The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029930	Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 chromosome, complete genome	4782608	930298	937610	4782608	integrase,protease	Dickeya_phage(16.67%)	6	931549:931563	942728:942742
AYS07147.1|930298_931417_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYS07148.1|931413_933360_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931549:931563	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYS07149.1|933489_933711_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYS07150.1|934034_934355_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYS07151.1|934385_936662_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYS07152.1|937232_937610_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942728:942742	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029930	Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 chromosome, complete genome	4782608	1008523	1085835	4782608	protease,integrase,transposase,tail,terminase	Salmonella_phage(73.33%)	93	990589:990608	1061196:1061215
990589:990608	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS07202.1|1008523_1009864_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYS07203.1|1009860_1010109_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYS07204.1|1010149_1010395_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS07205.1|1010394_1011276_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYS07206.1|1011272_1012337_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYS07207.1|1012414_1013095_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYS07208.1|1013091_1013877_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYS07209.1|1013882_1014179_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYS07210.1|1014269_1014470_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYS07211.1|1014758_1015163_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYS07212.1|1015494_1015869_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYS07213.1|1015953_1016937_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYS07214.1|1016939_1017689_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYS07215.1|1017699_1018047_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYS07216.1|1018043_1018568_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYS07217.1|1018567_1019041_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYS07218.1|1019044_1019617_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYS07219.1|1019710_1019977_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS07220.1|1020058_1020220_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS07221.1|1020652_1021150_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS07222.1|1021334_1021574_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYS07223.1|1021563_1021869_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYS07224.1|1021908_1022511_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYS07225.1|1022719_1023331_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYS07226.1|1023463_1024261_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS07227.1|1024659_1024785_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS07228.1|1024920_1025370_-	lipoprotein	NA	NA	NA	NA	NA
AYS07229.1|1025586_1025976_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYS07230.1|1025962_1026244_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYS07231.1|1026243_1026858_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYS07232.1|1027076_1027331_+	hypothetical protein	NA	NA	NA	NA	NA
AYS07233.1|1027435_1027813_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYS07234.1|1027876_1028137_+	hypothetical protein	NA	NA	NA	NA	NA
AYS07235.1|1028226_1028979_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYS07236.1|1028944_1030348_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYS07237.1|1030347_1031817_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYS07238.1|1031908_1032439_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYS07239.1|1032453_1033686_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYS07240.1|1033690_1034188_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYS07241.1|1034199_1035141_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYS07242.1|1035182_1035551_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYS07243.1|1035516_1035924_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYS07244.1|1035920_1036475_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYS07245.1|1036461_1036851_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYS07246.1|1036825_1037389_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYS07247.1|1037392_1038538_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYS07248.1|1038549_1038990_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYS07249.1|1038993_1039446_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYS07250.1|1039623_1041576_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYS07251.1|1041575_1042226_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYS07252.1|1042229_1042532_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYS07253.1|1042534_1043566_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYS07254.1|1043562_1043898_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYS07255.1|1044092_1044824_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS07256.1|1044823_1045252_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS07257.1|1045310_1046066_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYS07258.1|1046153_1046291_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYS07259.1|1046306_1046660_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYS07260.1|1046660_1047860_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYS07261.1|1047856_1048537_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYS07262.1|1048536_1050048_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYS07263.1|1050062_1050581_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYS07264.1|1051502_1052204_-	hypothetical protein	NA	NA	NA	NA	NA
AYS07265.1|1052516_1052795_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYS07266.1|1053220_1055833_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYS07267.1|1056040_1057051_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYS07268.1|1057213_1057759_+	hypothetical protein	NA	NA	NA	NA	NA
AYS07269.1|1057755_1058865_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYS07270.1|1058963_1061072_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYS07271.1|1061084_1062992_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061196:1061215	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS07272.1|1063006_1064260_+	inner membrane protein	NA	NA	NA	NA	NA
AYS07273.1|1064264_1065905_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYS07274.1|1065901_1066465_+	lipoprotein	NA	NA	NA	NA	NA
AYS07275.1|1066718_1066886_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYS07276.1|1066985_1067504_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYS07277.1|1067572_1069333_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYS07278.1|1069518_1069971_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYS07279.1|1070042_1071095_-	outer membrane protein A	NA	NA	NA	NA	NA
AYS07280.1|1071449_1071959_-	cell division inhibitor	NA	NA	NA	NA	NA
AYS07281.1|1072175_1072781_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYS07282.1|1072767_1074921_-	inner membrane protein	NA	NA	NA	NA	NA
AYS07283.1|1074939_1075386_-	hypothetical protein	NA	NA	NA	NA	NA
AYS07284.1|1075509_1077564_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYS07285.1|1077599_1078058_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYS07286.1|1078152_1078815_-	hypothetical protein	NA	NA	NA	NA	NA
AYS07287.1|1078985_1079402_+	hypothetical protein	NA	NA	NA	NA	NA
AYS07288.1|1079446_1079764_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYS07289.1|1079821_1081033_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYS07290.1|1082164_1082623_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS07291.1|1083359_1083641_+	acylphosphatase	NA	NA	NA	NA	NA
AYS07292.1|1083637_1083967_-	sulfite reductase	NA	NA	NA	NA	NA
AYS07293.1|1084053_1084713_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYS07294.1|1085376_1085835_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029930	Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 chromosome, complete genome	4782608	1528654	1601594	4782608	tRNA,protease,plate,transposase,tail,head	Burkholderia_virus(43.24%)	79	NA	NA
AYS07694.1|1528654_1529113_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS07695.1|1529615_1529897_+	stress response protein	NA	NA	NA	NA	NA
AYS07696.1|1530165_1530987_+|protease	serine protease	protease	NA	NA	NA	NA
AYS07697.1|1531021_1531351_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYS07698.1|1531337_1531700_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYS07699.1|1531811_1531982_-	hypothetical protein	NA	NA	NA	NA	NA
AYS07700.1|1532116_1533151_+	hypothetical protein	NA	NA	NA	NA	NA
AYS07701.1|1533325_1534714_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYS07702.1|1534724_1536254_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYS07703.1|1536780_1537725_+	hypothetical protein	NA	NA	NA	NA	NA
AYS07704.1|1537906_1538296_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYS07705.1|1538267_1538720_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYS07706.1|1538914_1539145_-	hypothetical protein	NA	NA	NA	NA	NA
AYS07707.1|1539141_1539825_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYS07708.1|1539821_1540037_-	hypothetical protein	NA	NA	NA	NA	NA
AYS07709.1|1540029_1540413_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYS07710.1|1540409_1540712_-	hypothetical protein	NA	NA	NA	NA	NA
AYS07711.1|1540721_1540994_-	hypothetical protein	NA	NA	NA	NA	NA
AYS07712.1|1541282_1541813_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYS07713.1|1541840_1542110_-	hypothetical protein	NA	NA	NA	NA	NA
AYS07714.1|1542112_1543279_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYS07715.1|1543289_1545059_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYS07716.1|1545236_1545668_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYS07717.1|1545663_1546260_+	hypothetical protein	NA	NA	NA	NA	NA
AYS07718.1|1546503_1546854_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYS07719.1|1547568_1548219_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYS07720.1|1548215_1548542_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYS07721.1|1548541_1548853_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYS07722.1|1548852_1549398_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYS07723.1|1549394_1550990_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYS07724.1|1550989_1552486_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYS07725.1|1552466_1553288_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYS07726.1|1553290_1553749_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYS07727.1|1553963_1555079_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYS07728.1|1555093_1556047_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYS07729.1|1556056_1556395_+	hypothetical protein	NA	NA	NA	NA	NA
AYS07730.1|1556396_1556843_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYS07731.1|1556842_1557307_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYS07732.1|1557303_1557558_+	hypothetical protein	NA	NA	NA	NA	NA
AYS07733.1|1557547_1558975_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYS07734.1|1558974_1559496_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYS07735.1|1559498_1559780_+	hypothetical protein	NA	NA	NA	NA	NA
AYS07736.1|1559877_1560213_+	hypothetical protein	NA	NA	NA	NA	NA
AYS07737.1|1560388_1562854_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYS07738.1|1562853_1563738_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYS07739.1|1563734_1563950_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYS07740.1|1563937_1565092_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYS07741.1|1565088_1565616_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYS07742.1|1565672_1566020_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYS07743.1|1566010_1567114_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYS07744.1|1567106_1567685_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYS07745.1|1567687_1568713_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYS07746.1|1569226_1569844_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYS07747.1|1570882_1571455_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYS07748.1|1571735_1573118_+	amino acid permease	NA	NA	NA	NA	NA
AYS07749.1|1573179_1573515_-	hypothetical protein	NA	NA	NA	NA	NA
AYS07750.1|1573641_1574373_+	two-component response regulator	NA	NA	NA	NA	NA
AYS07751.1|1574853_1576005_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYS07752.1|1576157_1577864_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYS07753.1|1577971_1579276_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYS07754.1|1579351_1580281_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYS07755.1|1580277_1581681_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYS07756.1|1581848_1583495_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYS07757.1|1583694_1584870_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYS07758.1|1584972_1586481_+	hypothetical protein	NA	NA	NA	NA	NA
AYS07759.1|1587186_1588188_+	adenosine deaminase	NA	NA	NA	NA	NA
AYS07760.1|1588261_1589377_-	oxidoreductase	NA	NA	NA	NA	NA
AYS07761.1|1589479_1589635_+	hypothetical protein	NA	NA	NA	NA	NA
AYS07762.1|1589933_1590149_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYS07763.1|1590237_1590678_+	hypothetical protein	NA	NA	NA	NA	NA
AYS07764.1|1590754_1591336_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYS07765.1|1591335_1591914_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYS07766.1|1593742_1594801_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYS07767.1|1594804_1595425_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYS07768.1|1595427_1596120_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYS07769.1|1596119_1596755_+	endonuclease III	NA	NA	NA	NA	NA
AYS07770.1|1597355_1598861_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYS07771.1|1598965_1599571_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYS07772.1|1600319_1601594_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029930	Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 chromosome, complete genome	4782608	1782631	1787043	4782608		Escherichia_phage(50.0%)	6	NA	NA
AYS07956.1|1782631_1782871_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYS07957.1|1783743_1784553_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYS07958.1|1784625_1785003_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYS07959.1|1785150_1785693_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYS07960.1|1785884_1786613_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYS07961.1|1786629_1787043_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029930	Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 chromosome, complete genome	4782608	1990896	1998130	4782608		Morganella_phage(33.33%)	7	NA	NA
AYS08151.1|1990896_1992327_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYS08152.1|1992400_1993096_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYS08153.1|1993175_1993487_-	hypothetical protein	NA	NA	NA	NA	NA
AYS08154.1|1994137_1995322_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYS08155.1|1995781_1995994_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYS08156.1|1996439_1997708_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYS08157.1|1997710_1998130_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029930	Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 chromosome, complete genome	4782608	2104431	2114938	4782608		Enterobacteria_phage(37.5%)	10	NA	NA
AYS08254.1|2104431_2105745_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYS08255.1|2105771_2106851_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYS08256.1|2106855_2107629_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYS08257.1|2107644_2108619_-	reductase RfbI	NA	NA	NA	NA	NA
AYS08258.1|2108624_2109176_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYS08259.1|2109176_2110055_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYS08260.1|2110102_2111002_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYS08261.1|2111001_2112087_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYS08262.1|2112463_2113357_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYS08263.1|2113534_2114938_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029930	Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 chromosome, complete genome	4782608	2192167	2201338	4782608	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYS08323.1|2192167_2194201_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYS08324.1|2194441_2194900_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYS08325.1|2195071_2195602_+	lipoprotein	NA	NA	NA	NA	NA
AYS08326.1|2195658_2196126_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYS08327.1|2196172_2196892_-	two-component system response regulator	NA	NA	NA	NA	NA
AYS08328.1|2196888_2198574_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYS08329.1|2198796_2199528_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYS08330.1|2199587_2199695_+	hypothetical protein	NA	NA	NA	NA	NA
AYS08331.1|2199675_2200407_-	ABC transporter permease	NA	NA	NA	NA	NA
AYS08332.1|2200390_2201338_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029930	Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 chromosome, complete genome	4782608	2736783	2750175	4782608	tail	Salmonella_phage(70.0%)	11	NA	NA
AYS08761.1|2736783_2737002_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYS08762.1|2737092_2738193_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS08763.1|2738189_2738675_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS08764.1|2738671_2741749_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS08765.1|2741741_2741861_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS08766.1|2741875_2742178_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS08767.1|2742232_2742748_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS08768.1|2742757_2743930_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS08769.1|2744072_2744645_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS08770.1|2745322_2746438_+	glycosyltransferase	NA	NA	NA	NA	NA
AYS08771.1|2746518_2750175_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029930	Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 chromosome, complete genome	4782608	3067614	3111317	4782608	tRNA,bacteriocin,protease,transposase	Bacillus_virus(33.33%)	44	NA	NA
AYS09058.1|3067614_3068073_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS09059.1|3068262_3069342_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYS09060.1|3069443_3070607_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYS09061.1|3070628_3071675_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYS09062.1|3072048_3072474_+	hypothetical protein	NA	NA	NA	NA	NA
AYS09063.1|3072499_3073078_+	hypothetical protein	NA	NA	NA	NA	NA
AYS09064.1|3073111_3073786_+	hypothetical protein	NA	NA	NA	NA	NA
AYS09065.1|3073767_3074451_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYS09066.1|3074444_3075101_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYS09067.1|3075205_3075664_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS09068.1|3075852_3077844_-	transketolase	NA	NA	NA	NA	NA
AYS09069.1|3078119_3078878_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYS09070.1|3078978_3079899_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYS09071.1|3080126_3082103_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYS09072.1|3082111_3082243_-	hypothetical protein	NA	NA	NA	NA	NA
AYS09073.1|3082537_3082837_-	membrane protein	NA	NA	NA	NA	NA
AYS09074.1|3082892_3084047_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYS09075.1|3084539_3085934_+	galactose-proton symport	NA	NA	NA	NA	NA
AYS09076.1|3086012_3086510_+	hypothetical protein	NA	NA	NA	NA	NA
AYS09077.1|3086605_3087313_+	endonuclease I	NA	NA	NA	NA	NA
AYS09078.1|3087389_3088121_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYS09079.1|3088140_3089088_+	glutathione synthetase	NA	NA	NA	NA	NA
AYS09080.1|3089303_3089867_+	hypothetical protein	NA	NA	NA	NA	NA
AYS09081.1|3089866_3090283_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYS09082.1|3090329_3091016_-	global regulatory protein	NA	NA	NA	NA	NA
AYS09083.1|3091145_3092126_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYS09084.1|3092143_3092848_+	hypothetical protein	NA	NA	NA	NA	NA
AYS09085.1|3092866_3093433_+	hypothetical protein	NA	NA	NA	NA	NA
AYS09086.1|3093429_3093720_+	hypothetical protein	NA	NA	NA	NA	NA
AYS09087.1|3093727_3094321_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYS09088.1|3094313_3095450_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYS09089.1|3095540_3096548_-	hypothetical protein	NA	NA	NA	NA	NA
AYS09090.1|3096680_3097727_-	L-asparaginase	NA	NA	NA	NA	NA
AYS09091.1|3098045_3098504_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS09092.1|3098626_3099346_-	hypothetical protein	NA	NA	NA	NA	NA
AYS09093.1|3099395_3099722_-	hypothetical protein	NA	NA	NA	NA	NA
AYS09094.1|3099721_3100441_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYS09095.1|3100595_3101648_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYS09096.1|3101675_3101951_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYS09097.1|3102063_3103149_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYS09098.1|3103365_3104622_+	nucleoside permease	NA	NA	NA	NA	NA
AYS09099.1|3107232_3107940_+	hypothetical protein	NA	NA	NA	NA	NA
AYS09100.1|3110529_3110796_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYS09101.1|3111038_3111317_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029930	Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 chromosome, complete genome	4782608	3488420	3526478	4782608	plate,integrase,transposase,tail,terminase,portal,capsid	Salmonella_phage(82.05%)	46	3483384:3483398	3495550:3495564
3483384:3483398	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYS09429.1|3488420_3490067_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYS09430.1|3490206_3490305_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYS09431.1|3490560_3490890_+	hypothetical protein	NA	NA	NA	NA	NA
AYS09432.1|3490930_3491983_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYS09433.1|3492378_3492948_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYS09434.1|3493073_3493295_+	hypothetical protein	NA	NA	NA	NA	NA
AYS09435.1|3493327_3493837_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYS09436.1|3494011_3494236_+	hypothetical protein	NA	NA	NA	NA	NA
AYS09437.1|3494258_3494600_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYS09438.1|3494667_3494901_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYS09439.1|3494900_3495128_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYS09440.1|3495124_3495982_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3495550:3495564	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYS09441.1|3495978_3498393_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYS09442.1|3498546_3498735_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYS09443.1|3500702_3501617_+	hypothetical protein	NA	NA	NA	NA	NA
AYS09444.1|3501613_3502354_+	hypothetical protein	NA	NA	NA	NA	NA
AYS09445.1|3502388_3503426_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYS09446.1|3503425_3505192_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYS09447.1|3505334_3506168_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYS09448.1|3506184_3507243_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYS09449.1|3507246_3507897_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYS09450.1|3507929_3508457_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYS09451.1|3508456_3508660_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYS09452.1|3508663_3508879_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYS09453.1|3508898_3509372_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYS09454.1|3509373_3509751_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYS09455.1|3509747_3510176_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYS09456.1|3510271_3510703_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYS09457.1|3510695_3511142_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYS09458.1|3511210_3511789_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYS09459.1|3511785_3512145_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYS09460.1|3512131_3513040_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYS09461.1|3513032_3513638_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS09462.1|3513634_3515149_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYS09463.1|3515148_3515742_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYS09464.1|3515713_3516154_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYS09465.1|3516576_3517149_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS09466.1|3517291_3518464_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS09467.1|3518473_3518989_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS09468.1|3519043_3519346_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS09469.1|3519360_3519480_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS09470.1|3519472_3522550_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS09471.1|3522546_3523032_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS09472.1|3523028_3524129_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS09473.1|3524219_3524438_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYS09474.1|3526019_3526478_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029930	Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 chromosome, complete genome	4782608	4442171	4516518	4782608	plate,integrase,tail,terminase,portal,capsid	Salmonella_phage(82.98%)	76	4503669:4503685	4516677:4516693
AYS10245.1|4442171_4444121_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYS10246.1|4444192_4445101_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10247.1|4445174_4446074_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10248.1|4446115_4446475_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10249.1|4446574_4446844_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10250.1|4446975_4448250_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYS10251.1|4448469_4448847_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10252.1|4448933_4449152_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYS10253.1|4449219_4450320_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYS10254.1|4450316_4450802_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYS10255.1|4450801_4453582_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYS10256.1|4453574_4453694_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYS10257.1|4453708_4454011_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYS10258.1|4454065_4454581_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYS10259.1|4454590_4455763_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYS10260.1|4456297_4457020_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYS10261.1|4457217_4457625_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYS10262.1|4457631_4459251_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYS10263.1|4459247_4459853_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS10264.1|4459845_4460754_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYS10265.1|4460740_4461100_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYS10266.1|4461096_4461675_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYS10267.1|4461743_4462190_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYS10268.1|4462182_4462614_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYS10269.1|4462709_4463135_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYS10270.1|4463134_4463512_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYS10271.1|4463516_4463987_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYS10272.1|4464006_4464222_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYS10273.1|4464225_4464429_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYS10274.1|4464428_4464893_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYS10275.1|4464986_4465637_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYS10276.1|4465640_4466705_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYS10277.1|4466721_4467555_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYS10278.1|4467697_4469464_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYS10279.1|4469460_4470507_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYS10280.1|4470555_4471251_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10281.1|4471270_4472335_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10282.1|4472331_4473396_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10283.1|4474320_4474650_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYS10284.1|4474646_4476716_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYS10285.1|4476706_4477567_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYS10286.1|4477563_4478148_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYS10287.1|4478144_4478372_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYS10288.1|4478371_4478605_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYS10289.1|4478672_4479014_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYS10290.1|4478977_4479178_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYS10291.1|4479185_4479695_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYS10292.1|4479727_4479970_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYS10293.1|4480086_4480719_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYS10294.1|4480722_4481748_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYS10295.1|4481854_4482208_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYS10296.1|4482824_4483112_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10297.1|4483122_4484013_+	methyltransferase	NA	NA	NA	NA	NA
AYS10298.1|4484012_4484759_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10299.1|4485060_4487031_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS10300.1|4487050_4488355_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS10301.1|4488377_4489073_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYS10302.1|4489098_4489893_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS10303.1|4489902_4490970_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS10304.1|4491014_4492748_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYS10305.1|4492747_4495243_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS10306.1|4495266_4496313_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYS10307.1|4496315_4497593_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYS10308.1|4497837_4498377_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS10309.1|4499230_4500742_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYS10310.1|4500725_4502315_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10311.1|4502478_4503492_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4503669:4503685	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYS10312.1|4503918_4504212_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10313.1|4504208_4504697_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10314.1|4504876_4505329_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10315.1|4510551_4511013_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10316.1|4511009_4511231_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYS10317.1|4512087_4512870_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10318.1|4513496_4513721_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10319.1|4513850_4514948_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYS10320.1|4515258_4516518_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4516677:4516693	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029930	Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 chromosome, complete genome	4782608	4658770	4669029	4782608	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYS10457.1|4658770_4659847_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYS10458.1|4659843_4660917_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYS10459.1|4660891_4662055_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10460.1|4662330_4662897_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYS10461.1|4662912_4663152_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYS10462.1|4663155_4664016_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYS10463.1|4664438_4664762_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYS10464.1|4664745_4665246_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYS10465.1|4665242_4665470_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10466.1|4665466_4665787_+	P4 phage protein	NA	NA	NA	NA	NA
AYS10467.1|4665801_4666476_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYS10468.1|4666472_4668134_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYS10469.1|4668870_4669029_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029931	Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence	216915	3612	57130	216915	transposase,holin	Escherichia_phage(43.75%)	56	NA	NA
AYS10564.1|3612_3888_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS10565.1|3806_4310_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	6.3e-94
AYS10566.1|4636_4861_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10567.1|5516_5777_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10568.1|5865_6357_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10569.1|6361_6670_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10570.1|6877_7258_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10571.1|7343_7592_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10572.1|7629_7851_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	8.2e-06
AYS10573.1|8013_8397_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10574.1|8711_8936_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10575.1|9022_9487_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10576.1|9669_12099_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10577.1|12221_12668_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10578.1|12715_13522_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10579.1|13749_13992_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10580.1|14069_14402_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10581.1|14901_16083_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10582.1|16091_16388_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
AYS10583.1|16451_16919_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10584.1|17778_18555_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10585.1|18704_19481_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10586.1|19669_20011_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10587.1|20111_20375_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.1e-08
AYS10588.1|20608_21307_+	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	4.2e-11
AYS10589.1|21461_21758_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10590.1|21845_24230_-	periplasmic protein	NA	NA	NA	NA	NA
AYS10591.1|24480_25089_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10592.1|25201_25498_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10593.1|25502_26099_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10594.1|26490_27372_+	replication protein	NA	J9Q7H0	Salmonella_phage	41.3	6.5e-54
AYS10595.1|27957_28473_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10596.1|29123_31580_-	periplasmic protein	NA	NA	NA	NA	NA
AYS10597.1|32216_33971_-	DNA restriction methylase	NA	J9Q747	Salmonella_phage	30.9	1.1e-68
AYS10598.1|34156_35314_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.1e-19
AYS10599.1|35673_36498_+	DNA modification methylase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
AYS10600.1|36512_37334_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10601.1|37616_38324_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10602.1|38538_39615_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
AYS10603.1|40149_41025_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
AYS10604.1|41278_41860_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10605.1|42466_42820_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10606.1|42871_43189_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10607.1|43188_43986_+	pilus assembly protein	NA	NA	NA	NA	NA
AYS10608.1|43988_45221_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10609.1|45222_45663_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10610.1|45640_47011_+	TrhB	NA	NA	NA	NA	NA
AYS10611.1|47019_47532_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10612.1|47532_48390_+	plasmid transfer protein	NA	NA	NA	NA	NA
AYS10613.1|48399_49350_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10614.1|49358_52040_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10615.1|52673_52949_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	93.4	1.9e-44
AYS10616.1|53077_55081_+|holin	transporter, betaine/carnitine/choline family	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AYS10617.1|55143_56439_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10618.1|56432_56936_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS10619.1|56854_57130_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
>prophage 2
CP029931	Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence	216915	81854	134417	216915	integrase,transposase	Escherichia_phage(50.0%)	63	106758:106772	131258:131272
AYS10640.1|81854_82358_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS10641.1|82276_82552_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS10642.1|82593_84450_+	hypothetical protein	NA	S5MMD7	Bacillus_phage	26.4	2.2e-19
AYS10643.1|84847_85723_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10644.1|85781_86159_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10645.1|86219_87206_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10646.1|87265_88318_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10647.1|88356_88626_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10648.1|88696_89824_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10649.1|89901_91914_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10650.1|91985_92207_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10651.1|92321_93554_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
AYS10652.1|93828_94353_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10653.1|94343_95309_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10654.1|95379_96315_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10655.1|96392_97313_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10656.1|97385_98321_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10657.1|98497_99454_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10658.1|99866_100136_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10659.1|100190_100781_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10660.1|100788_101046_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10661.1|101119_101656_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10662.1|101672_102128_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10663.1|102111_102339_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10664.1|102387_102642_-	hypothetical protein	NA	NA	NA	NA	NA
AYS10665.1|102709_103669_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10666.1|103679_104588_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10667.1|104892_106074_-	recombinase	NA	NA	NA	NA	NA
AYS10668.1|106288_106501_+	regulatory protein	NA	NA	NA	NA	NA
106758:106772	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYS10669.1|106807_107083_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	7.7e-46
106758:106772	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYS10670.1|107001_107505_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS10671.1|107611_108046_-	transcriptional regulator MerR	NA	NA	NA	NA	NA
AYS10672.1|108063_108468_+	MerT	NA	NA	NA	NA	NA
AYS10673.1|108481_108757_+	mercuric transport protein	NA	NA	NA	NA	NA
AYS10674.1|108792_109215_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AYS10675.1|109266_110961_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYS10676.1|110978_111341_+	transcriptional regulator MerD	NA	NA	NA	NA	NA
AYS10677.1|111337_111574_+	mercury resistance protein	NA	NA	NA	NA	NA
AYS10678.1|111570_112278_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10679.1|112316_113621_+|integrase	integrase	integrase	NA	NA	NA	NA
AYS10680.1|113649_114372_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS10681.1|115127_115979_+	replication protein	NA	NA	NA	NA	NA
AYS10682.1|116286_117102_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AYS10683.1|117162_117966_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYS10684.1|117965_118802_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYS10685.1|118862_119585_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS10686.1|120164_121025_-	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
120619:120633	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYS10687.1|121207_121474_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
120619:120633	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYS10688.1|121506_122229_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS10689.1|122462_123389_-	sulfonamide-resistant dihydropteroate synthase sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	7.2e-11
AYS10690.1|123295_123676_-	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYS10691.1|123872_124472_-	dihydrofolate reductase	NA	A0A1B2IAU3	Erwinia_phage	32.8	5.3e-15
AYS10692.1|124503_125517_+|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYS10693.1|125506_126070_+	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYS10694.1|126195_126756_+	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYS10695.1|126758_129725_+|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYS10696.1|129791_130169_+	hypothetical protein	NA	NA	NA	NA	NA
AYS10697.1|130369_131029_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AYS10698.1|131307_131583_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS10699.1|131501_132005_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.4	1.3e-94
AYS10700.1|132586_133342_+	replication protein	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
AYS10701.1|133719_133995_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS10702.1|133913_134417_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	94.0	3.6e-89
