The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029936	Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 chromosome, complete genome	4783243	930035	937347	4783243	integrase,protease	Dickeya_phage(16.67%)	6	931286:931300	942465:942479
AYR98507.1|930035_931154_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYR98508.1|931150_933097_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931286:931300	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYR98509.1|933226_933448_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYR98510.1|933771_934092_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYR98511.1|934122_936399_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYR98512.1|936969_937347_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942465:942479	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029936	Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 chromosome, complete genome	4783243	1008251	1085563	4783243	protease,integrase,transposase,terminase,tail	Salmonella_phage(73.33%)	93	990317:990336	1060924:1060943
990317:990336	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYR98562.1|1008251_1009592_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYR98563.1|1009588_1009837_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYR98564.1|1009877_1010123_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYR98565.1|1010122_1011004_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYR98566.1|1011000_1012065_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYR98567.1|1012142_1012823_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYR98568.1|1012819_1013605_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYR98569.1|1013610_1013907_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYR98570.1|1013997_1014198_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYR98571.1|1014486_1014891_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYR98572.1|1015222_1015597_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYR98573.1|1015681_1016665_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYR98574.1|1016667_1017417_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYR98575.1|1017427_1017775_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYR98576.1|1017771_1018296_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYR98577.1|1018295_1018769_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYR98578.1|1018772_1019345_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYR98579.1|1019438_1019705_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYR98580.1|1019786_1019948_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR98581.1|1020380_1020878_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR98582.1|1021062_1021302_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYR98583.1|1021291_1021597_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYR98584.1|1021636_1022239_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYR98585.1|1022447_1023059_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYR98586.1|1023191_1023989_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYR98587.1|1024387_1024513_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR98588.1|1024648_1025098_-	lipoprotein	NA	NA	NA	NA	NA
AYR98589.1|1025314_1025704_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYR98590.1|1025690_1025972_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYR98591.1|1025971_1026586_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYR98592.1|1026804_1027059_+	hypothetical protein	NA	NA	NA	NA	NA
AYR98593.1|1027163_1027541_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYR98594.1|1027604_1027865_+	hypothetical protein	NA	NA	NA	NA	NA
AYR98595.1|1027954_1028707_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYR98596.1|1028672_1030076_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYR98597.1|1030075_1031545_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYR98598.1|1031636_1032167_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYR98599.1|1032181_1033414_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYR98600.1|1033418_1033916_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYR98601.1|1033927_1034869_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYR98602.1|1034910_1035279_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYR98603.1|1035244_1035652_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYR98604.1|1035648_1036203_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYR98605.1|1036189_1036579_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYR98606.1|1036553_1037117_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYR98607.1|1037120_1038266_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYR98608.1|1038277_1038718_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYR98609.1|1038721_1039174_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYR98610.1|1039351_1041304_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYR98611.1|1041303_1041954_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYR98612.1|1041957_1042260_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYR98613.1|1042262_1043294_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYR98614.1|1043290_1043626_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYR98615.1|1043820_1044552_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR98616.1|1044551_1044980_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR98617.1|1045038_1045794_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYR98618.1|1045881_1046019_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYR98619.1|1046034_1046388_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYR98620.1|1046388_1047588_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYR98621.1|1047584_1048265_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYR98622.1|1048264_1049776_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYR98623.1|1049790_1050309_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYR98624.1|1051230_1051932_-	hypothetical protein	NA	NA	NA	NA	NA
AYR98625.1|1052244_1052523_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYR98626.1|1052948_1055561_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYR98627.1|1055768_1056779_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYR98628.1|1056941_1057487_+	hypothetical protein	NA	NA	NA	NA	NA
AYR98629.1|1057483_1058593_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYR98630.1|1058691_1060800_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYR98631.1|1060812_1062720_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1060924:1060943	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYR98632.1|1062734_1063988_+	inner membrane protein	NA	NA	NA	NA	NA
AYR98633.1|1063992_1065633_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYR98634.1|1065629_1066193_+	lipoprotein	NA	NA	NA	NA	NA
AYR98635.1|1066446_1066614_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYR98636.1|1066713_1067232_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYR98637.1|1067300_1069061_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYR98638.1|1069246_1069699_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYR98639.1|1069770_1070823_-	outer membrane protein A	NA	NA	NA	NA	NA
AYR98640.1|1071177_1071687_-	cell division inhibitor	NA	NA	NA	NA	NA
AYR98641.1|1071903_1072509_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYR98642.1|1072495_1074649_-	inner membrane protein	NA	NA	NA	NA	NA
AYR98643.1|1074667_1075114_-	hypothetical protein	NA	NA	NA	NA	NA
AYR98644.1|1075237_1077292_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYR98645.1|1077327_1077786_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYR98646.1|1077880_1078543_-	hypothetical protein	NA	NA	NA	NA	NA
AYR98647.1|1078713_1079130_+	hypothetical protein	NA	NA	NA	NA	NA
AYR98648.1|1079174_1079492_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYR98649.1|1079549_1080761_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYR98650.1|1081892_1082351_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR98651.1|1083087_1083369_+	acylphosphatase	NA	NA	NA	NA	NA
AYR98652.1|1083365_1083695_-	sulfite reductase	NA	NA	NA	NA	NA
AYR98653.1|1083781_1084441_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYR98654.1|1085104_1085563_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029936	Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 chromosome, complete genome	4783243	1528745	1602343	4783243	head,protease,tRNA,transposase,plate,tail	Burkholderia_virus(44.12%)	72	NA	NA
AYR99054.1|1528745_1529204_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR99055.1|1529706_1529988_+	stress response protein	NA	NA	NA	NA	NA
AYR99056.1|1530256_1531078_+|protease	serine protease	protease	NA	NA	NA	NA
AYR99057.1|1531112_1531442_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYR99058.1|1531428_1531791_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYR99059.1|1531902_1532073_-	hypothetical protein	NA	NA	NA	NA	NA
AYR99060.1|1532207_1533242_+	hypothetical protein	NA	NA	NA	NA	NA
AYR99061.1|1533416_1534805_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYR99062.1|1534815_1536345_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYR99063.1|1536871_1537816_+	hypothetical protein	NA	NA	NA	NA	NA
AYR99064.1|1537997_1538387_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYR99065.1|1538358_1538811_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYR99066.1|1539005_1539236_-	hypothetical protein	NA	NA	NA	NA	NA
AYR99067.1|1539232_1539916_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYR99068.1|1540500_1540803_-	hypothetical protein	NA	NA	NA	NA	NA
AYR99069.1|1541373_1541904_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYR99070.1|1542203_1543370_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYR99071.1|1543380_1545150_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYR99072.1|1546594_1546945_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYR99073.1|1547659_1548310_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYR99074.1|1548632_1548944_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYR99075.1|1548943_1549489_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYR99076.1|1549485_1551081_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYR99077.1|1551080_1552577_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYR99078.1|1552557_1553379_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYR99079.1|1553381_1553840_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYR99080.1|1554054_1555170_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYR99081.1|1555184_1556138_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYR99082.1|1556147_1556486_+	hypothetical protein	NA	NA	NA	NA	NA
AYR99083.1|1556487_1556934_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYR99084.1|1556933_1557398_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYR99085.1|1557638_1559066_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYR99086.1|1559065_1559587_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYR99087.1|1559589_1559871_+	hypothetical protein	NA	NA	NA	NA	NA
AYR99088.1|1559968_1560304_+	hypothetical protein	NA	NA	NA	NA	NA
AYR99089.1|1560479_1562945_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYR99090.1|1562944_1563829_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYR99091.1|1563825_1564041_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYR99092.1|1564028_1565183_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYR99093.1|1565179_1565707_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYR99094.1|1565763_1566111_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYR99095.1|1566101_1567205_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYR99096.1|1567197_1567776_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYR99097.1|1567778_1568804_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYR99098.1|1569317_1569935_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYR99099.1|1571445_1572018_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYR99100.1|1572298_1573681_+	amino acid permease	NA	NA	NA	NA	NA
AYR99101.1|1573742_1574078_-	hypothetical protein	NA	NA	NA	NA	NA
AYR99102.1|1574204_1574936_+	two-component response regulator	NA	NA	NA	NA	NA
AYR99103.1|1575416_1576568_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYR99104.1|1576720_1578427_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYR99105.1|1578534_1579839_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYR99106.1|1579914_1580844_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYR99107.1|1580840_1582244_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYR99108.1|1582411_1584058_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYR99109.1|1584257_1585433_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYR99110.1|1585535_1587044_+	hypothetical protein	NA	NA	NA	NA	NA
AYR99111.1|1587749_1588751_+	adenosine deaminase	NA	NA	NA	NA	NA
AYR99112.1|1588824_1589940_-	oxidoreductase	NA	NA	NA	NA	NA
AYR99113.1|1590042_1590198_+	hypothetical protein	NA	NA	NA	NA	NA
AYR99114.1|1590496_1590712_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYR99115.1|1590800_1591241_+	hypothetical protein	NA	NA	NA	NA	NA
AYR99116.1|1591317_1591899_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYR99117.1|1591898_1592477_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYR99118.1|1592469_1594491_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYR99119.1|1594491_1595550_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYR99120.1|1595553_1596174_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYR99121.1|1596176_1596869_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYR99122.1|1596868_1597504_+	endonuclease III	NA	NA	NA	NA	NA
AYR99123.1|1598104_1599610_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYR99124.1|1599714_1600320_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYR99125.1|1601068_1602343_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029936	Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 chromosome, complete genome	4783243	1783380	1787792	4783243		Escherichia_phage(50.0%)	6	NA	NA
AYR99309.1|1783380_1783620_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYR99310.1|1784492_1785302_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYR99311.1|1785374_1785752_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYR99312.1|1785899_1786442_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYR99313.1|1786633_1787362_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYR99314.1|1787378_1787792_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029936	Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 chromosome, complete genome	4783243	1991645	1998879	4783243		Morganella_phage(33.33%)	7	NA	NA
AYR99504.1|1991645_1993076_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYR99505.1|1993149_1993845_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYR99506.1|1993924_1994236_-	hypothetical protein	NA	NA	NA	NA	NA
AYR99507.1|1994886_1996071_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYR99508.1|1996530_1996743_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYR99509.1|1997188_1998457_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYR99510.1|1998459_1998879_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029936	Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 chromosome, complete genome	4783243	2105180	2115687	4783243		Enterobacteria_phage(37.5%)	10	NA	NA
AYR99607.1|2105180_2106494_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYR99608.1|2106520_2107600_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYR99609.1|2107604_2108378_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYR99610.1|2108393_2109368_-	reductase RfbI	NA	NA	NA	NA	NA
AYR99611.1|2109373_2109925_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYR99612.1|2109925_2110804_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYR99613.1|2110851_2111751_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYR99614.1|2111750_2112836_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYR99615.1|2113212_2114106_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYR99616.1|2114283_2115687_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029936	Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 chromosome, complete genome	4783243	2192916	2202087	4783243	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYR99676.1|2192916_2194950_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYR99677.1|2195190_2195649_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYR99678.1|2195820_2196351_+	lipoprotein	NA	NA	NA	NA	NA
AYR99679.1|2196407_2196875_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYR99680.1|2196921_2197641_-	two-component system response regulator	NA	NA	NA	NA	NA
AYR99681.1|2197637_2199323_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYR99682.1|2199545_2200277_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYR99683.1|2200336_2200444_+	hypothetical protein	NA	NA	NA	NA	NA
AYR99684.1|2200424_2201156_-	ABC transporter permease	NA	NA	NA	NA	NA
AYR99685.1|2201139_2202087_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029936	Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 chromosome, complete genome	4783243	2737394	2750786	4783243	tail	Salmonella_phage(70.0%)	11	NA	NA
AYS00115.1|2737394_2737613_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYS00116.1|2737703_2738804_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS00117.1|2738800_2739286_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS00118.1|2739282_2742360_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS00119.1|2742352_2742472_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS00120.1|2742486_2742789_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS00121.1|2742843_2743359_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS00122.1|2743368_2744541_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS00123.1|2744683_2745256_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS00124.1|2745933_2747049_+	glycosyltransferase	NA	NA	NA	NA	NA
AYS00125.1|2747129_2750786_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029936	Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 chromosome, complete genome	4783243	3068146	3111849	4783243	bacteriocin,transposase,protease,tRNA	Bacillus_virus(33.33%)	44	NA	NA
AYS00412.1|3068146_3068605_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS00413.1|3068794_3069874_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYS00414.1|3069975_3071139_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYS00415.1|3071160_3072207_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYS00416.1|3072580_3073006_+	hypothetical protein	NA	NA	NA	NA	NA
AYS00417.1|3073031_3073610_+	hypothetical protein	NA	NA	NA	NA	NA
AYS00418.1|3073643_3074318_+	hypothetical protein	NA	NA	NA	NA	NA
AYS00419.1|3074299_3074983_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYS00420.1|3074976_3075633_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYS00421.1|3075737_3076196_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS00422.1|3076384_3078376_-	transketolase	NA	NA	NA	NA	NA
AYS00423.1|3078651_3079410_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYS00424.1|3079510_3080431_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYS00425.1|3080658_3082635_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYS00426.1|3082643_3082775_-	hypothetical protein	NA	NA	NA	NA	NA
AYS00427.1|3083069_3083369_-	membrane protein	NA	NA	NA	NA	NA
AYS00428.1|3083424_3084579_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYS00429.1|3085071_3086466_+	galactose-proton symport	NA	NA	NA	NA	NA
AYS00430.1|3086544_3087042_+	hypothetical protein	NA	NA	NA	NA	NA
AYS00431.1|3087137_3087845_+	endonuclease I	NA	NA	NA	NA	NA
AYS00432.1|3087921_3088653_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYS00433.1|3088672_3089620_+	glutathione synthetase	NA	NA	NA	NA	NA
AYS00434.1|3089835_3090399_+	hypothetical protein	NA	NA	NA	NA	NA
AYS00435.1|3090398_3090815_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYS00436.1|3090861_3091548_-	global regulatory protein	NA	NA	NA	NA	NA
AYS00437.1|3091677_3092658_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYS00438.1|3092675_3093380_+	hypothetical protein	NA	NA	NA	NA	NA
AYS00439.1|3093398_3093965_+	hypothetical protein	NA	NA	NA	NA	NA
AYS00440.1|3093961_3094252_+	hypothetical protein	NA	NA	NA	NA	NA
AYS00441.1|3094259_3094853_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYS00442.1|3094845_3095982_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYS00443.1|3096072_3097080_-	hypothetical protein	NA	NA	NA	NA	NA
AYS00444.1|3097212_3098259_-	L-asparaginase	NA	NA	NA	NA	NA
AYS00445.1|3098577_3099036_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS00446.1|3099158_3099878_-	hypothetical protein	NA	NA	NA	NA	NA
AYS00447.1|3099927_3100254_-	hypothetical protein	NA	NA	NA	NA	NA
AYS00448.1|3100253_3100973_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYS00449.1|3101127_3102180_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYS00450.1|3102207_3102483_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYS00451.1|3102595_3103681_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYS00452.1|3103897_3105154_+	nucleoside permease	NA	NA	NA	NA	NA
AYS00453.1|3107764_3108472_+	hypothetical protein	NA	NA	NA	NA	NA
AYS00454.1|3111061_3111328_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYS00455.1|3111570_3111849_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029936	Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 chromosome, complete genome	4783243	3489168	3527226	4783243	capsid,integrase,transposase,terminase,plate,tail,portal	Salmonella_phage(82.05%)	46	3484132:3484146	3496298:3496312
3484132:3484146	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYS00783.1|3489168_3490815_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYS00784.1|3490954_3491053_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYS00785.1|3491308_3491638_+	hypothetical protein	NA	NA	NA	NA	NA
AYS00786.1|3491678_3492731_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYS00787.1|3493126_3493696_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYS00788.1|3493821_3494043_+	hypothetical protein	NA	NA	NA	NA	NA
AYS00789.1|3494075_3494585_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYS00790.1|3494759_3494984_+	hypothetical protein	NA	NA	NA	NA	NA
AYS00791.1|3495006_3495348_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYS00792.1|3495415_3495649_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYS00793.1|3495648_3495876_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYS00794.1|3495872_3496730_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3496298:3496312	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYS00795.1|3496726_3499141_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYS00796.1|3499294_3499483_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYS00797.1|3501450_3502365_+	hypothetical protein	NA	NA	NA	NA	NA
AYS00798.1|3502361_3503102_+	hypothetical protein	NA	NA	NA	NA	NA
AYS00799.1|3503136_3504174_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYS00800.1|3504173_3505940_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYS00801.1|3506082_3506916_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYS00802.1|3506932_3507991_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYS00803.1|3507994_3508645_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYS00804.1|3508677_3509205_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYS00805.1|3509204_3509408_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYS00806.1|3509411_3509627_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYS00807.1|3509646_3510120_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYS00808.1|3510121_3510499_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYS00809.1|3510495_3510924_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYS00810.1|3511019_3511451_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYS00811.1|3511443_3511890_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYS00812.1|3511958_3512537_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYS00813.1|3512533_3512893_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYS00814.1|3512879_3513788_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYS00815.1|3513780_3514386_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS00816.1|3514382_3515897_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYS00817.1|3515896_3516490_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYS00818.1|3516461_3516902_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYS00819.1|3517324_3517897_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS00820.1|3518039_3519212_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS00821.1|3519221_3519737_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS00822.1|3519791_3520094_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS00823.1|3520108_3520228_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS00824.1|3520220_3523298_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS00825.1|3523294_3523780_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS00826.1|3523776_3524877_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS00827.1|3524967_3525186_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYS00828.1|3526767_3527226_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029936	Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 chromosome, complete genome	4783243	4442845	4517195	4783243	capsid,integrase,terminase,plate,portal,tail	Salmonella_phage(82.98%)	76	4504346:4504362	4517354:4517370
AYS01599.1|4442845_4444795_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYS01600.1|4444866_4445775_+	hypothetical protein	NA	NA	NA	NA	NA
AYS01601.1|4445848_4446748_+	hypothetical protein	NA	NA	NA	NA	NA
AYS01602.1|4446789_4447149_+	hypothetical protein	NA	NA	NA	NA	NA
AYS01603.1|4447248_4447518_-	hypothetical protein	NA	NA	NA	NA	NA
AYS01604.1|4447649_4448924_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYS01605.1|4449143_4449521_+	hypothetical protein	NA	NA	NA	NA	NA
AYS01606.1|4449607_4449826_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYS01607.1|4449893_4450994_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYS01608.1|4450990_4451476_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYS01609.1|4451475_4454256_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYS01610.1|4454248_4454368_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYS01611.1|4454382_4454685_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYS01612.1|4454739_4455255_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYS01613.1|4455264_4456437_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYS01614.1|4456971_4457694_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYS01615.1|4457891_4458299_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYS01616.1|4458305_4459925_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYS01617.1|4459921_4460527_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS01618.1|4460519_4461428_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYS01619.1|4461414_4461774_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYS01620.1|4461770_4462349_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYS01621.1|4462417_4462864_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYS01622.1|4462856_4463288_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYS01623.1|4463383_4463809_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYS01624.1|4463808_4464186_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYS01625.1|4464190_4464661_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYS01626.1|4464680_4464896_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYS01627.1|4464899_4465103_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYS01628.1|4465102_4465567_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYS01629.1|4465660_4466311_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYS01630.1|4466314_4467379_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYS01631.1|4467395_4468229_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYS01632.1|4468371_4470138_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYS01633.1|4470134_4471181_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYS01634.1|4471229_4471925_-	hypothetical protein	NA	NA	NA	NA	NA
AYS01635.1|4471944_4473009_-	hypothetical protein	NA	NA	NA	NA	NA
AYS01636.1|4473005_4474070_-	hypothetical protein	NA	NA	NA	NA	NA
AYS01637.1|4474994_4475324_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYS01638.1|4475320_4477390_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYS01639.1|4477380_4478241_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYS01640.1|4478237_4478822_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYS01641.1|4478818_4479046_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYS01642.1|4479045_4479279_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYS01643.1|4479346_4479688_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYS01644.1|4479651_4479852_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYS01645.1|4479859_4480369_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYS01646.1|4480401_4480644_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYS01647.1|4480760_4481393_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYS01648.1|4481396_4482422_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYS01649.1|4482528_4482882_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYS01650.1|4483498_4483786_+	hypothetical protein	NA	NA	NA	NA	NA
AYS01651.1|4483796_4484687_+	methyltransferase	NA	NA	NA	NA	NA
AYS01652.1|4484686_4485433_+	hypothetical protein	NA	NA	NA	NA	NA
AYS01653.1|4485734_4487705_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS01654.1|4487724_4489029_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS01655.1|4489051_4489747_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYS01656.1|4489772_4490567_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS01657.1|4490576_4491644_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS01658.1|4491688_4493425_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYS01659.1|4493424_4495920_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS01660.1|4495943_4496990_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYS01661.1|4496992_4498270_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYS01662.1|4498514_4499054_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS01663.1|4499907_4501419_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYS01664.1|4501402_4502992_+	hypothetical protein	NA	NA	NA	NA	NA
AYS01665.1|4503155_4504169_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4504346:4504362	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYS01666.1|4504595_4504889_+	hypothetical protein	NA	NA	NA	NA	NA
AYS01667.1|4504885_4505374_+	hypothetical protein	NA	NA	NA	NA	NA
AYS01668.1|4505553_4506006_-	hypothetical protein	NA	NA	NA	NA	NA
AYS01669.1|4511228_4511690_+	hypothetical protein	NA	NA	NA	NA	NA
AYS01670.1|4511686_4511908_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYS01671.1|4512764_4513547_+	hypothetical protein	NA	NA	NA	NA	NA
AYS01672.1|4514173_4514398_-	hypothetical protein	NA	NA	NA	NA	NA
AYS01673.1|4514527_4515625_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYS01674.1|4515935_4517195_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4517354:4517370	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029936	Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 chromosome, complete genome	4783243	4659447	4669706	4783243	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYS01811.1|4659447_4660524_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYS01812.1|4660520_4661594_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYS01813.1|4661568_4662732_-	hypothetical protein	NA	NA	NA	NA	NA
AYS01814.1|4663007_4663574_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYS01815.1|4663589_4663829_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYS01816.1|4663832_4664693_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYS01817.1|4665115_4665439_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYS01818.1|4665422_4665923_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYS01819.1|4665919_4666147_+	hypothetical protein	NA	NA	NA	NA	NA
AYS01820.1|4666143_4666464_+	P4 phage protein	NA	NA	NA	NA	NA
AYS01821.1|4666478_4667153_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYS01822.1|4667149_4668811_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYS01823.1|4669547_4669706_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029935	Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence	216699	3612	57130	216699	transposase,holin	Escherichia_phage(43.75%)	56	NA	NA
AYR97489.1|3612_3888_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR97490.1|3806_4310_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	6.3e-94
AYR97491.1|4636_4861_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97492.1|5516_5777_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97493.1|5865_6357_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97494.1|6361_6670_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97495.1|6877_7258_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97496.1|7343_7592_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97497.1|7629_7851_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	8.2e-06
AYR97498.1|8013_8397_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97499.1|8711_8936_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97500.1|9022_9487_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97501.1|9669_12099_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97502.1|12221_12668_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97503.1|12715_13522_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97504.1|13749_13992_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97505.1|14069_14402_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97506.1|14901_16083_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97507.1|16091_16388_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
AYR97508.1|16451_16919_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97509.1|17778_18555_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97510.1|18704_19481_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97511.1|19669_20011_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97512.1|20111_20375_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.1e-08
AYR97513.1|20608_21307_+	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	4.2e-11
AYR97514.1|21461_21758_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97515.1|21845_24230_-	periplasmic protein	NA	NA	NA	NA	NA
AYR97516.1|24480_25089_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97517.1|25201_25498_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97518.1|25502_26099_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97519.1|26490_27372_+	replication protein	NA	J9Q7H0	Salmonella_phage	41.3	6.5e-54
AYR97520.1|27957_28473_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97521.1|29123_31580_-	periplasmic protein	NA	NA	NA	NA	NA
AYR97522.1|32216_33971_-	DNA restriction methylase	NA	J9Q747	Salmonella_phage	30.9	1.1e-68
AYR97523.1|34156_35314_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.1e-19
AYR97524.1|35673_36498_+	DNA modification methylase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
AYR97525.1|36512_37334_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97526.1|37616_38324_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97527.1|38538_39615_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
AYR97528.1|40149_41025_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
AYR97529.1|41278_41860_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97530.1|42466_42820_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97531.1|42871_43189_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97532.1|43188_43986_+	pilus assembly protein	NA	NA	NA	NA	NA
AYR97533.1|43988_45221_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97534.1|45222_45663_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97535.1|45640_47011_+	TrhB	NA	NA	NA	NA	NA
AYR97536.1|47019_47532_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97537.1|47532_48390_+	plasmid transfer protein	NA	NA	NA	NA	NA
AYR97538.1|48399_49350_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97539.1|49358_52040_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97540.1|52673_52949_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	93.4	1.9e-44
AYR97541.1|53077_55081_+|holin	transporter, betaine/carnitine/choline family	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AYR97542.1|55143_56439_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97543.1|56432_56936_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR97544.1|56854_57130_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
>prophage 2
CP029935	Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence	216699	81748	134201	216699	transposase,integrase	Escherichia_phage(50.0%)	63	106652:106666	131152:131166
AYR97564.1|81748_82252_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR97565.1|82170_82446_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR97566.1|82487_84344_+	hypothetical protein	NA	S5MMD7	Bacillus_phage	26.4	2.2e-19
AYR97567.1|84741_85617_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97568.1|85675_86053_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97569.1|86113_87100_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97570.1|87159_88212_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97571.1|88250_88520_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97572.1|88590_89718_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97573.1|89795_91808_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97574.1|91879_92101_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97575.1|92215_93448_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
AYR97576.1|93722_94247_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97577.1|94237_95203_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97578.1|95273_96209_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97579.1|96286_97207_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97580.1|97279_98215_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97581.1|98391_99348_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97582.1|99760_100030_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97583.1|100084_100675_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97584.1|100682_100940_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97585.1|101013_101550_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97586.1|101566_102022_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97587.1|102005_102233_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97588.1|102281_102536_-	hypothetical protein	NA	NA	NA	NA	NA
AYR97589.1|102603_103563_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97590.1|103573_104482_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97591.1|104786_105968_-	recombinase	NA	NA	NA	NA	NA
AYR97592.1|106182_106395_+	regulatory protein	NA	NA	NA	NA	NA
106652:106666	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYR97593.1|106701_106977_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	7.7e-46
106652:106666	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYR97594.1|106895_107399_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR97595.1|107505_107940_-	transcriptional regulator MerR	NA	NA	NA	NA	NA
AYR97596.1|107957_108362_+	MerT	NA	NA	NA	NA	NA
AYR97597.1|108375_108651_+	mercuric transport protein	NA	NA	NA	NA	NA
AYR97598.1|108686_109109_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AYR97599.1|109160_110855_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYR97600.1|110872_111235_+	transcriptional regulator MerD	NA	NA	NA	NA	NA
AYR97601.1|111231_111468_+	mercury resistance protein	NA	NA	NA	NA	NA
AYR97602.1|111464_112172_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97603.1|112210_113515_+|integrase	integrase	integrase	NA	NA	NA	NA
AYR97604.1|113543_114266_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR97605.1|115021_115873_+	replication protein	NA	NA	NA	NA	NA
AYR97606.1|116180_116996_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AYR97607.1|117056_117860_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYR97608.1|117859_118696_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYR97609.1|118756_119479_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR97610.1|120058_120919_-	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
120513:120527	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYR97611.1|121101_121368_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
120513:120527	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYR97612.1|121400_122123_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR97613.1|122356_123283_-	sulfonamide-resistant dihydropteroate synthase sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	7.2e-11
AYR97614.1|123189_123570_-	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYR97615.1|123766_124366_-	dihydrofolate reductase	NA	A0A1B2IAU3	Erwinia_phage	32.8	5.3e-15
AYR97616.1|124397_125411_+|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYR97617.1|125400_125964_+	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYR97618.1|126089_126650_+	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYR97619.1|126652_129619_+|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYR97620.1|129685_130063_+	hypothetical protein	NA	NA	NA	NA	NA
AYR97621.1|130263_130923_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AYR97622.1|131201_131477_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR97623.1|131395_131899_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.4	1.3e-94
AYR97624.1|132480_133236_+	replication protein	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
AYR97625.1|133503_133779_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR97626.1|133697_134201_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	95.8	3.8e-91
