The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029911	Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 chromosome, complete genome	4784370	930439	937751	4784370	protease,integrase	Dickeya_phage(16.67%)	6	931690:931704	942869:942883
AYS24799.1|930439_931558_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYS24800.1|931554_933501_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931690:931704	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYS24801.1|933630_933852_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYS24802.1|934175_934496_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYS24803.1|934526_936803_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYS24804.1|937373_937751_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942869:942883	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029911	Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 chromosome, complete genome	4784370	1008694	1086006	4784370	protease,tail,terminase,integrase,transposase	Salmonella_phage(73.33%)	93	990760:990779	1061367:1061386
990760:990779	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS24854.1|1008694_1010035_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYS24855.1|1010031_1010280_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYS24856.1|1010320_1010566_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS24857.1|1010565_1011447_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYS24858.1|1011443_1012508_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYS24859.1|1012585_1013266_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYS24860.1|1013262_1014048_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYS24861.1|1014053_1014350_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYS24862.1|1014440_1014641_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYS24863.1|1014929_1015334_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYS24864.1|1015665_1016040_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYS24865.1|1016124_1017108_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYS24866.1|1017110_1017860_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYS24867.1|1017870_1018218_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYS24868.1|1018214_1018739_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYS24869.1|1018738_1019212_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYS24870.1|1019215_1019788_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYS24871.1|1019881_1020148_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS24872.1|1020229_1020391_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS24873.1|1020823_1021321_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS24874.1|1021505_1021745_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYS24875.1|1021734_1022040_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYS24876.1|1022079_1022682_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYS24877.1|1022890_1023502_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYS24878.1|1023634_1024432_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS24879.1|1024830_1024956_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS24880.1|1025091_1025541_-	lipoprotein	NA	NA	NA	NA	NA
AYS24881.1|1025757_1026147_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYS24882.1|1026133_1026415_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYS24883.1|1026414_1027029_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYS24884.1|1027247_1027502_+	hypothetical protein	NA	NA	NA	NA	NA
AYS24885.1|1027606_1027984_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYS24886.1|1028047_1028308_+	hypothetical protein	NA	NA	NA	NA	NA
AYS24887.1|1028397_1029150_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYS24888.1|1029115_1030519_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYS24889.1|1030518_1031988_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYS24890.1|1032079_1032610_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYS24891.1|1032624_1033857_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYS24892.1|1033861_1034359_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYS24893.1|1034370_1035312_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYS24894.1|1035353_1035722_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYS24895.1|1035687_1036095_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYS24896.1|1036091_1036646_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYS24897.1|1036632_1037022_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYS24898.1|1036996_1037560_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYS24899.1|1037563_1038709_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYS24900.1|1038720_1039161_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYS24901.1|1039164_1039617_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYS24902.1|1039794_1041747_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYS24903.1|1041746_1042397_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYS24904.1|1042400_1042703_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYS24905.1|1042705_1043737_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYS24906.1|1043733_1044069_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYS24907.1|1044263_1044995_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS24908.1|1044994_1045423_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS24909.1|1045481_1046237_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYS24910.1|1046324_1046462_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYS24911.1|1046477_1046831_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYS24912.1|1046831_1048031_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYS24913.1|1048027_1048708_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYS24914.1|1048707_1050219_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYS24915.1|1050233_1050752_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYS24916.1|1051673_1052375_-	hypothetical protein	NA	NA	NA	NA	NA
AYS24917.1|1052687_1052966_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYS24918.1|1053391_1056004_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYS24919.1|1056211_1057222_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYS24920.1|1057384_1057930_+	hypothetical protein	NA	NA	NA	NA	NA
AYS24921.1|1057926_1059036_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYS24922.1|1059134_1061243_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYS24923.1|1061255_1063163_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061367:1061386	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS24924.1|1063177_1064431_+	inner membrane protein	NA	NA	NA	NA	NA
AYS24925.1|1064435_1066076_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYS24926.1|1066072_1066636_+	lipoprotein	NA	NA	NA	NA	NA
AYS24927.1|1066889_1067057_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYS24928.1|1067156_1067675_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYS24929.1|1067743_1069504_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYS24930.1|1069689_1070142_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYS24931.1|1070213_1071266_-	outer membrane protein A	NA	NA	NA	NA	NA
AYS24932.1|1071620_1072130_-	cell division inhibitor	NA	NA	NA	NA	NA
AYS24933.1|1072346_1072952_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYS24934.1|1072938_1075092_-	inner membrane protein	NA	NA	NA	NA	NA
AYS24935.1|1075110_1075557_-	hypothetical protein	NA	NA	NA	NA	NA
AYS24936.1|1075680_1077735_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYS24937.1|1077770_1078229_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYS24938.1|1078323_1078986_-	hypothetical protein	NA	NA	NA	NA	NA
AYS24939.1|1079156_1079573_+	hypothetical protein	NA	NA	NA	NA	NA
AYS24940.1|1079617_1079935_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYS24941.1|1079992_1081204_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYS24942.1|1082335_1082794_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS24943.1|1083530_1083812_+	acylphosphatase	NA	NA	NA	NA	NA
AYS24944.1|1083808_1084138_-	sulfite reductase	NA	NA	NA	NA	NA
AYS24945.1|1084224_1084884_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYS24946.1|1085547_1086006_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029911	Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 chromosome, complete genome	4784370	1528824	1602329	4784370	protease,plate,tail,tRNA,head,transposase	Burkholderia_virus(44.12%)	71	NA	NA
AYS25346.1|1528824_1529283_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS25347.1|1529785_1530067_+	stress response protein	NA	NA	NA	NA	NA
AYS25348.1|1530335_1531157_+|protease	serine protease	protease	NA	NA	NA	NA
AYS25349.1|1531191_1531521_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYS25350.1|1531507_1531870_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYS25351.1|1531981_1532152_-	hypothetical protein	NA	NA	NA	NA	NA
AYS25352.1|1532286_1533321_+	hypothetical protein	NA	NA	NA	NA	NA
AYS25353.1|1533495_1534884_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYS25354.1|1534894_1536424_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYS25355.1|1536950_1537895_+	hypothetical protein	NA	NA	NA	NA	NA
AYS25356.1|1538076_1538466_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYS25357.1|1538437_1538890_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYS25358.1|1539084_1539315_-	hypothetical protein	NA	NA	NA	NA	NA
AYS25359.1|1539311_1539995_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYS25360.1|1540579_1540882_-	hypothetical protein	NA	NA	NA	NA	NA
AYS25361.1|1541452_1541983_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYS25362.1|1542282_1543449_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYS25363.1|1543459_1545229_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYS25364.1|1546673_1547024_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYS25365.1|1547738_1548389_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYS25366.1|1548711_1549023_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYS25367.1|1549022_1549568_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYS25368.1|1549564_1551160_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYS25369.1|1551159_1552656_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYS25370.1|1552636_1553458_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYS25371.1|1553460_1553919_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYS25372.1|1554133_1555249_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYS25373.1|1555263_1556217_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYS25374.1|1556226_1556565_+	hypothetical protein	NA	NA	NA	NA	NA
AYS25375.1|1556566_1557013_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYS25376.1|1557012_1557477_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYS25377.1|1557717_1559145_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYS25378.1|1559144_1559666_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYS25379.1|1559668_1559950_+	hypothetical protein	NA	NA	NA	NA	NA
AYS25380.1|1560047_1560383_+	hypothetical protein	NA	NA	NA	NA	NA
AYS25381.1|1560558_1563024_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYS25382.1|1563023_1563908_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYS25383.1|1563904_1564120_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYS25384.1|1564107_1565262_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYS25385.1|1565258_1565786_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYS25386.1|1565842_1566190_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYS25387.1|1566180_1567284_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYS25388.1|1567276_1567855_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYS25389.1|1567857_1568883_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYS25390.1|1569396_1570014_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYS25391.1|1571524_1572097_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYS25392.1|1572377_1573760_+	amino acid permease	NA	NA	NA	NA	NA
AYS25393.1|1573821_1574157_-	hypothetical protein	NA	NA	NA	NA	NA
AYS25394.1|1574283_1575015_+	two-component response regulator	NA	NA	NA	NA	NA
AYS25395.1|1575495_1576647_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYS25396.1|1576799_1578506_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYS25397.1|1578613_1579918_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYS25398.1|1579993_1580923_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYS25399.1|1580919_1582323_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYS25400.1|1582490_1584137_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYS25401.1|1584336_1585512_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYS25402.1|1585614_1587123_+	hypothetical protein	NA	NA	NA	NA	NA
AYS25403.1|1587828_1588830_+	adenosine deaminase	NA	NA	NA	NA	NA
AYS25404.1|1588903_1590019_-	oxidoreductase	NA	NA	NA	NA	NA
AYS25405.1|1590121_1590277_+	hypothetical protein	NA	NA	NA	NA	NA
AYS25406.1|1590575_1590791_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYS25407.1|1590879_1591320_+	hypothetical protein	NA	NA	NA	NA	NA
AYS25408.1|1591396_1591978_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYS25409.1|1591977_1592556_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYS25410.1|1594477_1595536_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYS25411.1|1595539_1596160_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYS25412.1|1596162_1596855_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYS25413.1|1596854_1597490_+	endonuclease III	NA	NA	NA	NA	NA
AYS25414.1|1598090_1599596_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYS25415.1|1599700_1600306_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYS25416.1|1601054_1602329_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029911	Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 chromosome, complete genome	4784370	1783366	1787778	4784370		Escherichia_phage(50.0%)	6	NA	NA
AYS25600.1|1783366_1783606_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYS25601.1|1784478_1785288_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYS25602.1|1785360_1785738_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYS25603.1|1785885_1786428_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYS25604.1|1786619_1787348_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYS25605.1|1787364_1787778_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029911	Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 chromosome, complete genome	4784370	1991631	1998865	4784370		Morganella_phage(33.33%)	7	NA	NA
AYS25795.1|1991631_1993062_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYS25796.1|1993135_1993831_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYS25797.1|1993910_1994222_-	hypothetical protein	NA	NA	NA	NA	NA
AYS25798.1|1994872_1996057_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYS25799.1|1996516_1996729_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYS25800.1|1997174_1998443_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYS25801.1|1998445_1998865_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029911	Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 chromosome, complete genome	4784370	2105166	2115673	4784370		Enterobacteria_phage(37.5%)	10	NA	NA
AYS25898.1|2105166_2106480_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYS25899.1|2106506_2107586_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYS25900.1|2107590_2108364_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYS25901.1|2108379_2109354_-	reductase RfbI	NA	NA	NA	NA	NA
AYS25902.1|2109359_2109911_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYS25903.1|2109911_2110790_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYS25904.1|2110837_2111737_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYS25905.1|2111736_2112822_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYS25906.1|2113198_2114092_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYS25907.1|2114269_2115673_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029911	Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 chromosome, complete genome	4784370	2192902	2202073	4784370	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYS25967.1|2192902_2194936_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYS25968.1|2195176_2195635_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYS25969.1|2195806_2196337_+	lipoprotein	NA	NA	NA	NA	NA
AYS25970.1|2196393_2196861_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYS25971.1|2196907_2197627_-	two-component system response regulator	NA	NA	NA	NA	NA
AYS25972.1|2197623_2199309_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYS25973.1|2199531_2200263_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYS25974.1|2200322_2200430_+	hypothetical protein	NA	NA	NA	NA	NA
AYS25975.1|2200410_2201142_-	ABC transporter permease	NA	NA	NA	NA	NA
AYS25976.1|2201125_2202073_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029911	Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 chromosome, complete genome	4784370	2737518	2750910	4784370	tail	Salmonella_phage(70.0%)	11	NA	NA
AYS26405.1|2737518_2737737_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYS26406.1|2737827_2738928_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS26407.1|2738924_2739410_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS26408.1|2739406_2742484_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS26409.1|2742476_2742596_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS26410.1|2742610_2742913_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS26411.1|2742967_2743483_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS26412.1|2743492_2744665_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS26413.1|2744807_2745380_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS26414.1|2746057_2747173_+	glycosyltransferase	NA	NA	NA	NA	NA
AYS26415.1|2747253_2750910_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029911	Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 chromosome, complete genome	4784370	3068071	3111774	4784370	protease,bacteriocin,transposase,tRNA	Bacillus_virus(33.33%)	44	NA	NA
AYS26703.1|3068071_3068530_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS26704.1|3068719_3069799_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYS26705.1|3069900_3071064_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYS26706.1|3071085_3072132_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYS26707.1|3072505_3072931_+	hypothetical protein	NA	NA	NA	NA	NA
AYS26708.1|3072956_3073535_+	hypothetical protein	NA	NA	NA	NA	NA
AYS26709.1|3073568_3074243_+	hypothetical protein	NA	NA	NA	NA	NA
AYS26710.1|3074224_3074908_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYS26711.1|3074901_3075558_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYS26712.1|3075662_3076121_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS26713.1|3076309_3078301_-	transketolase	NA	NA	NA	NA	NA
AYS26714.1|3078576_3079335_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYS26715.1|3079435_3080356_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYS26716.1|3080583_3082560_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYS26717.1|3082568_3082700_-	hypothetical protein	NA	NA	NA	NA	NA
AYS26718.1|3082994_3083294_-	membrane protein	NA	NA	NA	NA	NA
AYS26719.1|3083349_3084504_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYS26720.1|3084996_3086391_+	galactose-proton symport	NA	NA	NA	NA	NA
AYS26721.1|3086469_3086967_+	hypothetical protein	NA	NA	NA	NA	NA
AYS26722.1|3087062_3087770_+	endonuclease I	NA	NA	NA	NA	NA
AYS26723.1|3087846_3088578_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYS26724.1|3088597_3089545_+	glutathione synthetase	NA	NA	NA	NA	NA
AYS26725.1|3089760_3090324_+	hypothetical protein	NA	NA	NA	NA	NA
AYS26726.1|3090323_3090740_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYS26727.1|3090786_3091473_-	global regulatory protein	NA	NA	NA	NA	NA
AYS26728.1|3091602_3092583_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYS26729.1|3092600_3093305_+	hypothetical protein	NA	NA	NA	NA	NA
AYS26730.1|3093323_3093890_+	hypothetical protein	NA	NA	NA	NA	NA
AYS26731.1|3093886_3094177_+	hypothetical protein	NA	NA	NA	NA	NA
AYS26732.1|3094184_3094778_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYS26733.1|3094770_3095907_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYS26734.1|3095997_3097005_-	hypothetical protein	NA	NA	NA	NA	NA
AYS26735.1|3097137_3098184_-	L-asparaginase	NA	NA	NA	NA	NA
AYS26736.1|3098502_3098961_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS26737.1|3099083_3099803_-	hypothetical protein	NA	NA	NA	NA	NA
AYS26738.1|3099852_3100179_-	hypothetical protein	NA	NA	NA	NA	NA
AYS26739.1|3100178_3100898_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYS26740.1|3101052_3102105_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYS26741.1|3102132_3102408_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYS26742.1|3102520_3103606_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYS26743.1|3103822_3105079_+	nucleoside permease	NA	NA	NA	NA	NA
AYS26744.1|3107689_3108397_+	hypothetical protein	NA	NA	NA	NA	NA
AYS26745.1|3110986_3111253_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYS26746.1|3111495_3111774_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029911	Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 chromosome, complete genome	4784370	3488957	3527015	4784370	portal,plate,tail,terminase,capsid,integrase,transposase	Salmonella_phage(82.05%)	46	3483921:3483935	3496087:3496101
3483921:3483935	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYS27074.1|3488957_3490604_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYS27075.1|3490743_3490842_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYS27076.1|3491097_3491427_+	hypothetical protein	NA	NA	NA	NA	NA
AYS27077.1|3491467_3492520_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYS27078.1|3492915_3493485_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYS27079.1|3493610_3493832_+	hypothetical protein	NA	NA	NA	NA	NA
AYS27080.1|3493864_3494374_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYS27081.1|3494548_3494773_+	hypothetical protein	NA	NA	NA	NA	NA
AYS27082.1|3494795_3495137_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYS27083.1|3495204_3495438_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYS27084.1|3495437_3495665_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYS27085.1|3495661_3496519_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3496087:3496101	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYS27086.1|3496515_3498930_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYS27087.1|3499083_3499272_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYS27088.1|3501239_3502154_+	hypothetical protein	NA	NA	NA	NA	NA
AYS27089.1|3502150_3502891_+	hypothetical protein	NA	NA	NA	NA	NA
AYS27090.1|3502925_3503963_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYS27091.1|3503962_3505729_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYS27092.1|3505871_3506705_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYS27093.1|3506721_3507780_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYS27094.1|3507783_3508434_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYS27095.1|3508466_3508994_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYS27096.1|3508993_3509197_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYS27097.1|3509200_3509416_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYS27098.1|3509435_3509909_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYS27099.1|3509910_3510288_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYS27100.1|3510284_3510713_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYS27101.1|3510808_3511240_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYS27102.1|3511232_3511679_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYS27103.1|3511747_3512326_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYS27104.1|3512322_3512682_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYS27105.1|3512668_3513577_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYS27106.1|3513569_3514175_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS27107.1|3514171_3515686_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYS27108.1|3515685_3516279_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYS27109.1|3516250_3516691_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYS27110.1|3517113_3517686_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS27111.1|3517828_3519001_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS27112.1|3519010_3519526_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS27113.1|3519580_3519883_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS27114.1|3519897_3520017_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS27115.1|3520009_3523087_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS27116.1|3523083_3523569_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS27117.1|3523565_3524666_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS27118.1|3524756_3524975_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYS27119.1|3526556_3527015_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029911	Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 chromosome, complete genome	4784370	4442710	4517060	4784370	portal,plate,terminase,tail,capsid,integrase	Salmonella_phage(82.98%)	76	4504211:4504227	4517219:4517235
AYS27890.1|4442710_4444660_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYS27891.1|4444731_4445640_+	hypothetical protein	NA	NA	NA	NA	NA
AYS27892.1|4445713_4446613_+	hypothetical protein	NA	NA	NA	NA	NA
AYS27893.1|4446654_4447014_+	hypothetical protein	NA	NA	NA	NA	NA
AYS27894.1|4447113_4447383_-	hypothetical protein	NA	NA	NA	NA	NA
AYS27895.1|4447514_4448789_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYS27896.1|4449008_4449386_+	hypothetical protein	NA	NA	NA	NA	NA
AYS27897.1|4449472_4449691_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYS27898.1|4449758_4450859_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYS27899.1|4450855_4451341_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYS27900.1|4451340_4454121_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYS27901.1|4454113_4454233_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYS27902.1|4454247_4454550_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYS27903.1|4454604_4455120_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYS27904.1|4455129_4456302_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYS27905.1|4456836_4457559_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYS27906.1|4457756_4458164_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYS27907.1|4458170_4459790_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYS27908.1|4459786_4460392_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS27909.1|4460384_4461293_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYS27910.1|4461279_4461639_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYS27911.1|4461635_4462214_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYS27912.1|4462282_4462729_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYS27913.1|4462721_4463153_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYS27914.1|4463248_4463674_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYS27915.1|4463673_4464051_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYS27916.1|4464055_4464526_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYS27917.1|4464545_4464761_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYS27918.1|4464764_4464968_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYS27919.1|4464967_4465432_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYS27920.1|4465525_4466176_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYS27921.1|4466179_4467244_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYS27922.1|4467260_4468094_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYS27923.1|4468236_4470003_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYS27924.1|4469999_4471046_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYS27925.1|4471094_4471790_-	hypothetical protein	NA	NA	NA	NA	NA
AYS27926.1|4471809_4472874_-	hypothetical protein	NA	NA	NA	NA	NA
AYS27927.1|4472870_4473935_-	hypothetical protein	NA	NA	NA	NA	NA
AYS27928.1|4474859_4475189_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYS27929.1|4475185_4477255_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYS27930.1|4477245_4478106_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYS27931.1|4478102_4478687_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYS27932.1|4478683_4478911_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYS27933.1|4478910_4479144_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYS27934.1|4479211_4479553_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYS27935.1|4479516_4479717_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYS27936.1|4479724_4480234_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYS27937.1|4480266_4480509_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYS27938.1|4480625_4481258_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYS27939.1|4481261_4482287_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYS27940.1|4482393_4482747_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYS27941.1|4483363_4483651_+	hypothetical protein	NA	NA	NA	NA	NA
AYS27942.1|4483661_4484552_+	methyltransferase	NA	NA	NA	NA	NA
AYS27943.1|4484551_4485298_+	hypothetical protein	NA	NA	NA	NA	NA
AYS27944.1|4485599_4487570_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS27945.1|4487589_4488894_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS27946.1|4488916_4489612_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYS27947.1|4489637_4490432_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS27948.1|4490441_4491509_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS27949.1|4491553_4493290_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYS27950.1|4493289_4495785_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS27951.1|4495808_4496855_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYS27952.1|4496857_4498135_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYS27953.1|4498379_4498919_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS27954.1|4499772_4501284_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYS27955.1|4501267_4502857_+	hypothetical protein	NA	NA	NA	NA	NA
AYS27956.1|4503020_4504034_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4504211:4504227	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYS27957.1|4504460_4504754_+	hypothetical protein	NA	NA	NA	NA	NA
AYS27958.1|4504750_4505239_+	hypothetical protein	NA	NA	NA	NA	NA
AYS27959.1|4505418_4505871_-	hypothetical protein	NA	NA	NA	NA	NA
AYS27960.1|4511093_4511555_+	hypothetical protein	NA	NA	NA	NA	NA
AYS27961.1|4511551_4511773_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYS27962.1|4512629_4513412_+	hypothetical protein	NA	NA	NA	NA	NA
AYS27963.1|4514038_4514263_-	hypothetical protein	NA	NA	NA	NA	NA
AYS27964.1|4514392_4515490_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYS27965.1|4515800_4517060_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4517219:4517235	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029911	Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 chromosome, complete genome	4784370	4659312	4669571	4784370	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYS28102.1|4659312_4660389_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYS28103.1|4660385_4661459_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYS28104.1|4661433_4662597_-	hypothetical protein	NA	NA	NA	NA	NA
AYS28105.1|4662872_4663439_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYS28106.1|4663454_4663694_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYS28107.1|4663697_4664558_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYS28108.1|4664980_4665304_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYS28109.1|4665287_4665788_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYS28110.1|4665784_4666012_+	hypothetical protein	NA	NA	NA	NA	NA
AYS28111.1|4666008_4666329_+	P4 phage protein	NA	NA	NA	NA	NA
AYS28112.1|4666343_4667018_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYS28113.1|4667014_4668676_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYS28114.1|4669412_4669571_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029910	Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence	217083	3612	57130	217083	transposase,holin	Escherichia_phage(43.75%)	56	NA	NA
AYS23782.1|3612_3888_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS23783.1|3806_4310_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	6.3e-94
AYS23784.1|4636_4861_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23785.1|5516_5777_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23786.1|5865_6357_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23787.1|6361_6670_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23788.1|6877_7258_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23789.1|7343_7592_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23790.1|7629_7851_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	8.2e-06
AYS23791.1|8013_8397_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23792.1|8711_8936_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23793.1|9022_9487_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23794.1|9669_12099_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23795.1|12221_12668_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23796.1|12715_13522_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23797.1|13749_13992_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23798.1|14069_14402_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23799.1|14901_16083_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23800.1|16091_16388_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
AYS23801.1|16451_16919_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23802.1|17778_18555_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23803.1|18704_19481_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23804.1|19669_20011_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23805.1|20111_20375_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.1e-08
AYS23806.1|20608_21307_+	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	4.2e-11
AYS23807.1|21461_21758_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23808.1|21845_24230_-	periplasmic protein	NA	NA	NA	NA	NA
AYS23809.1|24480_25089_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23810.1|25201_25498_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23811.1|25502_26099_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23812.1|26490_27372_+	replication protein	NA	J9Q7H0	Salmonella_phage	41.3	6.5e-54
AYS23813.1|27957_28473_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23814.1|29123_31580_-	periplasmic protein	NA	NA	NA	NA	NA
AYS23815.1|32216_33971_-	DNA restriction methylase	NA	J9Q747	Salmonella_phage	30.9	1.1e-68
AYS23816.1|34156_35314_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.1e-19
AYS23817.1|35673_36498_+	DNA modification methylase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
AYS23818.1|36512_37334_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23819.1|37616_38324_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23820.1|38538_39615_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
AYS23821.1|40149_41025_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
AYS23822.1|41278_41860_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23823.1|42466_42820_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23824.1|42871_43189_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23825.1|43188_43986_+	pilus assembly protein	NA	NA	NA	NA	NA
AYS23826.1|43988_45221_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23827.1|45222_45663_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23828.1|45640_47011_+	TrhB	NA	NA	NA	NA	NA
AYS23829.1|47019_47532_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23830.1|47532_48390_+	plasmid transfer protein	NA	NA	NA	NA	NA
AYS23831.1|48399_49350_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23832.1|49358_52040_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23833.1|52673_52949_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	93.4	1.9e-44
AYS23834.1|53077_55081_+|holin	transporter, betaine/carnitine/choline family	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AYS23835.1|55143_56439_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23836.1|56432_56936_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS23837.1|56854_57130_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
>prophage 2
CP029910	Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence	217083	82223	134584	217083	transposase,integrase	Escherichia_phage(50.0%)	63	107127:107141	131627:131641
AYS23857.1|82223_82727_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS23858.1|82645_82921_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS23859.1|82962_84819_+	hypothetical protein	NA	S5MMD7	Bacillus_phage	26.4	2.2e-19
AYS23860.1|85216_86092_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23861.1|86150_86528_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23862.1|86588_87575_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23863.1|87634_88687_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23864.1|88725_88995_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23865.1|89065_90193_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23866.1|90270_92283_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23867.1|92354_92576_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23868.1|92690_93923_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
AYS23869.1|94197_94722_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23870.1|94712_95678_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23871.1|95748_96684_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23872.1|96761_97682_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23873.1|97754_98690_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23874.1|98866_99823_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23875.1|100235_100505_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23876.1|100559_101150_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23877.1|101157_101415_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23878.1|101488_102025_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23879.1|102041_102497_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23880.1|102480_102708_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23881.1|102756_103011_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23882.1|103078_104038_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23883.1|104048_104957_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23884.1|105261_106443_-	recombinase	NA	NA	NA	NA	NA
AYS23885.1|106657_106870_+	regulatory protein	NA	NA	NA	NA	NA
107127:107141	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYS23886.1|107176_107452_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	7.7e-46
107127:107141	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYS23887.1|107370_107874_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS23888.1|107980_108415_-	transcriptional regulator MerR	NA	NA	NA	NA	NA
AYS23889.1|108432_108837_+	MerT	NA	NA	NA	NA	NA
AYS23890.1|108850_109126_+	mercuric transport protein	NA	NA	NA	NA	NA
AYS23891.1|109161_109584_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AYS23892.1|109635_111330_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYS23893.1|111347_111710_+	transcriptional regulator MerD	NA	NA	NA	NA	NA
AYS23894.1|111706_111943_+	mercury resistance protein	NA	NA	NA	NA	NA
AYS23895.1|111939_112647_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23896.1|112685_113990_+|integrase	integrase	integrase	NA	NA	NA	NA
AYS23897.1|114018_114741_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS23898.1|115496_116348_+	replication protein	NA	NA	NA	NA	NA
AYS23899.1|116655_117471_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AYS23900.1|117531_118335_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYS23901.1|118334_119171_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYS23902.1|119231_119954_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS23903.1|120533_121394_-	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
120988:121002	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYS23904.1|121576_121843_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
120988:121002	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYS23905.1|121875_122598_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS23906.1|122831_123758_-	sulfonamide-resistant dihydropteroate synthase sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	7.2e-11
AYS23907.1|123664_124045_-	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYS23908.1|124241_124841_-	dihydrofolate reductase	NA	A0A1B2IAU3	Erwinia_phage	32.8	5.3e-15
AYS23909.1|124872_125886_+|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYS23910.1|125875_126439_+	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYS23911.1|126564_127125_+	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYS23912.1|127127_130094_+|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYS23913.1|130160_130538_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23914.1|130738_131398_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AYS23915.1|131676_131952_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS23916.1|131870_132374_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.4	1.3e-94
AYS23917.1|132955_133711_+	replication protein	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
AYS23918.1|133886_134162_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS23919.1|134080_134584_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	92.8	1.4e-88
