR97189.1|4462055_4462634_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYR97190.1|4462702_4463149_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYR97191.1|4463141_4463573_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYR97192.1|4463668_4464094_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYR97193.1|4464093_4464471_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYR97194.1|4464475_4464946_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYR97195.1|4464965_4465181_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYR97196.1|4465184_4465388_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYR97197.1|4465387_4465852_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYR97198.1|4465945_4466596_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYR97199.1|4466599_4467664_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYR97200.1|4467680_4468514_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYR97201.1|4468656_4470423_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYR97202.1|4470419_4471466_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYR97203.1|4471514_4472210_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97204.1|4472229_4473294_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97205.1|4473290_4474355_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97206.1|4475279_4475609_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYR97207.1|4475605_4477675_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYR97208.1|4477665_4478526_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYR97209.1|4478522_4479107_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYR97210.1|4479103_4479331_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYR97211.1|4479330_4479564_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYR97212.1|4479631_4479973_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYR97213.1|4479936_4480137_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYR97214.1|4480144_4480654_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYR97215.1|4480686_4480929_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYR97216.1|4481045_4481678_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYR97217.1|4481681_4482707_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYR97218.1|4482813_4483167_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYR97219.1|4483783_4484071_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97220.1|4484081_4484972_+	methyltransferase	NA	NA	NA	NA	NA
AYR97221.1|4484971_4485718_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97222.1|4486019_4487990_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYR97223.1|4488009_4489314_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYR97224.1|4489336_4490032_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYR97225.1|4490057_4490852_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYR97226.1|4490861_4491929_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYR97227.1|4491973_4493710_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYR97228.1|4493709_4496205_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYR97229.1|4496228_4497275_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYR97230.1|4497277_4498555_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYR97231.1|4498799_4499339_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYR97232.1|4500192_4501704_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYR97233.1|4501687_4503277_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97234.1|4503440_4504454_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4504631:4504647	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYR97235.1|4504880_4505174_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97236.1|4505170_4505659_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97237.1|4505838_4506291_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97238.1|4511513_4511975_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97239.1|4511971_4512193_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYR97240.1|4513049_4513832_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97241.1|4514458_4514683_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97242.1|4514812_4515817_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYR97243.1|4516127_4517387_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4517546:4517562	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029944	Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 chromosome, complete genome	4784815	4659639	4669898	4784815	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYR97380.1|4659639_4660716_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYR97381.1|4660712_4661786_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYR97382.1|4661760_4662924_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97383.1|4663199_4663766_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYR97384.1|4663781_4664021_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYR97385.1|4664024_4664885_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYR97386.1|4665307_4665631_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYR97387.1|4665614_4666115_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYR97388.1|4666111_4666339_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97389.1|4666335_4666656_+	P4 phage protein	NA	NA	NA	NA	NA
AYR97390.1|4666670_4667345_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYR97391.1|4667341_4669003_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYR97392.1|4669739_4669898_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029943	Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence	217072	3612	57130	217072	holin,transposase	Escherichia_phage(43.75%)	56	NA	NA
AYR93047.1|3612_3888_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR93048.1|3806_4310_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	6.3e-94
AYR93049.1|4636_4861_-	hypothetical protein	NA	NA	NA	NA	NA
AYR93050.1|5516_5777_-	hypothetical protein	NA	NA	NA	NA	NA
AYR93051.1|5865_6357_-	hypothetical protein	NA	NA	NA	NA	NA
AYR93052.1|6361_6670_-	hypothetical protein	NA	NA	NA	NA	NA
AYR93053.1|6877_7258_-	hypothetical protein	NA	NA	NA	NA	NA
AYR93054.1|7343_7592_-	hypothetical protein	NA	NA	NA	NA	NA
AYR93055.1|7629_7851_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	8.2e-06
AYR93056.1|8013_8397_-	hypothetical protein	NA	NA	NA	NA	NA
AYR93057.1|8711_8936_-	hypothetical protein	NA	NA	NA	NA	NA
AYR93058.1|9022_9487_-	hypothetical protein	NA	NA	NA	NA	NA
AYR93059.1|9669_12099_-	hypothetical protein	NA	NA	NA	NA	NA
AYR93060.1|12221_12668_-	hypothetical protein	NA	NA	NA	NA	NA
AYR93061.1|12715_13522_-	hypothetical protein	NA	NA	NA	NA	NA
AYR93062.1|13749_13992_-	hypothetical protein	NA	NA	NA	NA	NA
AYR93063.1|14069_14402_-	hypothetical protein	NA	NA	NA	NA	NA
AYR93064.1|14901_16083_-	hypothetical protein	NA	NA	NA	NA	NA
AYR93065.1|16091_16388_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
AYR93066.1|16451_16919_-	hypothetical protein	NA	NA	NA	NA	NA
AYR93067.1|17778_18555_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93068.1|18704_19481_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93069.1|19669_20011_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93070.1|20111_20375_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.1e-08
AYR93071.1|20608_21307_+	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	4.2e-11
AYR93072.1|21461_21758_-	hypothetical protein	NA	NA	NA	NA	NA
AYR93073.1|21845_24230_-	periplasmic protein	NA	NA	NA	NA	NA
AYR93074.1|24480_25089_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93075.1|25201_25498_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93076.1|25502_26099_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93077.1|26490_27372_+	replication protein	NA	J9Q7H0	Salmonella_phage	41.3	6.5e-54
AYR93078.1|27957_28473_-	hypothetical protein	NA	NA	NA	NA	NA
AYR93079.1|29123_31580_-	periplasmic protein	NA	NA	NA	NA	NA
AYR93080.1|32216_33971_-	DNA restriction methylase	NA	J9Q747	Salmonella_phage	30.9	1.1e-68
AYR93081.1|34156_35314_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.1e-19
AYR93082.1|35673_36498_+	DNA modification methylase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
AYR93083.1|36512_37334_-	hypothetical protein	NA	NA	NA	NA	NA
AYR93084.1|37616_38324_-	hypothetical protein	NA	NA	NA	NA	NA
AYR93085.1|38538_39615_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
AYR93086.1|40149_41025_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
AYR93087.1|41278_41860_-	hypothetical protein	NA	NA	NA	NA	NA
AYR93088.1|42466_42820_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93089.1|42871_43189_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93090.1|43188_43986_+	pilus assembly protein	NA	NA	NA	NA	NA
AYR93091.1|43988_45221_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93092.1|45222_45663_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93093.1|45640_47011_+	TrhB	NA	NA	NA	NA	NA
AYR93094.1|47019_47532_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93095.1|47532_48390_+	plasmid transfer protein	NA	NA	NA	NA	NA
AYR93096.1|48399_49350_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93097.1|49358_52040_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93098.1|52673_52949_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	93.4	1.9e-44
AYR93099.1|53077_55081_+|holin	transporter, betaine/carnitine/choline family	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AYR93100.1|55143_56439_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93101.1|56432_56936_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR93102.1|56854_57130_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
>prophage 2
CP029943	Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence	217072	82010	134573	217072	integrase,transposase	Escherichia_phage(50.0%)	63	106914:106928	131414:131428
AYR93122.1|82010_82514_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR93123.1|82432_82708_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR93124.1|82749_84606_+	hypothetical protein	NA	S5MMD7	Bacillus_phage	26.4	2.2e-19
AYR93125.1|85003_85879_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93126.1|85937_86315_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93127.1|86375_87362_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93128.1|87421_88474_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93129.1|88512_88782_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93130.1|88852_89980_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93131.1|90057_92070_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93132.1|92141_92363_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93133.1|92477_93710_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
AYR93134.1|93984_94509_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93135.1|94499_95465_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93136.1|95535_96471_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93137.1|96548_97469_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93138.1|97541_98477_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93139.1|98653_99610_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93140.1|100022_100292_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93141.1|100346_100937_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93142.1|100944_101202_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93143.1|101275_101812_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93144.1|101828_102284_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93145.1|102267_102495_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93146.1|102543_102798_-	hypothetical protein	NA	NA	NA	NA	NA
AYR93147.1|102865_103825_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93148.1|103835_104744_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93149.1|105048_106230_-	recombinase	NA	NA	NA	NA	NA
AYR93150.1|106444_106657_+	regulatory protein	NA	NA	NA	NA	NA
106914:106928	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYR93151.1|106963_107239_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	7.7e-46
106914:106928	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYR93152.1|107157_107661_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR93153.1|107767_108202_-	transcriptional regulator MerR	NA	NA	NA	NA	NA
AYR93154.1|108219_108624_+	MerT	NA	NA	NA	NA	NA
AYR93155.1|108637_108913_+	mercuric transport protein	NA	NA	NA	NA	NA
AYR93156.1|108948_109371_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AYR93157.1|109422_111117_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYR93158.1|111134_111497_+	transcriptional regulator MerD	NA	NA	NA	NA	NA
AYR93159.1|111493_111730_+	mercury resistance protein	NA	NA	NA	NA	NA
AYR93160.1|111726_112434_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93161.1|112472_113777_+|integrase	integrase	integrase	NA	NA	NA	NA
AYR93162.1|113805_114528_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR93163.1|115283_116135_+	replication protein	NA	NA	NA	NA	NA
AYR93164.1|116442_117258_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AYR93165.1|117318_118122_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYR93166.1|118121_118958_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYR93167.1|119018_119741_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR93168.1|120320_121181_-	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
120775:120789	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYR93169.1|121363_121630_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
120775:120789	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYR93170.1|121662_122385_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR93171.1|122618_123545_-	sulfonamide-resistant dihydropteroate synthase sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	7.2e-11
AYR93172.1|123451_123832_-	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYR93173.1|124028_124628_-	dihydrofolate reductase	NA	A0A1B2IAU3	Erwinia_phage	32.8	5.3e-15
AYR93174.1|124659_125673_+|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYR93175.1|125662_126226_+	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYR93176.1|126351_126912_+	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYR93177.1|126914_129881_+|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYR93178.1|129947_130325_+	hypothetical protein	NA	NA	NA	NA	NA
AYR93179.1|130525_131185_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AYR93180.1|131463_131739_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR93181.1|131657_132161_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	1.1e-93
AYR93182.1|132742_133498_+	replication protein	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
AYR93183.1|133875_134151_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR93184.1|134069_134573_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	92.8	1.4e-88
