The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029923	Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 chromosome, complete genome	4782756	930261	937573	4782756	protease,integrase	Dickeya_phage(16.67%)	6	931512:931526	942691:942705
AYS33429.1|930261_931380_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYS33430.1|931376_933323_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931512:931526	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYS33431.1|933452_933674_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYS33432.1|933997_934318_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYS33433.1|934348_936625_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYS33434.1|937195_937573_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942691:942705	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029923	Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 chromosome, complete genome	4782756	1008486	1085798	4782756	transposase,protease,tail,integrase,terminase	Salmonella_phage(73.33%)	93	990552:990571	1061159:1061178
990552:990571	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS33484.1|1008486_1009827_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYS33485.1|1009823_1010072_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYS33486.1|1010112_1010358_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS33487.1|1010357_1011239_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYS33488.1|1011235_1012300_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYS33489.1|1012377_1013058_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYS33490.1|1013054_1013840_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYS33491.1|1013845_1014142_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYS33492.1|1014232_1014433_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYS33493.1|1014721_1015126_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYS33494.1|1015457_1015832_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYS33495.1|1015916_1016900_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYS33496.1|1016902_1017652_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYS33497.1|1017662_1018010_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYS33498.1|1018006_1018531_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYS33499.1|1018530_1019004_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYS33500.1|1019007_1019580_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYS33501.1|1019673_1019940_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS33502.1|1020021_1020183_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS33503.1|1020615_1021113_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS33504.1|1021297_1021537_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYS33505.1|1021526_1021832_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYS33506.1|1021871_1022474_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYS33507.1|1022682_1023294_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYS33508.1|1023426_1024224_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS33509.1|1024622_1024748_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS33510.1|1024883_1025333_-	lipoprotein	NA	NA	NA	NA	NA
AYS33511.1|1025549_1025939_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYS33512.1|1025925_1026207_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYS33513.1|1026206_1026821_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYS33514.1|1027039_1027294_+	hypothetical protein	NA	NA	NA	NA	NA
AYS33515.1|1027398_1027776_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYS33516.1|1027839_1028100_+	hypothetical protein	NA	NA	NA	NA	NA
AYS33517.1|1028189_1028942_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYS33518.1|1028907_1030311_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYS33519.1|1030310_1031780_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYS33520.1|1031871_1032402_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYS33521.1|1032416_1033649_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYS33522.1|1033653_1034151_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYS33523.1|1034162_1035104_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYS33524.1|1035145_1035514_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYS33525.1|1035479_1035887_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYS33526.1|1035883_1036438_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYS33527.1|1036424_1036814_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYS33528.1|1036788_1037352_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYS33529.1|1037355_1038501_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYS33530.1|1038512_1038953_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYS33531.1|1038956_1039409_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYS33532.1|1039586_1041539_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYS33533.1|1041538_1042189_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYS33534.1|1042192_1042495_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYS33535.1|1042497_1043529_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYS33536.1|1043525_1043861_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYS33537.1|1044055_1044787_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS33538.1|1044786_1045215_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS33539.1|1045273_1046029_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYS33540.1|1046116_1046254_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYS33541.1|1046269_1046623_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYS33542.1|1046623_1047823_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYS33543.1|1047819_1048500_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYS33544.1|1048499_1050011_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYS33545.1|1050025_1050544_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYS33546.1|1051465_1052167_-	hypothetical protein	NA	NA	NA	NA	NA
AYS33547.1|1052479_1052758_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYS33548.1|1053183_1055796_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYS33549.1|1056003_1057014_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYS33550.1|1057176_1057722_+	hypothetical protein	NA	NA	NA	NA	NA
AYS33551.1|1057718_1058828_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYS33552.1|1058926_1061035_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYS33553.1|1061047_1062955_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061159:1061178	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS33554.1|1062969_1064223_+	inner membrane protein	NA	NA	NA	NA	NA
AYS33555.1|1064227_1065868_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYS33556.1|1065864_1066428_+	lipoprotein	NA	NA	NA	NA	NA
AYS33557.1|1066681_1066849_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYS33558.1|1066948_1067467_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYS33559.1|1067535_1069296_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYS33560.1|1069481_1069934_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYS33561.1|1070005_1071058_-	outer membrane protein A	NA	NA	NA	NA	NA
AYS33562.1|1071412_1071922_-	cell division inhibitor	NA	NA	NA	NA	NA
AYS33563.1|1072138_1072744_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYS33564.1|1072730_1074884_-	inner membrane protein	NA	NA	NA	NA	NA
AYS33565.1|1074902_1075349_-	hypothetical protein	NA	NA	NA	NA	NA
AYS33566.1|1075472_1077527_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYS33567.1|1077562_1078021_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYS33568.1|1078115_1078778_-	hypothetical protein	NA	NA	NA	NA	NA
AYS33569.1|1078948_1079365_+	hypothetical protein	NA	NA	NA	NA	NA
AYS33570.1|1079409_1079727_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYS33571.1|1079784_1080996_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYS33572.1|1082127_1082586_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS33573.1|1083322_1083604_+	acylphosphatase	NA	NA	NA	NA	NA
AYS33574.1|1083600_1083930_-	sulfite reductase	NA	NA	NA	NA	NA
AYS33575.1|1084016_1084676_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYS33576.1|1085339_1085798_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029923	Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 chromosome, complete genome	4782756	1528616	1601742	4782756	transposase,protease,head,tail,tRNA,plate	Burkholderia_virus(43.24%)	80	NA	NA
AYS33976.1|1528616_1529075_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS33977.1|1529577_1529859_+	stress response protein	NA	NA	NA	NA	NA
AYS33978.1|1530127_1530949_+|protease	serine protease	protease	NA	NA	NA	NA
AYS33979.1|1530983_1531313_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYS33980.1|1531299_1531662_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYS33981.1|1531773_1531944_-	hypothetical protein	NA	NA	NA	NA	NA
AYS33982.1|1532078_1533113_+	hypothetical protein	NA	NA	NA	NA	NA
AYS33983.1|1533287_1534676_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYS33984.1|1534686_1536216_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYS33985.1|1536742_1537687_+	hypothetical protein	NA	NA	NA	NA	NA
AYS33986.1|1537868_1538258_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYS33987.1|1538229_1538682_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYS33988.1|1538876_1539107_-	hypothetical protein	NA	NA	NA	NA	NA
AYS33989.1|1539103_1539787_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYS33990.1|1539783_1539999_-	hypothetical protein	NA	NA	NA	NA	NA
AYS33991.1|1539991_1540375_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYS33992.1|1540371_1540674_-	hypothetical protein	NA	NA	NA	NA	NA
AYS33993.1|1540683_1540956_-	hypothetical protein	NA	NA	NA	NA	NA
AYS33994.1|1541244_1541775_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYS33995.1|1541802_1542072_-	hypothetical protein	NA	NA	NA	NA	NA
AYS33996.1|1542074_1543241_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYS33997.1|1543251_1545021_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYS33998.1|1545198_1545630_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYS33999.1|1545625_1546222_+	hypothetical protein	NA	NA	NA	NA	NA
AYS34000.1|1546465_1546816_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYS34001.1|1547530_1548181_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYS34002.1|1548177_1548504_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYS34003.1|1548503_1548815_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYS34004.1|1548814_1549360_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYS34005.1|1549356_1550952_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYS34006.1|1550951_1552448_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYS34007.1|1552428_1553250_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYS34008.1|1553252_1553711_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYS34009.1|1553925_1555041_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYS34010.1|1555055_1556009_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYS34011.1|1556018_1556357_+	hypothetical protein	NA	NA	NA	NA	NA
AYS34012.1|1556358_1556805_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYS34013.1|1556804_1557269_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYS34014.1|1557265_1557520_+	hypothetical protein	NA	NA	NA	NA	NA
AYS34015.1|1557509_1558937_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYS34016.1|1558936_1559458_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYS34017.1|1559460_1559742_+	hypothetical protein	NA	NA	NA	NA	NA
AYS34018.1|1559839_1560175_+	hypothetical protein	NA	NA	NA	NA	NA
AYS34019.1|1560350_1562816_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYS34020.1|1562815_1563700_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYS34021.1|1563696_1563912_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYS34022.1|1563899_1565054_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYS34023.1|1565050_1565578_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYS34024.1|1565634_1565982_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYS34025.1|1565972_1567076_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYS34026.1|1567068_1567647_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYS34027.1|1567649_1568675_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYS34028.1|1569188_1569806_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYS34029.1|1570844_1571417_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYS34030.1|1571697_1573080_+	amino acid permease	NA	NA	NA	NA	NA
AYS34031.1|1573141_1573477_-	hypothetical protein	NA	NA	NA	NA	NA
AYS34032.1|1573603_1574335_+	two-component response regulator	NA	NA	NA	NA	NA
AYS34033.1|1574815_1575967_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYS34034.1|1576119_1577826_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYS34035.1|1577933_1579238_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYS34036.1|1579313_1580243_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYS34037.1|1580239_1581643_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYS34038.1|1581810_1583457_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYS34039.1|1583656_1584832_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYS34040.1|1584934_1586443_+	hypothetical protein	NA	NA	NA	NA	NA
AYS34041.1|1587148_1588150_+	adenosine deaminase	NA	NA	NA	NA	NA
AYS34042.1|1588223_1589339_-	oxidoreductase	NA	NA	NA	NA	NA
AYS34043.1|1589441_1589597_+	hypothetical protein	NA	NA	NA	NA	NA
AYS34044.1|1589895_1590111_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYS34045.1|1590199_1590640_+	hypothetical protein	NA	NA	NA	NA	NA
AYS34046.1|1590716_1591298_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYS34047.1|1591297_1591876_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYS34048.1|1591868_1593890_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYS34049.1|1593890_1594949_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYS34050.1|1594952_1595573_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYS34051.1|1595575_1596268_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYS34052.1|1596267_1596903_+	endonuclease III	NA	NA	NA	NA	NA
AYS34053.1|1597503_1599009_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYS34054.1|1599113_1599719_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYS34055.1|1600467_1601742_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029923	Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 chromosome, complete genome	4782756	1782779	1787191	4782756		Escherichia_phage(50.0%)	6	NA	NA
AYS34239.1|1782779_1783019_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYS34240.1|1783891_1784701_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYS34241.1|1784773_1785151_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYS34242.1|1785298_1785841_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYS34243.1|1786032_1786761_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYS34244.1|1786777_1787191_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029923	Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 chromosome, complete genome	4782756	1991044	1998278	4782756		Morganella_phage(33.33%)	7	NA	NA
AYS34434.1|1991044_1992475_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYS34435.1|1992548_1993244_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYS34436.1|1993323_1993635_-	hypothetical protein	NA	NA	NA	NA	NA
AYS34437.1|1994285_1995470_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYS34438.1|1995929_1996142_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYS34439.1|1996587_1997856_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYS34440.1|1997858_1998278_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029923	Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 chromosome, complete genome	4782756	2104579	2115086	4782756		Enterobacteria_phage(37.5%)	10	NA	NA
AYS34537.1|2104579_2105893_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYS34538.1|2105919_2106999_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYS34539.1|2107003_2107777_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYS34540.1|2107792_2108767_-	reductase RfbI	NA	NA	NA	NA	NA
AYS34541.1|2108772_2109324_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYS34542.1|2109324_2110203_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYS34543.1|2110250_2111150_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYS34544.1|2111149_2112235_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYS34545.1|2112611_2113505_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYS34546.1|2113682_2115086_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029923	Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 chromosome, complete genome	4782756	2192315	2201486	4782756	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYS34606.1|2192315_2194349_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYS34607.1|2194589_2195048_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYS34608.1|2195219_2195750_+	lipoprotein	NA	NA	NA	NA	NA
AYS34609.1|2195806_2196274_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYS34610.1|2196320_2197040_-	two-component system response regulator	NA	NA	NA	NA	NA
AYS34611.1|2197036_2198722_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYS34612.1|2198944_2199676_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYS34613.1|2199735_2199843_+	hypothetical protein	NA	NA	NA	NA	NA
AYS34614.1|2199823_2200555_-	ABC transporter permease	NA	NA	NA	NA	NA
AYS34615.1|2200538_2201486_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029923	Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 chromosome, complete genome	4782756	2737035	2750427	4782756	tail	Salmonella_phage(70.0%)	11	NA	NA
AYS35044.1|2737035_2737254_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYS35045.1|2737344_2738445_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS35046.1|2738441_2738927_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS35047.1|2738923_2742001_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS35048.1|2741993_2742113_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS35049.1|2742127_2742430_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS35050.1|2742484_2743000_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS35051.1|2743009_2744182_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS35052.1|2744324_2744897_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS35053.1|2745574_2746690_+	glycosyltransferase	NA	NA	NA	NA	NA
AYS35054.1|2746770_2750427_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029923	Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 chromosome, complete genome	4782756	3067727	3111430	4782756	tRNA,transposase,protease,bacteriocin	Bacillus_virus(33.33%)	44	NA	NA
AYS35342.1|3067727_3068186_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS35343.1|3068375_3069455_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYS35344.1|3069556_3070720_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYS35345.1|3070741_3071788_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYS35346.1|3072161_3072587_+	hypothetical protein	NA	NA	NA	NA	NA
AYS35347.1|3072612_3073191_+	hypothetical protein	NA	NA	NA	NA	NA
AYS35348.1|3073224_3073899_+	hypothetical protein	NA	NA	NA	NA	NA
AYS35349.1|3073880_3074564_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYS35350.1|3074557_3075214_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYS35351.1|3075318_3075777_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS35352.1|3075965_3077957_-	transketolase	NA	NA	NA	NA	NA
AYS35353.1|3078232_3078991_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYS35354.1|3079091_3080012_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYS35355.1|3080239_3082216_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYS35356.1|3082224_3082356_-	hypothetical protein	NA	NA	NA	NA	NA
AYS35357.1|3082650_3082950_-	membrane protein	NA	NA	NA	NA	NA
AYS35358.1|3083005_3084160_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYS35359.1|3084652_3086047_+	galactose-proton symport	NA	NA	NA	NA	NA
AYS35360.1|3086125_3086623_+	hypothetical protein	NA	NA	NA	NA	NA
AYS35361.1|3086718_3087426_+	endonuclease I	NA	NA	NA	NA	NA
AYS35362.1|3087502_3088234_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYS35363.1|3088253_3089201_+	glutathione synthetase	NA	NA	NA	NA	NA
AYS35364.1|3089416_3089980_+	hypothetical protein	NA	NA	NA	NA	NA
AYS35365.1|3089979_3090396_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYS35366.1|3090442_3091129_-	global regulatory protein	NA	NA	NA	NA	NA
AYS35367.1|3091258_3092239_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYS35368.1|3092256_3092961_+	hypothetical protein	NA	NA	NA	NA	NA
AYS35369.1|3092979_3093546_+	hypothetical protein	NA	NA	NA	NA	NA
AYS35370.1|3093542_3093833_+	hypothetical protein	NA	NA	NA	NA	NA
AYS35371.1|3093840_3094434_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYS35372.1|3094426_3095563_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYS35373.1|3095653_3096661_-	hypothetical protein	NA	NA	NA	NA	NA
AYS35374.1|3096793_3097840_-	L-asparaginase	NA	NA	NA	NA	NA
AYS35375.1|3098158_3098617_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS35376.1|3098739_3099459_-	hypothetical protein	NA	NA	NA	NA	NA
AYS35377.1|3099508_3099835_-	hypothetical protein	NA	NA	NA	NA	NA
AYS35378.1|3099834_3100554_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYS35379.1|3100708_3101761_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYS35380.1|3101788_3102064_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYS35381.1|3102176_3103262_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYS35382.1|3103478_3104735_+	nucleoside permease	NA	NA	NA	NA	NA
AYS35383.1|3107345_3108053_+	hypothetical protein	NA	NA	NA	NA	NA
AYS35384.1|3110642_3110909_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYS35385.1|3111151_3111430_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029923	Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 chromosome, complete genome	4782756	3488749	3526807	4782756	transposase,capsid,portal,tail,integrase,terminase,plate	Salmonella_phage(82.05%)	46	3483713:3483727	3495879:3495893
3483713:3483727	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYS35713.1|3488749_3490396_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYS35714.1|3490535_3490634_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYS35715.1|3490889_3491219_+	hypothetical protein	NA	NA	NA	NA	NA
AYS35716.1|3491259_3492312_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYS35717.1|3492707_3493277_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYS35718.1|3493402_3493624_+	hypothetical protein	NA	NA	NA	NA	NA
AYS35719.1|3493656_3494166_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYS35720.1|3494340_3494565_+	hypothetical protein	NA	NA	NA	NA	NA
AYS35721.1|3494587_3494929_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYS35722.1|3494996_3495230_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYS35723.1|3495229_3495457_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYS35724.1|3495453_3496311_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3495879:3495893	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYS35725.1|3496307_3498722_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYS35726.1|3498875_3499064_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYS35727.1|3501031_3501946_+	hypothetical protein	NA	NA	NA	NA	NA
AYS35728.1|3501942_3502683_+	hypothetical protein	NA	NA	NA	NA	NA
AYS35729.1|3502717_3503755_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYS35730.1|3503754_3505521_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYS35731.1|3505663_3506497_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYS35732.1|3506513_3507572_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYS35733.1|3507575_3508226_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYS35734.1|3508258_3508786_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYS35735.1|3508785_3508989_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYS35736.1|3508992_3509208_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYS35737.1|3509227_3509701_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYS35738.1|3509702_3510080_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYS35739.1|3510076_3510505_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYS35740.1|3510600_3511032_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYS35741.1|3511024_3511471_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYS35742.1|3511539_3512118_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYS35743.1|3512114_3512474_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYS35744.1|3512460_3513369_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYS35745.1|3513361_3513967_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS35746.1|3513963_3515478_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYS35747.1|3515477_3516071_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYS35748.1|3516042_3516483_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYS35749.1|3516905_3517478_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS35750.1|3517620_3518793_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS35751.1|3518802_3519318_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS35752.1|3519372_3519675_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS35753.1|3519689_3519809_+	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS35754.1|3519801_3522879_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS35755.1|3522875_3523361_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS35756.1|3523357_3524458_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS35757.1|3524548_3524767_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYS35758.1|3526348_3526807_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029923	Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 chromosome, complete genome	4782756	4442502	4516666	4782756	capsid,portal,tail,integrase,terminase,plate	Salmonella_phage(82.98%)	76	4504003:4504019	4516825:4516841
AYS36529.1|4442502_4444452_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYS36530.1|4444523_4445432_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36531.1|4445505_4446405_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36532.1|4446446_4446806_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36533.1|4446905_4447175_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36534.1|4447306_4448581_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYS36535.1|4448800_4449178_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36536.1|4449264_4449483_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYS36537.1|4449550_4450651_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYS36538.1|4450647_4451133_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYS36539.1|4451132_4453913_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYS36540.1|4453905_4454025_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYS36541.1|4454039_4454342_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYS36542.1|4454396_4454912_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYS36543.1|4454921_4456094_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYS36544.1|4456628_4457351_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYS36545.1|4457548_4457956_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYS36546.1|4457962_4459582_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYS36547.1|4459578_4460184_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS36548.1|4460176_4461085_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYS36549.1|4461071_4461431_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYS36550.1|4461427_4462006_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYS36551.1|4462074_4462521_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYS36552.1|4462513_4462945_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYS36553.1|4463040_4463466_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYS36554.1|4463465_4463843_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYS36555.1|4463847_4464318_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYS36556.1|4464337_4464553_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYS36557.1|4464556_4464760_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYS36558.1|4464759_4465224_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYS36559.1|4465317_4465968_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYS36560.1|4465971_4467036_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYS36561.1|4467052_4467886_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYS36562.1|4468028_4469795_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYS36563.1|4469791_4470838_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYS36564.1|4470886_4471582_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36565.1|4471601_4472666_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36566.1|4472662_4473727_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36567.1|4474651_4474981_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYS36568.1|4474977_4477047_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYS36569.1|4477037_4477898_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYS36570.1|4477894_4478479_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYS36571.1|4478475_4478703_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYS36572.1|4478702_4478936_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYS36573.1|4479003_4479345_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYS36574.1|4479308_4479509_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYS36575.1|4479516_4480026_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYS36576.1|4480058_4480301_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYS36577.1|4480417_4481050_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYS36578.1|4481053_4482079_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYS36579.1|4482185_4482539_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYS36580.1|4483155_4483443_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36581.1|4483453_4484344_+	methyltransferase	NA	NA	NA	NA	NA
AYS36582.1|4484343_4485090_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36583.1|4485391_4487362_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS36584.1|4487381_4488686_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS36585.1|4488708_4489404_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYS36586.1|4489429_4490224_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS36587.1|4490233_4491301_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS36588.1|4491345_4493082_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYS36589.1|4493081_4495577_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS36590.1|4495600_4496647_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYS36591.1|4496649_4497927_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYS36592.1|4498171_4498711_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS36593.1|4499564_4501076_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYS36594.1|4501059_4502649_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36595.1|4502812_4503826_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4504003:4504019	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYS36596.1|4504252_4504546_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36597.1|4504542_4505031_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36598.1|4505210_4505663_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36599.1|4510885_4511347_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36600.1|4511343_4511565_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYS36601.1|4512421_4513204_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36602.1|4513830_4514055_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36603.1|4514184_4515096_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36604.1|4515406_4516666_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4516825:4516841	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029923	Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 chromosome, complete genome	4782756	4658918	4669177	4782756	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYS36741.1|4658918_4659995_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYS36742.1|4659991_4661065_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYS36743.1|4661039_4662203_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36744.1|4662478_4663045_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYS36745.1|4663060_4663300_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYS36746.1|4663303_4664164_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYS36747.1|4664586_4664910_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYS36748.1|4664893_4665394_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYS36749.1|4665390_4665618_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36750.1|4665614_4665935_+	P4 phage protein	NA	NA	NA	NA	NA
AYS36751.1|4665949_4666624_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYS36752.1|4666620_4668282_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYS36753.1|4669018_4669177_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029924	Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence	217512	87558	141076	217512	transposase,holin	Escherichia_phage(43.75%)	56	NA	NA
AYS36935.1|87558_87834_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS36936.1|87752_88256_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	6.3e-94
AYS36937.1|88582_88807_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36938.1|89462_89723_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36939.1|89811_90303_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36940.1|90307_90616_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36941.1|90823_91204_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36942.1|91289_91538_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36943.1|91575_91797_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	8.2e-06
AYS36944.1|91959_92343_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36945.1|92657_92882_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36946.1|92968_93433_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36947.1|93615_96045_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36948.1|96167_96614_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36949.1|96661_97468_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36950.1|97695_97938_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36951.1|98015_98348_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36952.1|98847_100029_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36953.1|100037_100334_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
AYS36954.1|100397_100865_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36955.1|101724_102501_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36956.1|102650_103427_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36957.1|103615_103957_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36958.1|104057_104321_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.1e-08
AYS36959.1|104554_105253_+	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	4.2e-11
AYS36960.1|105407_105704_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36961.1|105791_108176_-	periplasmic protein	NA	NA	NA	NA	NA
AYS36962.1|108426_109035_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36963.1|109147_109444_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36964.1|109448_110045_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36965.1|110436_111318_+	replication protein	NA	J9Q7H0	Salmonella_phage	41.3	6.5e-54
AYS36966.1|111903_112419_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36967.1|113069_115526_-	periplasmic protein	NA	NA	NA	NA	NA
AYS36968.1|116162_117917_-	DNA restriction methylase	NA	J9Q747	Salmonella_phage	30.9	1.1e-68
AYS36969.1|118102_119260_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.1e-19
AYS36970.1|119619_120444_+	DNA modification methylase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
AYS36971.1|120458_121280_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36972.1|121562_122270_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36973.1|122484_123561_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
AYS36974.1|124095_124971_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
AYS36975.1|125224_125806_-	hypothetical protein	NA	NA	NA	NA	NA
AYS36976.1|126412_126766_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36977.1|126817_127135_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36978.1|127134_127932_+	pilus assembly protein	NA	NA	NA	NA	NA
AYS36979.1|127934_129167_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36980.1|129168_129609_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36981.1|129586_130957_+	TrhB	NA	NA	NA	NA	NA
AYS36982.1|130965_131478_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36983.1|131478_132336_+	plasmid transfer protein	NA	NA	NA	NA	NA
AYS36984.1|132345_133296_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36985.1|133304_135986_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36986.1|136619_136895_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	93.4	1.9e-44
AYS36987.1|137023_139027_+|holin	transporter, betaine/carnitine/choline family	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AYS36988.1|139089_140385_+	hypothetical protein	NA	NA	NA	NA	NA
AYS36989.1|140378_140882_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.4	9.7e-95
AYS36990.1|140800_141076_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
>prophage 2
CP029924	Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence	217512	166169	216361	217512	transposase,integrase	Escherichia_phage(45.0%)	59	166154:166213	216318:217086
166154:166213	attL	CGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGT	NA	NA	NA	NA
AYS37010.1|166169_166673_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS37011.1|166591_166867_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS37012.1|166908_168765_+	hypothetical protein	NA	S5MMD7	Bacillus_phage	26.4	2.2e-19
AYS37013.1|169162_170038_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37014.1|170096_170474_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37015.1|170534_171521_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37016.1|171580_172633_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37017.1|172671_172941_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37018.1|173011_174139_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37019.1|174216_176229_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37020.1|176300_176522_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37021.1|176636_177869_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
AYS37022.1|178143_178668_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37023.1|178658_179624_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37024.1|179694_180630_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37025.1|180707_181628_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37026.1|181700_182636_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37027.1|182812_183769_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37028.1|184181_184451_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37029.1|184505_185096_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37030.1|185103_185361_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37031.1|185434_185971_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37032.1|185987_186443_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37033.1|186426_186654_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37034.1|186702_186957_-	hypothetical protein	NA	NA	NA	NA	NA
AYS37035.1|187024_187984_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37036.1|187994_188903_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37037.1|189207_190389_-	recombinase	NA	NA	NA	NA	NA
AYS37038.1|190603_190816_+	regulatory protein	NA	NA	NA	NA	NA
AYS37039.1|191357_191861_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS37040.1|191967_192402_-	transcriptional regulator MerR	NA	NA	NA	NA	NA
AYS37041.1|192419_192824_+	MerT	NA	NA	NA	NA	NA
AYS37042.1|192837_193113_+	mercuric transport protein	NA	NA	NA	NA	NA
AYS37043.1|193148_193571_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AYS37044.1|193622_195317_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYS37045.1|195334_195697_+	transcriptional regulator MerD	NA	NA	NA	NA	NA
AYS37046.1|195693_195930_+	mercury resistance protein	NA	NA	NA	NA	NA
AYS37047.1|195926_196634_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37048.1|196672_197977_+|integrase	integrase	integrase	NA	NA	NA	NA
AYS37049.1|198005_198728_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS37050.1|199483_200335_+	replication protein	NA	NA	NA	NA	NA
AYS37051.1|200642_201458_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AYS37052.1|201518_202322_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYS37053.1|202321_203158_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYS37054.1|203218_203941_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS37055.1|204520_205381_-	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AYS37056.1|205563_205830_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
AYS37057.1|205862_206585_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS37058.1|206818_207745_-	sulfonamide-resistant dihydropteroate synthase sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	7.2e-11
AYS37059.1|207651_208032_-	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYS37060.1|208228_208828_-	dihydrofolate reductase	NA	A0A1B2IAU3	Erwinia_phage	32.8	5.3e-15
AYS37061.1|208859_209873_+|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYS37062.1|209862_210426_+	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYS37063.1|210551_211112_+	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYS37064.1|211114_214081_+|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYS37065.1|214147_214525_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37066.1|214725_215385_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AYS37067.1|215663_215939_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS37068.1|215857_216361_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
216318:217086	attR	ACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACCGGTTTCTTATTAGAATCTTCGCCACTAAATAAATTATAATAAATTGATTTTATTAGATATCTGTCAGAATCTATATGGTCAGCACGAGTAGCATGCTCTAATGTTTCAAATGCTAGGGTTTGTGCGGCTTCAGCAAAAATTCCAGGCCAACCCTTACTCAGCATCGACAGTCCTTTAAGGACCCTTATCTGAATTTCCCTCATACTGGCACCATCGCGCGCAACAGGTGAGAAAAAGTCTTCAAGTAGATCGTTATTCTGAAGTGGTGCAACATGTACAGAAGGATATTTCACTTCTATTTCATCAGATTTATTCTGCGCGTAAGCGGAAAGTATACGTACACCTCTGCCAATGACATCAATGGCGGTTCCAGGATCGTTCACTGCGGGGGAAAGGGCTCGGCAGGCTATTTCGGCCATGACGCTAAGACAAAATCGGGGGTCCTGAGCAAATGAACGTACATCCGAGACAATAATCGTCTCAAGTAAATCGGCGCTGATTGATGACTCCTGGCCTTGACTCAGGTACAAAACTGGCATGGATGGATGTATGAAACTGCCTGGCTGCGCCACAAGGTATATATGACGGGGATCATTGGTCAGCAGCTTGCTAAGTTTCACCATATCAATATATTCAACATAGCCAATCTTCTTCGGATAAACTGCAACCGTTCCTTTCGGCTGTTCATTGTTCTCAAGCCATGGATATCC	NA	NA	NA	NA
