The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029927	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217103 chromosome, complete genome	4778473	930169	937481	4778473	protease,integrase	Dickeya_phage(16.67%)	6	931420:931434	942412:942426
AYS15938.1|930169_931288_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYS15939.1|931284_933231_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931420:931434	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYS15940.1|933360_933582_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYS15941.1|933905_934226_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYS15942.1|934256_936533_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYS15943.1|937103_937481_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942412:942426	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029927	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217103 chromosome, complete genome	4778473	1008419	1085733	4778473	protease,tail,integrase,transposase,terminase	Salmonella_phage(73.33%)	93	990498:990517	1061093:1061112
990498:990517	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS15993.1|1008419_1009760_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYS15994.1|1009756_1010005_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYS15995.1|1010045_1010291_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS15996.1|1010290_1011172_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYS15997.1|1011168_1012233_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYS15998.1|1012310_1012991_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYS15999.1|1012987_1013773_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYS16000.1|1013778_1014075_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYS16001.1|1014165_1014366_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYS16002.1|1014654_1015059_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYS16003.1|1015390_1015765_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYS16004.1|1015849_1016833_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYS16005.1|1016835_1017585_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYS16006.1|1017595_1017943_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	3.7e-53
AYS16007.1|1017939_1018464_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYS16008.1|1018463_1018937_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYS16009.1|1018940_1019513_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYS16010.1|1019606_1019873_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS16011.1|1019954_1020116_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS16012.1|1020548_1021046_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS16013.1|1021230_1021470_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYS16014.1|1021459_1021765_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYS16015.1|1021804_1022407_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYS16016.1|1022615_1023227_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYS16017.1|1023359_1024157_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS16018.1|1024555_1024681_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS16019.1|1024816_1025266_-	lipoprotein	NA	NA	NA	NA	NA
AYS16020.1|1025482_1025872_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYS16021.1|1025858_1026140_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYS16022.1|1026139_1026754_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYS16023.1|1026973_1027228_+	hypothetical protein	NA	NA	NA	NA	NA
AYS16024.1|1027332_1027710_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYS16025.1|1027773_1028034_+	hypothetical protein	NA	NA	NA	NA	NA
AYS16026.1|1028123_1028876_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYS16027.1|1028841_1030245_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYS16028.1|1030244_1031714_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYS16029.1|1031805_1032336_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYS16030.1|1032350_1033583_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYS16031.1|1033587_1034085_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYS16032.1|1034096_1035038_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYS16033.1|1035079_1035448_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYS16034.1|1035413_1035821_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYS16035.1|1035817_1036372_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYS16036.1|1036358_1036748_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYS16037.1|1036722_1037286_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYS16038.1|1037289_1038435_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYS16039.1|1038446_1038887_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.0	7.8e-56
AYS16040.1|1038890_1039343_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYS16041.1|1039520_1041473_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYS16042.1|1041472_1042123_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYS16043.1|1042126_1042429_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYS16044.1|1042431_1043463_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYS16045.1|1043459_1043795_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYS16046.1|1043989_1044721_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS16047.1|1044720_1045149_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS16048.1|1045207_1045963_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYS16049.1|1046050_1046188_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYS16050.1|1046203_1046557_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYS16051.1|1046557_1047757_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYS16052.1|1047753_1048434_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYS16053.1|1048433_1049945_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYS16054.1|1049959_1050478_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYS16055.1|1051399_1052101_-	hypothetical protein	NA	NA	NA	NA	NA
AYS16056.1|1052413_1052692_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYS16057.1|1053117_1055730_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYS16058.1|1055937_1056948_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYS16059.1|1057110_1057656_+	hypothetical protein	NA	NA	NA	NA	NA
AYS16060.1|1057652_1058762_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYS16061.1|1058860_1060969_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYS16062.1|1060981_1062889_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061093:1061112	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS16063.1|1062903_1064157_+	inner membrane protein	NA	NA	NA	NA	NA
AYS16064.1|1064161_1065802_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYS16065.1|1065798_1066362_+	lipoprotein	NA	NA	NA	NA	NA
AYS16066.1|1066615_1066783_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYS16067.1|1066882_1067401_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYS16068.1|1067469_1069230_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYS16069.1|1069415_1069868_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYS16070.1|1069939_1070992_-	outer membrane protein A	NA	NA	NA	NA	NA
AYS16071.1|1071347_1071857_-	cell division inhibitor	NA	NA	NA	NA	NA
AYS16072.1|1072073_1072679_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYS16073.1|1072665_1074819_-	inner membrane protein	NA	NA	NA	NA	NA
AYS16074.1|1074837_1075284_-	hypothetical protein	NA	NA	NA	NA	NA
AYS16075.1|1075407_1077462_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYS16076.1|1077497_1077956_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYS16077.1|1078050_1078713_-	hypothetical protein	NA	NA	NA	NA	NA
AYS16078.1|1078883_1079300_+	hypothetical protein	NA	NA	NA	NA	NA
AYS16079.1|1079344_1079662_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYS16080.1|1079719_1080931_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYS16081.1|1082062_1082521_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS16082.1|1083257_1083539_+	acylphosphatase	NA	NA	NA	NA	NA
AYS16083.1|1083535_1083865_-	sulfite reductase	NA	NA	NA	NA	NA
AYS16084.1|1083951_1084611_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYS16085.1|1085274_1085733_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029927	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217103 chromosome, complete genome	4778473	1530655	1573899	4778473	protease,head,tail,transposase,plate	Burkholderia_virus(47.06%)	54	NA	NA
AYS16483.1|1530655_1531114_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS16484.1|1531616_1531898_+	stress response protein	NA	NA	NA	NA	NA
AYS16485.1|1532166_1532988_+|protease	serine protease	protease	NA	NA	NA	NA
AYS16486.1|1533022_1533352_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYS16487.1|1533338_1533701_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYS16488.1|1533812_1533983_-	hypothetical protein	NA	NA	NA	NA	NA
AYS16489.1|1534117_1535152_+	hypothetical protein	NA	NA	NA	NA	NA
AYS16490.1|1535326_1536715_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYS16491.1|1536725_1538255_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYS16492.1|1538781_1539726_+	hypothetical protein	NA	NA	NA	NA	NA
AYS16493.1|1539907_1540297_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYS16494.1|1540268_1540721_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYS16495.1|1540915_1541146_-	hypothetical protein	NA	NA	NA	NA	NA
AYS16496.1|1541142_1541826_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYS16497.1|1541822_1542038_-	hypothetical protein	NA	NA	NA	NA	NA
AYS16498.1|1542030_1542414_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYS16499.1|1542410_1542713_-	hypothetical protein	NA	NA	NA	NA	NA
AYS16500.1|1542722_1542995_-	hypothetical protein	NA	NA	NA	NA	NA
AYS16501.1|1543283_1543814_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYS16502.1|1543841_1544111_-	hypothetical protein	NA	NA	NA	NA	NA
AYS16503.1|1544113_1545280_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYS16504.1|1545290_1547060_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYS16505.1|1547237_1547669_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYS16506.1|1547664_1548261_+	hypothetical protein	NA	NA	NA	NA	NA
AYS16507.1|1548504_1548855_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYS16508.1|1549569_1550220_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYS16509.1|1550216_1550543_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYS16510.1|1550542_1550854_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYS16511.1|1550853_1551399_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYS16512.1|1551395_1552991_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYS16513.1|1552990_1554487_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYS16514.1|1554467_1555289_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYS16515.1|1555291_1555750_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYS16516.1|1555964_1557080_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYS16517.1|1557094_1558048_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYS16518.1|1558057_1558396_+	hypothetical protein	NA	NA	NA	NA	NA
AYS16519.1|1558397_1558844_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYS16520.1|1558843_1559308_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYS16521.1|1559304_1559559_+	hypothetical protein	NA	NA	NA	NA	NA
AYS16522.1|1559548_1560976_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYS16523.1|1560975_1561497_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYS16524.1|1561499_1561781_+	hypothetical protein	NA	NA	NA	NA	NA
AYS16525.1|1561878_1562214_+	hypothetical protein	NA	NA	NA	NA	NA
AYS16526.1|1562389_1564855_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYS16527.1|1564854_1565739_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYS16528.1|1565938_1567093_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYS16529.1|1567089_1567617_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYS16530.1|1567673_1568021_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYS16531.1|1568011_1569115_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYS16532.1|1569107_1569686_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYS16533.1|1569688_1570714_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYS16534.1|1571227_1571845_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYS16535.1|1572337_1572730_-	hypothetical protein	NA	Q9MCR6	Enterobacteria_phage	51.1	6.8e-19
AYS16536.1|1573326_1573899_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
>prophage 4
CP029927	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217103 chromosome, complete genome	4778473	1785270	1789682	4778473		Escherichia_phage(50.0%)	6	NA	NA
AYS16745.1|1785270_1785510_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
AYS16746.1|1786382_1787192_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYS16747.1|1787264_1787642_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYS16748.1|1787789_1788332_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYS16749.1|1788523_1789252_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYS16750.1|1789268_1789682_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029927	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217103 chromosome, complete genome	4778473	2084545	2095052	4778473		Enterobacteria_phage(37.5%)	10	NA	NA
AYS17023.1|2084545_2085859_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYS17024.1|2085885_2086965_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYS17025.1|2086969_2087743_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYS17026.1|2087758_2088733_-	reductase RfbI	NA	NA	NA	NA	NA
AYS17027.1|2088738_2089290_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYS17028.1|2089290_2090169_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYS17029.1|2090216_2091116_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYS17030.1|2091115_2092201_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYS17031.1|2092577_2093471_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYS17032.1|2093648_2095052_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 6
CP029927	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217103 chromosome, complete genome	4778473	2170944	2180115	4778473	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYS17091.1|2170944_2172978_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYS17092.1|2173218_2173677_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYS17093.1|2173848_2174379_+	lipoprotein	NA	NA	NA	NA	NA
AYS17094.1|2174435_2174903_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYS17095.1|2174949_2175669_-	two-component system response regulator	NA	NA	NA	NA	NA
AYS17096.1|2175665_2177351_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYS17097.1|2177573_2178305_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYS17098.1|2178364_2178472_+	hypothetical protein	NA	NA	NA	NA	NA
AYS17099.1|2178452_2179184_-	ABC transporter permease	NA	NA	NA	NA	NA
AYS17100.1|2179167_2180115_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 7
CP029927	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217103 chromosome, complete genome	4778473	2715583	2728975	4778473	tail	Salmonella_phage(70.0%)	11	NA	NA
AYS17528.1|2715583_2715802_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYS17529.1|2715892_2716993_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS17530.1|2716989_2717475_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS17531.1|2717471_2720549_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYS17532.1|2720541_2720661_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS17533.1|2720675_2720978_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS17534.1|2721032_2721548_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS17535.1|2721557_2722730_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS17536.1|2722872_2723445_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS17537.1|2724122_2725238_+	glycosyltransferase	NA	NA	NA	NA	NA
AYS17538.1|2725318_2728975_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 8
CP029927	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217103 chromosome, complete genome	4778473	3047033	3090735	4778473	transposase,bacteriocin,protease,tRNA	Bacillus_virus(33.33%)	44	NA	NA
AYS17829.1|3047033_3047492_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS17830.1|3047681_3048761_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYS17831.1|3048862_3050026_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYS17832.1|3050047_3051094_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYS17833.1|3051467_3051893_+	hypothetical protein	NA	NA	NA	NA	NA
AYS17834.1|3051918_3052497_+	hypothetical protein	NA	NA	NA	NA	NA
AYS17835.1|3052530_3053205_+	hypothetical protein	NA	NA	NA	NA	NA
AYS17836.1|3053186_3053870_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYS17837.1|3053863_3054520_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYS17838.1|3054624_3055083_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS17839.1|3055271_3057263_-	transketolase	NA	NA	NA	NA	NA
AYS17840.1|3057538_3058297_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYS17841.1|3058397_3059318_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYS17842.1|3059545_3061522_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYS17843.1|3061530_3061662_-	hypothetical protein	NA	NA	NA	NA	NA
AYS17844.1|3061956_3062256_-	membrane protein	NA	NA	NA	NA	NA
AYS17845.1|3062311_3063466_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYS17846.1|3063958_3065353_+	galactose-proton symport	NA	NA	NA	NA	NA
AYS17847.1|3065431_3065929_+	hypothetical protein	NA	NA	NA	NA	NA
AYS17848.1|3066024_3066732_+	endonuclease I	NA	NA	NA	NA	NA
AYS17849.1|3066808_3067540_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYS17850.1|3067559_3068507_+	glutathione synthetase	NA	NA	NA	NA	NA
AYS17851.1|3068722_3069286_+	hypothetical protein	NA	NA	NA	NA	NA
AYS17852.1|3069285_3069702_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYS17853.1|3069748_3070435_-	global regulatory protein	NA	NA	NA	NA	NA
AYS17854.1|3070564_3071545_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYS17855.1|3071562_3072267_+	hypothetical protein	NA	NA	NA	NA	NA
AYS17856.1|3072285_3072852_+	hypothetical protein	NA	NA	NA	NA	NA
AYS17857.1|3072848_3073139_+	hypothetical protein	NA	NA	NA	NA	NA
AYS17858.1|3073146_3073740_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYS17859.1|3073732_3074869_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYS17860.1|3074959_3075967_-	hypothetical protein	NA	NA	NA	NA	NA
AYS17861.1|3076099_3077146_-	L-asparaginase	NA	NA	NA	NA	NA
AYS17862.1|3077464_3077923_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS17863.1|3078045_3078765_-	hypothetical protein	NA	NA	NA	NA	NA
AYS17864.1|3078814_3079141_-	hypothetical protein	NA	NA	NA	NA	NA
AYS17865.1|3079140_3079860_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYS17866.1|3080014_3081067_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYS17867.1|3081094_3081370_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYS17868.1|3081482_3082568_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYS17869.1|3082784_3084041_+	nucleoside permease	NA	NA	NA	NA	NA
AYS17870.1|3086651_3087359_+	hypothetical protein	NA	NA	NA	NA	NA
AYS17871.1|3089947_3090214_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYS17872.1|3090456_3090735_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 9
CP029927	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217103 chromosome, complete genome	4778473	3468273	3506331	4778473	portal,tail,integrase,capsid,transposase,terminase,plate	Salmonella_phage(82.05%)	45	3463237:3463251	3475403:3475417
3463237:3463251	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYS18202.1|3468273_3469920_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYS18203.1|3470059_3470158_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYS18204.1|3470413_3470743_+	hypothetical protein	NA	NA	NA	NA	NA
AYS18205.1|3470783_3471836_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYS18206.1|3472231_3472801_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYS18207.1|3473180_3473690_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYS18208.1|3473864_3474089_+	hypothetical protein	NA	NA	NA	NA	NA
AYS18209.1|3474111_3474453_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYS18210.1|3474520_3474754_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYS18211.1|3474753_3474981_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYS18212.1|3474977_3475835_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3475403:3475417	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYS18213.1|3475831_3478246_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYS18214.1|3478399_3478588_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYS18215.1|3480555_3481470_+	hypothetical protein	NA	NA	NA	NA	NA
AYS18216.1|3481466_3482207_+	hypothetical protein	NA	NA	NA	NA	NA
AYS18217.1|3482241_3483279_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYS18218.1|3483278_3485045_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYS18219.1|3485187_3486021_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYS18220.1|3486037_3487096_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYS18221.1|3487099_3487750_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYS18222.1|3487782_3488310_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYS18223.1|3488309_3488513_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYS18224.1|3488516_3488732_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYS18225.1|3488751_3489225_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYS18226.1|3489226_3489604_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYS18227.1|3489600_3490029_+	regulatory protein	NA	E5G6N2	Salmonella_phage	76.6	5.4e-46
AYS18228.1|3490124_3490556_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYS18229.1|3490548_3490995_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYS18230.1|3491063_3491642_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYS18231.1|3491638_3491998_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYS18232.1|3491984_3492893_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYS18233.1|3492885_3493491_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS18234.1|3493487_3495002_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYS18235.1|3495001_3495595_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYS18236.1|3495566_3496007_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYS18237.1|3496429_3497002_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS18238.1|3497144_3498317_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS18239.1|3498326_3498842_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS18240.1|3498896_3499199_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS18241.1|3499213_3499333_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS18242.1|3499325_3502403_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYS18243.1|3502399_3502885_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS18244.1|3502881_3503982_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS18245.1|3504072_3504291_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYS18246.1|3505872_3506331_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 10
CP029927	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217103 chromosome, complete genome	4778473	4438074	4512344	4778473	portal,tail,integrase,capsid,terminase,plate	Salmonella_phage(82.61%)	75	4499588:4499604	4512503:4512519
AYS19024.1|4438074_4440024_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYS19025.1|4440095_4441004_+	hypothetical protein	NA	NA	NA	NA	NA
AYS19026.1|4441077_4441977_+	hypothetical protein	NA	NA	NA	NA	NA
AYS19027.1|4442018_4442378_+	hypothetical protein	NA	NA	NA	NA	NA
AYS19028.1|4442477_4442747_-	hypothetical protein	NA	NA	NA	NA	NA
AYS19029.1|4442878_4444153_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYS19030.1|4444372_4444750_+	hypothetical protein	NA	NA	NA	NA	NA
AYS19031.1|4444836_4445055_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYS19032.1|4445122_4446223_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYS19033.1|4446219_4446705_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYS19034.1|4446704_4449485_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYS19035.1|4449477_4449597_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYS19036.1|4449611_4449914_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYS19037.1|4449968_4450484_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYS19038.1|4450493_4451666_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYS19039.1|4452200_4452923_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYS19040.1|4453120_4453528_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYS19041.1|4453534_4455154_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYS19042.1|4455150_4455756_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS19043.1|4455748_4456657_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	96.4	1.3e-153
AYS19044.1|4456643_4457003_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYS19045.1|4456999_4457578_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYS19046.1|4457646_4458093_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYS19047.1|4458085_4458517_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
AYS19048.1|4458612_4459038_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYS19049.1|4459037_4459415_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYS19050.1|4459419_4459890_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYS19051.1|4459909_4460125_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYS19052.1|4460128_4460332_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYS19053.1|4460331_4460796_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYS19054.1|4460889_4461540_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYS19055.1|4461543_4462608_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYS19056.1|4462624_4463458_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYS19057.1|4463600_4465367_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYS19058.1|4465363_4466410_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYS19059.1|4466458_4467154_-	hypothetical protein	NA	NA	NA	NA	NA
AYS19060.1|4467173_4468238_-	hypothetical protein	NA	NA	NA	NA	NA
AYS19061.1|4468234_4469299_-	hypothetical protein	NA	NA	NA	NA	NA
AYS19062.1|4470223_4472632_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.1	0.0e+00
AYS19063.1|4472622_4473483_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYS19064.1|4473479_4474064_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYS19065.1|4474060_4474288_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYS19066.1|4474287_4474521_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYS19067.1|4474588_4474930_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYS19068.1|4474893_4475094_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYS19069.1|4475101_4475611_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYS19070.1|4475643_4475886_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYS19071.1|4476002_4476635_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYS19072.1|4476638_4477664_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYS19073.1|4477770_4478124_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYS19074.1|4478740_4479028_+	hypothetical protein	NA	NA	NA	NA	NA
AYS19075.1|4479038_4479929_+	methyltransferase	NA	NA	NA	NA	NA
AYS19076.1|4479928_4480675_+	hypothetical protein	NA	NA	NA	NA	NA
AYS19077.1|4480976_4482947_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS19078.1|4482966_4484271_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS19079.1|4484293_4484989_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYS19080.1|4485014_4485809_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS19081.1|4485818_4486886_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS19082.1|4486930_4488667_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYS19083.1|4488666_4491162_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS19084.1|4491185_4492232_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYS19085.1|4492234_4493512_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYS19086.1|4493756_4494296_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS19087.1|4495149_4496661_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYS19088.1|4496644_4498234_+	hypothetical protein	NA	NA	NA	NA	NA
AYS19089.1|4498397_4499411_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4499588:4499604	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYS19090.1|4499837_4500131_+	hypothetical protein	NA	NA	NA	NA	NA
AYS19091.1|4500127_4500616_+	hypothetical protein	NA	NA	NA	NA	NA
AYS19092.1|4500795_4501248_-	hypothetical protein	NA	NA	NA	NA	NA
AYS19093.1|4506470_4506932_+	hypothetical protein	NA	NA	NA	NA	NA
AYS19094.1|4506928_4507150_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYS19095.1|4508006_4508789_+	hypothetical protein	NA	NA	NA	NA	NA
AYS19096.1|4509415_4509640_-	hypothetical protein	NA	NA	NA	NA	NA
AYS19097.1|4509769_4510774_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYS19098.1|4511084_4512344_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4512503:4512519	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 11
CP029927	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217103 chromosome, complete genome	4778473	4654597	4661080	4778473	capsid	Enterobacteria_phage(66.67%)	8	NA	NA
AYS19235.1|4654597_4655674_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYS19236.1|4655670_4656744_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYS19237.1|4656718_4657882_-	hypothetical protein	NA	NA	NA	NA	NA
AYS19238.1|4658157_4658724_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYS19239.1|4658739_4658979_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYS19240.1|4658982_4659843_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYS19241.1|4660265_4660532_+	hypothetical protein	NA	Q7M299	Enterobacteria_phage	70.5	5.8e-30
AYS19242.1|4660579_4661080_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
