The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029928	Salmonella enterica subsp. enterica serovar Typhi strain 311189_216103 chromosome, complete genome	4799426	930262	937574	4799426	protease,integrase	Dickeya_phage(16.67%)	6	931513:931527	942878:942892
AYS11582.1|930262_931381_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYS11583.1|931377_933324_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931513:931527	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYS11584.1|933453_933675_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYS11585.1|933998_934319_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.9	9.1e-14
AYS11586.1|934349_936626_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYS11587.1|937196_937574_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942878:942892	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029928	Salmonella enterica subsp. enterica serovar Typhi strain 311189_216103 chromosome, complete genome	4799426	1008730	1086043	4799426	terminase,tail,protease,integrase,transposase	Salmonella_phage(73.33%)	93	990809:990828	1061404:1061423
990809:990828	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS11637.1|1008730_1010071_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYS11638.1|1010067_1010316_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYS11639.1|1010356_1010602_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS11640.1|1010601_1011483_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYS11641.1|1011479_1012544_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYS11642.1|1012621_1013302_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYS11643.1|1013298_1014084_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYS11644.1|1014089_1014386_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYS11645.1|1014476_1014677_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYS11646.1|1014965_1015370_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYS11647.1|1015701_1016076_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYS11648.1|1016160_1017144_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYS11649.1|1017146_1017896_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYS11650.1|1017906_1018254_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYS11651.1|1018250_1018775_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYS11652.1|1018774_1019248_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYS11653.1|1019251_1019824_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYS11654.1|1019917_1020184_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS11655.1|1020265_1020427_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS11656.1|1020859_1021357_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS11657.1|1021541_1021781_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYS11658.1|1021770_1022076_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYS11659.1|1022115_1022718_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYS11660.1|1022926_1023538_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYS11661.1|1023670_1024468_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS11662.1|1024866_1024992_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS11663.1|1025127_1025577_-	lipoprotein	NA	NA	NA	NA	NA
AYS11664.1|1025793_1026183_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYS11665.1|1026169_1026451_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYS11666.1|1026450_1027065_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYS11667.1|1027284_1027539_+	hypothetical protein	NA	NA	NA	NA	NA
AYS11668.1|1027643_1028021_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYS11669.1|1028084_1028345_+	hypothetical protein	NA	NA	NA	NA	NA
AYS11670.1|1028434_1029187_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYS11671.1|1029152_1030556_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYS11672.1|1030555_1032025_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYS11673.1|1032116_1032647_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYS11674.1|1032661_1033894_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYS11675.1|1033898_1034396_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYS11676.1|1034407_1035349_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYS11677.1|1035390_1035759_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYS11678.1|1035724_1036132_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYS11679.1|1036128_1036683_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYS11680.1|1036669_1037059_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYS11681.1|1037033_1037597_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYS11682.1|1037600_1038746_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYS11683.1|1038757_1039198_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYS11684.1|1039201_1039654_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYS11685.1|1039831_1041784_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYS11686.1|1041783_1042434_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYS11687.1|1042437_1042740_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYS11688.1|1042742_1043774_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYS11689.1|1043770_1044106_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYS11690.1|1044300_1045032_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS11691.1|1045031_1045460_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS11692.1|1045518_1046274_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYS11693.1|1046361_1046499_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYS11694.1|1046514_1046868_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYS11695.1|1046868_1048068_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYS11696.1|1048064_1048745_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYS11697.1|1048744_1050256_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYS11698.1|1050270_1050789_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYS11699.1|1051710_1052412_-	hypothetical protein	NA	NA	NA	NA	NA
AYS11700.1|1052724_1053003_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYS11701.1|1053428_1056041_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYS11702.1|1056248_1057259_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYS11703.1|1057421_1057967_+	hypothetical protein	NA	NA	NA	NA	NA
AYS11704.1|1057963_1059073_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYS11705.1|1059171_1061280_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYS11706.1|1061292_1063200_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061404:1061423	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS11707.1|1063214_1064468_+	inner membrane protein	NA	NA	NA	NA	NA
AYS11708.1|1064472_1066113_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYS11709.1|1066109_1066673_+	lipoprotein	NA	NA	NA	NA	NA
AYS11710.1|1066926_1067094_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYS11711.1|1067193_1067712_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYS11712.1|1067780_1069541_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYS11713.1|1069726_1070179_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYS11714.1|1070250_1071303_-	outer membrane protein A	NA	NA	NA	NA	NA
AYS11715.1|1071657_1072167_-	cell division inhibitor	NA	NA	NA	NA	NA
AYS11716.1|1072383_1072989_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYS11717.1|1072975_1075129_-	inner membrane protein	NA	NA	NA	NA	NA
AYS11718.1|1075147_1075594_-	hypothetical protein	NA	NA	NA	NA	NA
AYS11719.1|1075717_1077772_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYS11720.1|1077807_1078266_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYS11721.1|1078360_1079023_-	hypothetical protein	NA	NA	NA	NA	NA
AYS11722.1|1079193_1079610_+	hypothetical protein	NA	NA	NA	NA	NA
AYS11723.1|1079654_1079972_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYS11724.1|1080029_1081241_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYS11725.1|1082372_1082831_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS11726.1|1083567_1083849_+	acylphosphatase	NA	NA	NA	NA	NA
AYS11727.1|1083845_1084175_-	sulfite reductase	NA	NA	NA	NA	NA
AYS11728.1|1084261_1084921_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYS11729.1|1085584_1086043_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029928	Salmonella enterica subsp. enterica serovar Typhi strain 311189_216103 chromosome, complete genome	4799426	1530598	1604196	4799426	head,tail,plate,tRNA,protease,transposase	Burkholderia_virus(44.12%)	72	NA	NA
AYS12133.1|1530598_1531057_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS12134.1|1531559_1531841_+	stress response protein	NA	NA	NA	NA	NA
AYS12135.1|1532109_1532931_+|protease	serine protease	protease	NA	NA	NA	NA
AYS12136.1|1532965_1533295_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYS12137.1|1533281_1533644_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYS12138.1|1533755_1533926_-	hypothetical protein	NA	NA	NA	NA	NA
AYS12139.1|1534060_1535095_+	hypothetical protein	NA	NA	NA	NA	NA
AYS12140.1|1535269_1536658_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYS12141.1|1536668_1538198_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYS12142.1|1538724_1539669_+	hypothetical protein	NA	NA	NA	NA	NA
AYS12143.1|1539850_1540240_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYS12144.1|1540211_1540664_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYS12145.1|1540858_1541089_-	hypothetical protein	NA	NA	NA	NA	NA
AYS12146.1|1541085_1541769_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYS12147.1|1542353_1542656_-	hypothetical protein	NA	NA	NA	NA	NA
AYS12148.1|1543226_1543757_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYS12149.1|1544056_1545223_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYS12150.1|1545233_1547003_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYS12151.1|1548447_1548798_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYS12152.1|1549512_1550163_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYS12153.1|1550485_1550797_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYS12154.1|1550796_1551342_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYS12155.1|1551338_1552934_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYS12156.1|1552933_1554430_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYS12157.1|1554410_1555232_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYS12158.1|1555234_1555693_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYS12159.1|1555907_1557023_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYS12160.1|1557037_1557991_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYS12161.1|1558000_1558339_+	hypothetical protein	NA	NA	NA	NA	NA
AYS12162.1|1558340_1558787_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYS12163.1|1558786_1559251_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYS12164.1|1559491_1560919_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYS12165.1|1560918_1561440_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYS12166.1|1561442_1561724_+	hypothetical protein	NA	NA	NA	NA	NA
AYS12167.1|1561821_1562157_+	hypothetical protein	NA	NA	NA	NA	NA
AYS12168.1|1562332_1564798_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYS12169.1|1564797_1565682_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYS12170.1|1565678_1565894_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYS12171.1|1565881_1567036_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYS12172.1|1567032_1567560_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYS12173.1|1567616_1567964_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYS12174.1|1567954_1569058_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYS12175.1|1569050_1569629_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYS12176.1|1569631_1570657_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYS12177.1|1571170_1571788_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYS12178.1|1573298_1573871_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYS12179.1|1574151_1575534_+	amino acid permease	NA	NA	NA	NA	NA
AYS12180.1|1575595_1575931_-	hypothetical protein	NA	NA	NA	NA	NA
AYS12181.1|1576057_1576789_+	two-component response regulator	NA	NA	NA	NA	NA
AYS12182.1|1577269_1578421_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYS12183.1|1578573_1580280_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYS12184.1|1580387_1581692_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYS12185.1|1581767_1582697_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYS12186.1|1582693_1584097_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYS12187.1|1584264_1585911_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYS12188.1|1586110_1587286_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYS12189.1|1587388_1588897_+	hypothetical protein	NA	NA	NA	NA	NA
AYS12190.1|1589602_1590604_+	adenosine deaminase	NA	NA	NA	NA	NA
AYS12191.1|1590677_1591793_-	oxidoreductase	NA	NA	NA	NA	NA
AYS12192.1|1591895_1592051_+	hypothetical protein	NA	NA	NA	NA	NA
AYS12193.1|1592349_1592565_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYS12194.1|1592653_1593094_+	hypothetical protein	NA	NA	NA	NA	NA
AYS12195.1|1593170_1593752_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYS12196.1|1593751_1594330_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYS12197.1|1594322_1596344_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYS12198.1|1596344_1597403_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYS12199.1|1597406_1598027_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYS12200.1|1598029_1598722_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYS12201.1|1598721_1599357_+	endonuclease III	NA	NA	NA	NA	NA
AYS12202.1|1599957_1601463_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYS12203.1|1601567_1602173_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYS12204.1|1602921_1604196_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029928	Salmonella enterica subsp. enterica serovar Typhi strain 311189_216103 chromosome, complete genome	4799426	1691702	1755567	4799426	terminase,tail,plate,tRNA,portal,transposase,capsid	Enterobacteria_phage(75.0%)	74	NA	NA
AYS12291.1|1691702_1692452_-	vitamin B12 ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	4.6e-08
AYS12292.1|1692451_1693003_-	glutathione peroxidase	NA	NA	NA	NA	NA
AYS12293.1|1693094_1694075_-	vitamin B12 ABC transporter permease	NA	NA	NA	NA	NA
AYS12294.1|1694282_1694612_-	hypothetical protein	NA	NA	NA	NA	NA
AYS12295.1|1694719_1695082_-	hypothetical protein	NA	NA	NA	NA	NA
AYS12296.1|1695084_1696212_-	Integrase	NA	A0A0M4RTQ0	Salmonella_phage	51.4	7.0e-85
AYS12297.1|1696514_1696793_+	DNA-binding protein	NA	NA	NA	NA	NA
AYS12298.1|1696807_1697146_+	hypothetical protein	NA	A0A0A7NV42	Enterobacteria_phage	82.8	1.1e-46
AYS12299.1|1697156_1697435_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	4.5e-33
AYS12300.1|1697446_1697689_+	hypothetical protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AYS12301.1|1697685_1697799_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	94.6	3.6e-10
AYS12302.1|1697886_1698090_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	82.1	3.3e-25
AYS12303.1|1698086_1698305_+	hypothetical protein	NA	NA	NA	NA	NA
AYS12304.1|1698413_1698803_+	hypothetical protein	NA	NA	NA	NA	NA
AYS12305.1|1698799_1701640_+	Phage replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
AYS12306.1|1701716_1702676_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	1.3e-177
AYS12307.1|1702680_1702995_+	Plasmid stability protein	NA	A0A0A7NPT5	Enterobacteria_phage	51.4	9.2e-19
AYS12308.1|1703078_1703921_-	hypothetical protein	NA	NA	NA	NA	NA
AYS12309.1|1703960_1704458_-	hypothetical protein	NA	NA	NA	NA	NA
AYS12310.1|1705106_1706153_-|portal	Presumed portal vertex protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
AYS12311.1|1706152_1707904_-|terminase	Phage terminase ATPase subunit	terminase	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
AYS12312.1|1708058_1708895_+|capsid	Phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.2	7.2e-119
AYS12313.1|1708918_1709971_+|capsid	Phage major capsid protein	capsid	A0A0A7NQ82	Enterobacteria_phage	99.7	1.5e-198
AYS12314.1|1710016_1710817_+|terminase	Phage terminase endonuclease subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	98.1	7.8e-139
AYS12315.1|1710918_1711413_+	Head completion/stabilization protein	NA	A0A0A7NPU2	Enterobacteria_phage	98.8	3.0e-88
AYS12316.1|1711412_1711613_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
AYS12317.1|1711615_1711939_+	hypothetical protein	NA	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
AYS12318.1|1711935_1712328_+	peptidase M15	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
AYS12319.1|1712324_1712732_+	hypothetical protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.0	6.5e-65
AYS12320.1|1712869_1713337_+|tail	tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
AYS12321.1|1713320_1713965_+|tail	Phage tail completion protein	tail	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
AYS12322.1|1713961_1714543_+|plate	Baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	8.6e-103
AYS12323.1|1714539_1714890_+|plate	Phage baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
AYS12324.1|1714893_1715790_+|plate	Baseplate assembly protein J	plate	A0A0A7NPY5	Enterobacteria_phage	99.0	1.2e-156
AYS12325.1|1715782_1716313_+|tail	Phage tail fiber	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	2.1e-92
AYS12326.1|1716315_1718481_+	hypothetical protein	NA	A0A0A7NV63	Enterobacteria_phage	82.7	0.0e+00
AYS12327.1|1718482_1719010_+|tail	Phage tail fiber	tail	A0A0C4UR05	Shigella_phage	94.9	8.9e-91
AYS12328.1|1719038_1719572_-|tail	Phage tail fiber	tail	C9DGR0	Escherichia_phage	98.9	3.2e-96
AYS12329.1|1719574_1720468_-	hypothetical protein	NA	C9DGR1	Escherichia_phage	99.3	1.1e-178
AYS12330.1|1720599_1721187_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	97.9	2.3e-103
AYS12331.1|1721222_1721711_-|tail	tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
AYS12332.1|1721723_1724531_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	98.1	0.0e+00
AYS12333.1|1724681_1725056_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
AYS12334.1|1725111_1725624_-|tail	tail protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
AYS12335.1|1725623_1726808_-|tail	tail protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	3.4e-223
AYS12336.1|1726965_1728069_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.8	1.1e-194
AYS12337.1|1728233_1728869_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
AYS12338.1|1728865_1729978_-	molybdenum cofactor biosynthesis protein A	NA	NA	NA	NA	NA
AYS12339.1|1729970_1731359_-	Chondro-6-sulfatase	NA	S5VT21	Leptospira_phage	27.4	1.3e-48
AYS12340.1|1731358_1731631_-	His-Xaa-Ser system protein HsxD	NA	NA	NA	NA	NA
AYS12341.1|1731883_1732144_+	hypothetical protein	NA	NA	NA	NA	NA
AYS12342.1|1732334_1732475_+	hok/gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
AYS12343.1|1732883_1733183_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AYS12344.1|1733187_1735575_-|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AYS12345.1|1735590_1736574_-|tRNA	phenylalanyl-tRNA synthetase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
AYS12346.1|1736875_1737232_-	50S ribosomal subunit protein L20	NA	NA	NA	NA	NA
AYS12347.1|1737282_1737480_-	50S ribosomal subunit protein L35	NA	NA	NA	NA	NA
AYS12348.1|1737575_1738118_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	6.3e-15
AYS12349.1|1738121_1740050_-|tRNA	threonyl-tRNA synthetase	tRNA	A0A2K9L297	Tupanvirus	37.6	1.6e-129
AYS12350.1|1740632_1740761_+	hypothetical protein	NA	NA	NA	NA	NA
AYS12351.1|1740941_1742165_+	O-antigen polymerase	NA	NA	NA	NA	NA
AYS12352.1|1743718_1744033_-	hypothetical protein	NA	NA	NA	NA	NA
AYS12353.1|1744175_1745135_+	outer membrane protein	NA	NA	NA	NA	NA
AYS12354.1|1745183_1745942_-	outer membrane protein	NA	NA	NA	NA	NA
AYS12355.1|1746230_1747163_+	6-phosphofructokinase isozyme	NA	NA	NA	NA	NA
AYS12356.1|1747259_1747550_+	hypothetical protein	NA	NA	NA	NA	NA
AYS12357.1|1747656_1748517_+	hypothetical protein	NA	NA	NA	NA	NA
AYS12358.1|1748559_1749096_-	hypothetical protein	NA	NA	NA	NA	NA
AYS12359.1|1749244_1749913_+	hydrolase	NA	NA	NA	NA	NA
AYS12360.1|1750050_1750650_+	hypothetical protein	NA	NA	NA	NA	NA
AYS12361.1|1750786_1752178_+	sodium:dicarboxylate symporter	NA	NA	NA	NA	NA
AYS12362.1|1752280_1752523_-	cell division activator CedA	NA	NA	NA	NA	NA
AYS12363.1|1752739_1754992_+	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	50.0	1.3e-143
AYS12364.1|1755108_1755567_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 5
CP029928	Salmonella enterica subsp. enterica serovar Typhi strain 311189_216103 chromosome, complete genome	4799426	1823840	1828252	4799426		Escherichia_phage(50.0%)	6	NA	NA
AYS12435.1|1823840_1824080_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
AYS12436.1|1824952_1825762_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYS12437.1|1825834_1826212_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYS12438.1|1826359_1826902_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYS12439.1|1827093_1827822_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYS12440.1|1827838_1828252_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 6
CP029928	Salmonella enterica subsp. enterica serovar Typhi strain 311189_216103 chromosome, complete genome	4799426	2032146	2039380	4799426		Morganella_phage(33.33%)	7	NA	NA
AYS12630.1|2032146_2033577_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYS12631.1|2033650_2034346_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYS12632.1|2034425_2034737_-	hypothetical protein	NA	NA	NA	NA	NA
AYS12633.1|2035387_2036572_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYS12634.1|2037031_2037244_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYS12635.1|2037689_2038958_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYS12636.1|2038960_2039380_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 7
CP029928	Salmonella enterica subsp. enterica serovar Typhi strain 311189_216103 chromosome, complete genome	4799426	2123122	2133629	4799426		Enterobacteria_phage(37.5%)	10	NA	NA
AYS12713.1|2123122_2124436_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYS12714.1|2124462_2125542_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYS12715.1|2125546_2126320_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYS12716.1|2126335_2127310_-	reductase RfbI	NA	NA	NA	NA	NA
AYS12717.1|2127315_2127867_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYS12718.1|2127867_2128746_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYS12719.1|2128793_2129693_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYS12720.1|2129692_2130778_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYS12721.1|2131154_2132048_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYS12722.1|2132225_2133629_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 8
CP029928	Salmonella enterica subsp. enterica serovar Typhi strain 311189_216103 chromosome, complete genome	4799426	2209521	2218692	4799426	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYS12780.1|2209521_2211555_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYS12781.1|2211795_2212254_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYS12782.1|2212425_2212956_+	lipoprotein	NA	NA	NA	NA	NA
AYS12783.1|2213012_2213480_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYS12784.1|2213526_2214246_-	two-component system response regulator	NA	NA	NA	NA	NA
AYS12785.1|2214242_2215928_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYS12786.1|2216150_2216882_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYS12787.1|2216941_2217049_+	hypothetical protein	NA	NA	NA	NA	NA
AYS12788.1|2217029_2217761_-	ABC transporter permease	NA	NA	NA	NA	NA
AYS12789.1|2217744_2218692_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 9
CP029928	Salmonella enterica subsp. enterica serovar Typhi strain 311189_216103 chromosome, complete genome	4799426	2754192	2767584	4799426	tail	Salmonella_phage(70.0%)	11	NA	NA
AYS13218.1|2754192_2754411_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYS13219.1|2754501_2755602_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS13220.1|2755598_2756084_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS13221.1|2756080_2759158_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYS13222.1|2759150_2759270_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS13223.1|2759284_2759587_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS13224.1|2759641_2760157_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS13225.1|2760166_2761339_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS13226.1|2761481_2762054_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS13227.1|2762731_2763847_+	glycosyltransferase	NA	NA	NA	NA	NA
AYS13228.1|2763927_2767584_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 10
CP029928	Salmonella enterica subsp. enterica serovar Typhi strain 311189_216103 chromosome, complete genome	4799426	3084856	3128559	4799426	protease,tRNA,bacteriocin,transposase	Bacillus_virus(33.33%)	44	NA	NA
AYS13516.1|3084856_3085315_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS13517.1|3085504_3086584_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYS13518.1|3086685_3087849_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYS13519.1|3087870_3088917_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYS13520.1|3089290_3089716_+	hypothetical protein	NA	NA	NA	NA	NA
AYS13521.1|3089741_3090320_+	hypothetical protein	NA	NA	NA	NA	NA
AYS13522.1|3090353_3091028_+	hypothetical protein	NA	NA	NA	NA	NA
AYS13523.1|3091009_3091693_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYS13524.1|3091686_3092343_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYS13525.1|3092447_3092906_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS13526.1|3093094_3095086_-	transketolase	NA	NA	NA	NA	NA
AYS13527.1|3095361_3096120_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYS13528.1|3096220_3097141_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYS13529.1|3097368_3099345_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYS13530.1|3099353_3099485_-	hypothetical protein	NA	NA	NA	NA	NA
AYS13531.1|3099779_3100079_-	membrane protein	NA	NA	NA	NA	NA
AYS13532.1|3100134_3101289_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYS13533.1|3101781_3103176_+	galactose-proton symport	NA	NA	NA	NA	NA
AYS13534.1|3103254_3103752_+	hypothetical protein	NA	NA	NA	NA	NA
AYS13535.1|3103847_3104555_+	endonuclease I	NA	NA	NA	NA	NA
AYS13536.1|3104631_3105363_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYS13537.1|3105382_3106330_+	glutathione synthetase	NA	NA	NA	NA	NA
AYS13538.1|3106545_3107109_+	hypothetical protein	NA	NA	NA	NA	NA
AYS13539.1|3107108_3107525_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYS13540.1|3107571_3108258_-	global regulatory protein	NA	NA	NA	NA	NA
AYS13541.1|3108387_3109368_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYS13542.1|3109385_3110090_+	hypothetical protein	NA	NA	NA	NA	NA
AYS13543.1|3110108_3110675_+	hypothetical protein	NA	NA	NA	NA	NA
AYS13544.1|3110671_3110962_+	hypothetical protein	NA	NA	NA	NA	NA
AYS13545.1|3110969_3111563_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYS13546.1|3111555_3112692_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYS13547.1|3112782_3113790_-	hypothetical protein	NA	NA	NA	NA	NA
AYS13548.1|3113922_3114969_-	L-asparaginase	NA	NA	NA	NA	NA
AYS13549.1|3115287_3115746_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS13550.1|3115868_3116588_-	hypothetical protein	NA	NA	NA	NA	NA
AYS13551.1|3116637_3116964_-	hypothetical protein	NA	NA	NA	NA	NA
AYS13552.1|3116963_3117683_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYS13553.1|3117837_3118890_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYS13554.1|3118917_3119193_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYS13555.1|3119305_3120391_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYS13556.1|3120607_3121864_+	nucleoside permease	NA	NA	NA	NA	NA
AYS13557.1|3124474_3125182_+	hypothetical protein	NA	NA	NA	NA	NA
AYS13558.1|3127771_3128038_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYS13559.1|3128280_3128559_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 11
CP029928	Salmonella enterica subsp. enterica serovar Typhi strain 311189_216103 chromosome, complete genome	4799426	3505546	3543604	4799426	terminase,tail,plate,portal,integrase,transposase,capsid	Salmonella_phage(82.05%)	46	3500510:3500524	3512676:3512690
3500510:3500524	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYS13888.1|3505546_3507193_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYS13889.1|3507332_3507431_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYS13890.1|3507686_3508016_+	hypothetical protein	NA	NA	NA	NA	NA
AYS13891.1|3508056_3509109_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYS13892.1|3509504_3510074_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYS13893.1|3510199_3510421_+	hypothetical protein	NA	NA	NA	NA	NA
AYS13894.1|3510453_3510963_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYS13895.1|3511137_3511362_+	hypothetical protein	NA	NA	NA	NA	NA
AYS13896.1|3511384_3511726_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYS13897.1|3511793_3512027_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYS13898.1|3512026_3512254_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYS13899.1|3512250_3513108_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3512676:3512690	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYS13900.1|3513104_3515519_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYS13901.1|3515672_3515861_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYS13902.1|3517828_3518743_+	hypothetical protein	NA	NA	NA	NA	NA
AYS13903.1|3518739_3519480_+	hypothetical protein	NA	NA	NA	NA	NA
AYS13904.1|3519514_3520552_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYS13905.1|3520551_3522318_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYS13906.1|3522460_3523294_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYS13907.1|3523310_3524369_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYS13908.1|3524372_3525023_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYS13909.1|3525055_3525583_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYS13910.1|3525582_3525786_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYS13911.1|3525789_3526005_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYS13912.1|3526024_3526498_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYS13913.1|3526499_3526877_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYS13914.1|3526873_3527302_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYS13915.1|3527397_3527829_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYS13916.1|3527821_3528268_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYS13917.1|3528336_3528915_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYS13918.1|3528911_3529271_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYS13919.1|3529257_3530166_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYS13920.1|3530158_3530764_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS13921.1|3530760_3532275_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.0	3.4e-199
AYS13922.1|3532274_3532868_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYS13923.1|3532839_3533280_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYS13924.1|3533702_3534275_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS13925.1|3534417_3535590_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS13926.1|3535599_3536115_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS13927.1|3536169_3536472_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS13928.1|3536486_3536606_+	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS13929.1|3536598_3539676_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYS13930.1|3539672_3540158_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS13931.1|3540154_3541255_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS13932.1|3541345_3541564_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYS13933.1|3543145_3543604_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 12
CP029928	Salmonella enterica subsp. enterica serovar Typhi strain 311189_216103 chromosome, complete genome	4799426	4459115	4533298	4799426	terminase,tail,plate,portal,integrase,capsid	Salmonella_phage(82.61%)	75	4520635:4520651	4533457:4533473
AYS14705.1|4459115_4461065_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYS14706.1|4461136_4462045_+	hypothetical protein	NA	NA	NA	NA	NA
AYS14707.1|4462118_4463018_+	hypothetical protein	NA	NA	NA	NA	NA
AYS14708.1|4463059_4463419_+	hypothetical protein	NA	NA	NA	NA	NA
AYS14709.1|4463518_4463788_-	hypothetical protein	NA	NA	NA	NA	NA
AYS14710.1|4463919_4465194_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYS14711.1|4465413_4465791_+	hypothetical protein	NA	NA	NA	NA	NA
AYS14712.1|4465877_4466096_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYS14713.1|4466163_4467264_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYS14714.1|4467260_4467746_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYS14715.1|4467745_4470526_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYS14716.1|4470518_4470638_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYS14717.1|4470652_4470955_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYS14718.1|4471009_4471525_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYS14719.1|4471534_4472707_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYS14720.1|4473241_4473964_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYS14721.1|4474161_4474569_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYS14722.1|4474575_4476195_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYS14723.1|4476191_4476797_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS14724.1|4476789_4477698_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYS14725.1|4477684_4478044_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYS14726.1|4478040_4478619_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYS14727.1|4478687_4479134_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYS14728.1|4479126_4479558_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
AYS14729.1|4479653_4480079_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYS14730.1|4480078_4480456_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYS14731.1|4480460_4480931_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYS14732.1|4480950_4481166_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYS14733.1|4481169_4481373_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYS14734.1|4481372_4481837_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYS14735.1|4481930_4482581_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYS14736.1|4482584_4483649_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYS14737.1|4483665_4484499_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYS14738.1|4484641_4486408_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYS14739.1|4486404_4487451_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYS14740.1|4487499_4488195_-	hypothetical protein	NA	NA	NA	NA	NA
AYS14741.1|4488214_4489279_-	hypothetical protein	NA	NA	NA	NA	NA
AYS14742.1|4489275_4490340_-	hypothetical protein	NA	NA	NA	NA	NA
AYS14743.1|4491264_4493679_-	replication endonuclease from prophage-like region 2	NA	A0A1S6L028	Salmonella_phage	94.9	0.0e+00
AYS14744.1|4493669_4494530_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYS14745.1|4494526_4495111_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYS14746.1|4495107_4495335_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYS14747.1|4495334_4495568_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYS14748.1|4495635_4495977_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYS14749.1|4495940_4496141_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYS14750.1|4496148_4496658_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYS14751.1|4496690_4496933_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYS14752.1|4497049_4497682_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYS14753.1|4497685_4498711_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYS14754.1|4498817_4499171_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYS14755.1|4499787_4500075_+	hypothetical protein	NA	NA	NA	NA	NA
AYS14756.1|4500085_4500976_+	methyltransferase	NA	NA	NA	NA	NA
AYS14757.1|4500975_4501722_+	hypothetical protein	NA	NA	NA	NA	NA
AYS14758.1|4502023_4503994_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS14759.1|4504013_4505318_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS14760.1|4505340_4506036_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYS14761.1|4506061_4506856_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS14762.1|4506865_4507933_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS14763.1|4507977_4509714_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYS14764.1|4509713_4512209_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS14765.1|4512232_4513279_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYS14766.1|4513281_4514559_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYS14767.1|4514803_4515343_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS14768.1|4516196_4517708_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYS14769.1|4517691_4519281_+	hypothetical protein	NA	NA	NA	NA	NA
AYS14770.1|4519444_4520458_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4520635:4520651	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYS14771.1|4520884_4521178_+	hypothetical protein	NA	NA	NA	NA	NA
AYS14772.1|4521174_4521663_+	hypothetical protein	NA	NA	NA	NA	NA
AYS14773.1|4521842_4522295_-	hypothetical protein	NA	NA	NA	NA	NA
AYS14774.1|4527517_4527979_+	hypothetical protein	NA	NA	NA	NA	NA
AYS14775.1|4527975_4528197_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYS14776.1|4529053_4529836_+	hypothetical protein	NA	NA	NA	NA	NA
AYS14777.1|4530462_4530687_-	hypothetical protein	NA	NA	NA	NA	NA
AYS14778.1|4530816_4531728_-	hypothetical protein	NA	NA	NA	NA	NA
AYS14779.1|4532038_4533298_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4533457:4533473	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 13
CP029928	Salmonella enterica subsp. enterica serovar Typhi strain 311189_216103 chromosome, complete genome	4799426	4675544	4682020	4799426	capsid	Enterobacteria_phage(66.67%)	8	NA	NA
AYS14916.1|4675544_4676621_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYS14917.1|4676617_4677691_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYS14918.1|4677665_4678829_-	hypothetical protein	NA	NA	NA	NA	NA
AYS14919.1|4679104_4679671_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYS14920.1|4679686_4679926_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYS14921.1|4679929_4680790_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYS14922.1|4681212_4681536_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYS14923.1|4681519_4682020_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
>prophage 1
CP029929	Salmonella enterica subsp. enterica serovar Typhi strain 311189_216103 plasmid pHCM2, complete sequence	106706	69	19259	106706		Salmonella_phage(100.0%)	19	NA	NA
AYS15018.1|69_564_-	hypothetical protein	NA	J9Q6J3	Salmonella_phage	97.6	2.3e-88
AYS15019.1|639_1284_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	2.4e-122
AYS15020.1|2028_3084_+	putative replication protein A	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
AYS15021.1|3612_3816_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	4.0e-31
AYS15022.1|3815_4121_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	90.8	4.9e-33
AYS15023.1|4161_4437_-	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.9e-46
AYS15024.1|4505_4916_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.1	1.4e-75
AYS15025.1|4899_5271_-	hypothetical protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
AYS15026.1|5433_6276_-	putative lipoprotein	NA	J9Q7Z4	Salmonella_phage	97.1	2.3e-125
AYS15027.1|6571_7648_-	putative recombinase	NA	J9Q736	Salmonella_phage	99.7	5.5e-204
AYS15028.1|7650_7917_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AYS15029.1|7916_8861_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.4	6.8e-182
AYS15030.1|8921_9950_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.8	1.1e-164
AYS15031.1|10069_10501_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	100.0	4.0e-73
AYS15032.1|10746_11337_+	hypothetical protein	NA	NA	NA	NA	NA
AYS15033.1|11430_11874_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	97.9	3.0e-71
AYS15034.1|11870_15389_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.1	0.0e+00
AYS15035.1|15569_16805_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	99.5	1.8e-238
AYS15036.1|16901_19259_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	90.7	0.0e+00
>prophage 2
CP029929	Salmonella enterica subsp. enterica serovar Typhi strain 311189_216103 plasmid pHCM2, complete sequence	106706	27749	106012	106706	tail	Salmonella_phage(94.51%)	93	NA	NA
AYS15049.1|27749_28055_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
AYS15050.1|28051_28204_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	96.0	7.6e-19
AYS15051.1|28203_28410_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	8.1e-32
AYS15052.1|28575_29898_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.4	5.8e-256
AYS15053.1|29932_30190_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	92.9	4.9e-34
AYS15054.1|30490_31285_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.2	4.9e-141
AYS15055.1|31468_32521_+	hypothetical protein	NA	J9Q6F5	Salmonella_phage	56.7	1.9e-92
AYS15056.1|32522_33734_-	hypothetical protein	NA	J9Q720	Salmonella_phage	96.5	6.6e-214
AYS15057.1|33796_35137_-	putative DNA helicase	NA	J9Q7G4	Salmonella_phage	99.6	3.8e-247
AYS15058.1|35197_35923_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.3	2.4e-139
AYS15059.1|36200_37256_+	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	42.6	5.1e-61
AYS15060.1|37325_38081_-	hypothetical protein	NA	J9Q7Y9	Salmonella_phage	43.0	3.2e-57
AYS15061.1|38129_38489_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
AYS15062.1|38488_39154_-	hypothetical protein	NA	J9Q7R7	Salmonella_phage	95.0	8.0e-113
AYS15063.1|39484_40036_+	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	39.8	7.8e-29
AYS15064.1|40086_40431_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	83.6	5.9e-27
AYS15065.1|40499_41219_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	95.7	1.5e-125
AYS15066.1|41205_41529_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	2.7e-50
AYS15067.1|41643_44196_-	hypothetical protein	NA	A0A0A0YQM3	Citrobacter_virus	52.5	1.4e-152
AYS15068.1|44278_48667_-|tail	putative phage tail protein	tail	J9Q713	Salmonella_phage	86.7	0.0e+00
AYS15069.1|48681_49269_-|tail	putative phage tail protein	tail	J9Q7F8	Salmonella_phage	92.3	1.1e-102
AYS15070.1|49256_50054_-	hypothetical protein	NA	J9Q7R4	Salmonella_phage	95.8	1.2e-155
AYS15071.1|50046_50778_-|tail	putative phage tail protein	tail	J9Q7Y5	Salmonella_phage	99.1	3.3e-136
AYS15072.1|50834_51170_-	hypothetical protein	NA	J9Q6E1	Salmonella_phage	97.3	5.7e-59
AYS15073.1|51211_55795_-	hypothetical protein	NA	J9Q712	Salmonella_phage	92.9	0.0e+00
AYS15074.1|55802_56072_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AYS15075.1|56152_56470_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
AYS15076.1|56529_57276_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	96.8	7.8e-125
AYS15077.1|57350_57734_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
AYS15078.1|57735_58209_-	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
AYS15079.1|58199_58544_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
AYS15080.1|58641_59475_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	100.0	2.6e-153
AYS15081.1|59474_59909_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
AYS15082.1|59952_60876_-	hypothetical protein	NA	J9Q6D6	Salmonella_phage	100.0	3.3e-157
AYS15083.1|60950_61826_-	hypothetical protein	NA	J9Q710	Salmonella_phage	100.0	3.8e-163
AYS15084.1|61852_62749_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.6	5.7e-146
AYS15085.1|62771_64346_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	3.2e-301
AYS15086.1|64379_65636_-	hypothetical protein	NA	J9Q7Y2	Salmonella_phage	99.8	5.3e-251
AYS15087.1|65638_66280_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	99.5	1.8e-109
AYS15088.1|66475_66742_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
AYS15089.1|66751_67651_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	4.0e-168
AYS15090.1|67647_67902_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AYS15091.1|67894_68533_-	putative ABC transporter ATP-binding protein	NA	J9Q807	Salmonella_phage	99.1	5.5e-111
AYS15092.1|68529_69198_-	hypothetical protein	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
AYS15093.1|69197_69878_-	hypothetical protein	NA	J9Q756	Salmonella_phage	99.6	7.4e-122
AYS15094.1|69960_71520_+	putative helicase	NA	J9Q7I4	Salmonella_phage	99.4	5.7e-295
AYS15095.1|71522_71801_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
AYS15096.1|71860_72283_+	putative lipoprotein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
AYS15097.1|72287_72815_+	putative transcriptional regulator	NA	J9Q6L0	Salmonella_phage	96.6	4.1e-80
AYS15098.1|73449_74100_+	hypothetical protein	NA	J9Q754	Salmonella_phage	100.0	1.4e-114
AYS15099.1|74184_74412_+	hypothetical protein	NA	NA	NA	NA	NA
AYS15100.1|75043_75526_-	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	5.5e-87
AYS15101.1|75731_76019_-	hypothetical protein	NA	J9Q753	Salmonella_phage	94.6	1.5e-47
AYS15102.1|76139_76532_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	65.4	1.7e-41
AYS15103.1|76660_76972_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	92.2	1.1e-45
AYS15104.1|77048_77363_-	hypothetical protein	NA	NA	NA	NA	NA
AYS15105.1|77457_77676_-	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
AYS15106.1|77686_77902_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	95.8	4.5e-33
AYS15107.1|78044_78290_+	hypothetical protein	NA	J9Q751	Salmonella_phage	92.5	5.8e-37
AYS15108.1|79726_80917_-	hypothetical protein	NA	J9Q803	Salmonella_phage	54.6	5.4e-120
AYS15109.1|80926_81244_-	hypothetical protein	NA	J9Q750	Salmonella_phage	80.0	8.1e-47
AYS15110.1|81328_81610_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.6	3.2e-31
AYS15111.1|81783_81987_+	hypothetical protein	NA	J9Q802	Salmonella_phage	95.5	1.5e-30
AYS15112.1|82047_82335_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	58.8	9.9e-28
AYS15113.1|82331_82640_-	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	56.9	3.0e-14
AYS15114.1|82651_83194_-	hypothetical protein	NA	J9Q748	Salmonella_phage	93.1	2.6e-93
AYS15115.1|83190_83832_-	hypothetical protein	NA	J9Q7H7	Salmonella_phage	100.0	9.7e-116
AYS15116.1|83923_84295_-	hypothetical protein	NA	J9Q7T4	Salmonella_phage	100.0	3.2e-63
AYS15117.1|84405_84579_-	hypothetical protein	NA	J9Q801	Salmonella_phage	98.2	9.5e-26
AYS15118.1|84575_85265_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	98.3	6.1e-124
AYS15119.1|85323_87027_-	putative DNA modification methylase	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
AYS15120.1|87150_87723_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	8.2e-98
AYS15121.1|87831_88674_-	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
AYS15122.1|88782_88971_-	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
AYS15123.1|88980_89475_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	96.3	1.9e-79
AYS15124.1|89617_90226_-	putative ribonuclease H	NA	J9Q745	Salmonella_phage	99.5	2.2e-117
AYS15125.1|90811_91042_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
AYS15126.1|91244_91838_-	hypothetical protein	NA	J9Q7T2	Salmonella_phage	99.5	4.6e-112
AYS15127.1|92023_92950_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	85.4	4.1e-107
AYS15128.1|92994_93552_-	hypothetical protein	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
AYS15129.1|93561_93981_-	hypothetical protein	NA	J9Q743	Salmonella_phage	98.6	2.9e-68
AYS15130.1|94044_94689_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
AYS15131.1|94688_95165_-	hypothetical protein	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
AYS15132.1|95161_95575_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
AYS15133.1|95576_96692_-	putative thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.1	7.6e-217
AYS15134.1|96807_97737_-	hypothetical protein	NA	J9Q742	Salmonella_phage	99.0	3.8e-161
AYS15135.1|97819_98962_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.5	2.4e-218
AYS15136.1|99069_101385_-	ribonucleotide-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
AYS15137.1|101462_102032_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	1.7e-103
AYS15138.1|102044_102791_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.0	4.4e-136
AYS15139.1|102780_104697_-	exonuclease	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
AYS15140.1|104693_104930_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
AYS15141.1|104926_106012_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.9	2.7e-206
