The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	0	19302	7432530		Bacillus_thuringiensis_phage(33.33%)	15	NA	NA
AYQ30660.1|1019_1808_+	short chain dehydrogenase	NA	NA	NA	NA	NA
AYQ30661.1|1897_3118_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AYQ30662.1|3357_4545_+	ATP-binding protein	NA	NA	NA	NA	NA
AYQ30663.1|4553_5300_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYQ30664.1|5328_7089_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ30665.1|7289_9038_-	sensor histidine kinase	NA	NA	NA	NA	NA
AYQ30666.1|9464_9935_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ30667.1|10081_10798_+	T9SS C-terminal target domain-containing protein	NA	NA	NA	NA	NA
AYQ30668.1|11069_11417_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
AYQ30669.1|11413_12568_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
AYQ30670.1|12683_13058_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	8.2e-06
AYQ30671.1|13054_14104_+	adenylate/guanylate cyclase domain-containing response regulator	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	34.0	1.0e-21
AYQ30672.1|14167_14383_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ30673.1|14495_16676_-	acylase	NA	NA	NA	NA	NA
AYQ36121.1|16797_19302_+	cation-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	25.7	6.2e-57
>prophage 2
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	25276	31280	7432530		Enterobacteria_phage(100.0%)	5	NA	NA
AYQ30680.1|25276_27517_-	hypothetical protein	NA	Q9EYF3	Enterobacteria_phage	35.3	2.2e-13
AYQ30681.1|27786_28593_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ30682.1|28693_29458_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ30683.1|29485_30133_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ30684.1|30116_31280_+	hypothetical protein	NA	Q9EYF3	Enterobacteria_phage	39.5	2.7e-15
>prophage 3
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	67814	71039	7432530		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
AYQ30710.1|67814_69068_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	43.4	2.1e-45
AYQ36123.1|69781_70288_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
AYQ30711.1|70223_71039_-	metallophosphoesterase	NA	A0A1V0SDK2	Indivirus	39.4	3.3e-28
>prophage 4
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	76083	81079	7432530	tRNA	Bodo_saltans_virus(33.33%)	5	NA	NA
AYQ30718.1|76083_77028_+	ribose-phosphate pyrophosphokinase	NA	A0A2H4UV84	Bodo_saltans_virus	34.4	6.0e-37
AYQ30719.1|77118_77682_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
AYQ30720.1|77750_78098_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	44.9	2.3e-18
AYQ30721.1|78387_79317_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AYQ30722.1|79387_81079_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.9	1.4e-148
>prophage 5
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	111162	113270	7432530		Bacillus_virus(50.0%)	3	NA	NA
AYQ30740.1|111162_112425_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	3.9e-84
AYQ30741.1|112664_112943_+	plasmid maintenance system killer	NA	NA	NA	NA	NA
AYQ30742.1|112955_113270_+	addiction module antidote protein, HigA family	NA	A0A2P1MXE5	Escherichia_phage	34.7	2.3e-09
>prophage 6
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	116447	116759	7432530		Riemerella_phage(100.0%)	1	NA	NA
AYQ30745.1|116447_116759_+	hypothetical protein	NA	F5A397	Riemerella_phage	51.2	3.2e-16
>prophage 7
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	119949	121737	7432530		Tupanvirus(100.0%)	1	NA	NA
AYQ30748.1|119949_121737_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	43.3	2.7e-22
>prophage 8
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	144323	145295	7432530		Synechococcus_phage(100.0%)	1	NA	NA
AYQ30766.1|144323_145295_-	NAD-dependent epimerase/dehydratase family protein	NA	E3SLH0	Synechococcus_phage	61.4	1.8e-113
>prophage 9
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	157877	158747	7432530		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AYQ30779.1|157877_158747_+	FkbM family methyltransferase	NA	C7U048	Ostreococcus_tauri_virus	30.4	2.9e-06
>prophage 10
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	175257	176379	7432530		Salmonella_virus(100.0%)	1	NA	NA
AYQ30788.1|175257_176379_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	27.7	1.1e-13
>prophage 11
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	180726	182730	7432530		Salmonella_phage(100.0%)	1	NA	NA
AYQ30792.1|180726_182730_-	NAD-dependent epimerase/dehydratase family protein	NA	E7C9N8	Salmonella_phage	38.0	3.7e-52
>prophage 12
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	194996	196445	7432530		Mycoplasma_phage(100.0%)	1	NA	NA
AYQ30805.1|194996_196445_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.3	2.5e-42
>prophage 13
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	199556	199976	7432530		Yersinia_phage(100.0%)	1	NA	NA
AYQ30808.1|199556_199976_+	HNH endonuclease	NA	A0A2C9D049	Yersinia_phage	39.8	2.0e-16
>prophage 14
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	203797	205273	7432530	tRNA	Tupanvirus(100.0%)	1	NA	NA
AYQ30811.1|203797_205273_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	39.4	2.0e-92
>prophage 15
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	210741	212694	7432530		Bacillus_phage(50.0%)	3	NA	NA
AYQ30817.1|210741_211314_+	hypothetical protein	NA	A0A0A0RMM3	Bacillus_phage	30.2	4.2e-09
AYQ30818.1|211328_212321_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
AYQ30819.1|212508_212694_+	cold shock domain-containing protein	NA	A0A1X9IGI9	Lactococcus_phage	46.0	1.2e-07
>prophage 16
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	230389	231283	7432530		Brevibacillus_phage(100.0%)	1	NA	NA
AYQ30835.1|230389_231283_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.6	1.9e-37
>prophage 17
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	236868	244863	7432530		uncultured_Mediterranean_phage(33.33%)	7	NA	NA
AYQ30841.1|236868_238731_+	hypothetical protein	NA	A0A1B1IVF2	uncultured_Mediterranean_phage	34.6	7.6e-60
AYQ30842.1|238734_239868_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
AYQ30843.1|239851_240919_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ30844.1|241197_241566_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ30845.1|241582_242713_-	histidinol-phosphate aminotransferase family protein	NA	A0A142C026	Faustovirus	25.9	4.2e-21
AYQ36130.1|242901_243933_-	transcriptional regulator	NA	NA	NA	NA	NA
AYQ30846.1|244113_244863_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KU27	Synechococcus_phage	34.1	1.9e-17
>prophage 18
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	255257	256571	7432530		Bacillus_phage(100.0%)	1	NA	NA
AYQ36134.1|255257_256571_-	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	24.5	9.6e-09
>prophage 19
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	265490	267571	7432530		Bacillus_phage(100.0%)	2	NA	NA
AYQ30858.1|265490_266216_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.8e-26
AYQ30859.1|266266_267571_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.1	4.0e-23
>prophage 20
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	273245	285068	7432530		Prochlorococcus_phage(25.0%)	10	NA	NA
AYQ30866.1|273245_274352_-	histidine kinase	NA	A0A0K0KVL7	Prochlorococcus_phage	26.4	1.6e-20
AYQ30867.1|274391_274718_-	type III effector	NA	NA	NA	NA	NA
AYQ30868.1|274746_275493_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ30869.1|275511_276522_-	multidrug transporter	NA	NA	NA	NA	NA
AYQ36137.1|276783_277902_+	DNA polymerase III subunit delta	NA	E7DN81	Pneumococcus_phage	25.5	9.6e-10
AYQ30870.1|277869_278463_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ30871.1|278510_279608_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYQ30872.1|279613_282805_-	AcrB/AcrD/AcrF family protein	NA	S5VTK5	Leptospira_phage	23.2	9.6e-63
AYQ30873.1|282823_284281_-	TolC family protein	NA	NA	NA	NA	NA
AYQ30874.1|284390_285068_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.5	4.4e-34
>prophage 21
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	297759	303823	7432530		Cyanophage(33.33%)	5	NA	NA
AYQ30881.1|297759_298662_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.5	1.5e-37
AYQ30882.1|298712_299420_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AYQ30883.1|299555_300845_-	adenylosuccinate synthase	NA	A0A291AUF9	Pandoravirus	30.8	2.8e-53
AYQ36139.1|300953_301457_-	transcriptional repressor	NA	NA	NA	NA	NA
AYQ30884.1|301564_303823_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2H4P7V9	Pseudomonas_phage	32.5	1.4e-07
>prophage 22
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	327023	330264	7432530		Cedratvirus(50.0%)	3	NA	NA
AYQ30903.1|327023_327782_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	26.0	1.3e-10
AYQ30904.1|327855_329175_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AYQ36140.1|329325_330264_+	D-2-hydroxyacid dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	28.0	6.4e-23
>prophage 23
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	336770	341541	7432530	protease	Staphylococcus_phage(100.0%)	4	NA	NA
AYQ30910.1|336770_338381_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	53.6	8.3e-156
AYQ30911.1|338494_339409_+|protease	serine protease	protease	NA	NA	NA	NA
AYQ30912.1|339693_340497_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYQ30913.1|340512_341541_-	XRE family transcriptional regulator	NA	Q4ZD53	Staphylococcus_phage	31.5	2.7e-06
>prophage 24
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	344976	346386	7432530		Enterobacteria_phage(100.0%)	1	NA	NA
AYQ30916.1|344976_346386_+	hypothetical protein	NA	Q9EYF3	Enterobacteria_phage	30.5	2.6e-12
>prophage 25
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	360710	361382	7432530		Bacillus_phage(100.0%)	1	NA	NA
AYQ30926.1|360710_361382_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.8	3.8e-30
>prophage 26
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	373180	375238	7432530	tRNA	Tupanvirus(100.0%)	1	NA	NA
AYQ30934.1|373180_375238_-|tRNA	methionine--tRNA ligase	tRNA	A0A2K9KZR3	Tupanvirus	33.1	5.6e-80
>prophage 27
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	383238	386202	7432530		Hokovirus(100.0%)	1	NA	NA
AYQ30943.1|383238_386202_-	response regulator	NA	A0A1V0SGX0	Hokovirus	27.4	1.4e-20
>prophage 28
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	414053	423416	7432530		Leptospira_phage(60.0%)	8	NA	NA
AYQ30948.1|414053_415127_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	38.9	1.3e-24
AYQ30949.1|415132_415864_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYQ30950.1|415982_417197_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	53.1	2.9e-113
AYQ30951.1|417147_418641_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	55.4	3.7e-158
AYQ30952.1|418647_420159_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	34.1	1.0e-59
AYQ30953.1|420062_422084_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ30954.1|422091_422952_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
AYQ30955.1|423041_423416_+	His-Xaa-Ser system protein HxsD	NA	S5VKU8	Leptospira_phage	39.3	4.6e-17
>prophage 29
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	445176	449330	7432530		Caulobacter_phage(50.0%)	5	NA	NA
AYQ30974.1|445176_446073_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	43.9	2.7e-63
AYQ30975.1|446337_446811_-	DNA repair protein	NA	NA	NA	NA	NA
AYQ30976.1|446823_447732_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ30977.1|447786_447975_-	DNA-binding protein	NA	NA	NA	NA	NA
AYQ30978.1|448151_449330_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	38.9	6.9e-75
>prophage 30
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	456908	458801	7432530		uncultured_marine_virus(50.0%)	3	NA	NA
AYQ30988.1|456908_457547_-	resolvase	NA	A0A0F7L6S1	uncultured_marine_virus	38.4	1.5e-28
AYQ30989.1|457769_458165_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ30990.1|458375_458801_+	DUF2958 domain-containing protein	NA	A0A1W6DX76	Sphingobium_phage	47.8	3.3e-19
>prophage 31
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	476050	480393	7432530		Pacmanvirus(50.0%)	5	NA	NA
AYQ36145.1|476050_477190_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X6WFP1	Pacmanvirus	29.8	1.4e-40
AYQ36146.1|477251_477641_-	VOC family protein	NA	NA	NA	NA	NA
AYQ30998.1|477703_478831_-	monooxygenase	NA	NA	NA	NA	NA
AYQ36147.1|479109_479637_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AYQ30999.1|479730_480393_-	hexitol phosphatase HxpB	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	30.9	8.8e-11
>prophage 32
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	485341	485782	7432530		Staphylococcus_phage(100.0%)	1	NA	NA
AYQ31006.1|485341_485782_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	48.9	2.1e-29
>prophage 33
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	490046	490928	7432530		Staphylococcus_phage(100.0%)	1	NA	NA
AYQ31010.1|490046_490928_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.9	1.2e-23
>prophage 34
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	503486	504767	7432530		Burkholderia_phage(100.0%)	1	NA	NA
AYQ31018.1|503486_504767_+	hypothetical protein	NA	C7BGE8	Burkholderia_phage	36.4	9.0e-12
>prophage 35
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	526075	526933	7432530	transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(100.0%)	1	NA	NA
AYQ36150.1|526075_526933_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	E9P639	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	23.5	6.2e-17
>prophage 36
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	533111	535577	7432530		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
AYQ31039.1|533111_535577_-	type I DNA topoisomerase	NA	A0A0G2Y4W4	Acanthamoeba_polyphaga_mimivirus	37.3	2.3e-133
>prophage 37
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	539585	540251	7432530		Murid_herpesvirus(100.0%)	1	NA	NA
AYQ31045.1|539585_540251_+	uracil-DNA glycosylase	NA	P88984	Murid_herpesvirus	45.5	4.9e-46
>prophage 38
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	543647	550014	7432530		Bacillus_phage(50.0%)	4	NA	NA
AYQ31050.1|543647_545429_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.9	4.1e-47
AYQ31051.1|545569_546856_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ31052.1|546933_548193_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYQ31053.1|548241_550014_+	T9SS C-terminal target domain-containing protein	NA	M4SNB6	Cellulophaga_phage	37.6	1.4e-18
>prophage 39
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	560821	561685	7432530		Tupanvirus(100.0%)	1	NA	NA
AYQ31061.1|560821_561685_-	transketolase	NA	A0A2K9L6P9	Tupanvirus	28.3	5.5e-29
>prophage 40
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	565004	565910	7432530		Bacillus_phage(100.0%)	1	NA	NA
AYQ31065.1|565004_565910_+	prohibitin family protein	NA	A0A172JI70	Bacillus_phage	24.2	2.3e-09
>prophage 41
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	569477	570146	7432530		Microcystis_virus(100.0%)	1	NA	NA
AYQ31072.1|569477_570146_+	formylglycine-generating enzyme family protein	NA	A0A7F1	Microcystis_virus	40.8	1.4e-27
>prophage 42
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	580951	582679	7432530		Salmonella_phage(50.0%)	2	NA	NA
AYQ31080.1|580951_582214_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	43.6	4.5e-88
AYQ31081.1|582217_582679_-	LexA family transcriptional regulator	NA	F1C5A6	Cronobacter_phage	43.8	3.1e-23
>prophage 43
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	589927	593587	7432530	integrase	Cellulophaga_phage(50.0%)	4	585096:585123	591445:591472
585096:585123	attL	AGGGGTTCGAGTCCCTTCGGGCGCACAA	NA	NA	NA	NA
AYQ31091.1|589927_591271_-|integrase	integrase	integrase	S0A3I4	Cellulophaga_phage	27.4	9.7e-25
AYQ31092.1|591533_592166_-	acetyltransferase	NA	NA	NA	NA	NA
591445:591472	attR	AGGGGTTCGAGTCCCTTCGGGCGCACAA	NA	NA	NA	NA
AYQ31093.1|592281_592995_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AYQ36151.1|593098_593587_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.0	2.4e-26
>prophage 44
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	613774	614098	7432530		Streptomyces_phage(100.0%)	1	NA	NA
AYQ31111.1|613774_614098_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	47.8	2.7e-13
>prophage 45
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	650810	653006	7432530		Bodo_saltans_virus(100.0%)	1	NA	NA
AYQ31130.1|650810_653006_-	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	23.1	3.6e-08
>prophage 46
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	659481	660771	7432530		Staphylococcus_phage(100.0%)	1	NA	NA
AYQ31137.1|659481_660771_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	49.9	8.0e-109
>prophage 47
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	702926	704174	7432530		Phage_TP(100.0%)	1	NA	NA
AYQ31167.1|702926_704174_-	U32 family peptidase	NA	Q6DW11	Phage_TP	27.7	1.4e-22
>prophage 48
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	720999	721692	7432530		Feldmannia_species_virus(100.0%)	1	NA	NA
AYQ31182.1|720999_721692_+	DNA-binding response regulator	NA	B5LWN0	Feldmannia_species_virus	24.8	2.6e-05
>prophage 49
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	734850	738604	7432530		Geobacillus_phage(50.0%)	4	NA	NA
AYQ31194.1|734850_735642_+	glycoside hydrolase	NA	A0A1U9WQS3	Geobacillus_phage	33.0	2.1e-19
AYQ31195.1|735647_736835_-	threonine synthase	NA	NA	NA	NA	NA
AYQ31196.1|736905_737808_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYQ31197.1|737947_738604_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-35
>prophage 50
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	745359	747835	7432530		Staphylococcus_phage(50.0%)	2	NA	NA
AYQ31201.1|745359_746097_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.2e-19
AYQ31202.1|746107_747835_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.7	9.1e-84
>prophage 51
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	761588	762350	7432530		Catovirus(100.0%)	1	NA	NA
AYQ31214.1|761588_762350_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	33.3	2.7e-08
>prophage 52
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	769102	770044	7432530		Tupanvirus(100.0%)	1	NA	NA
AYQ31220.1|769102_770044_-	NAD(P)-dependent oxidoreductase	NA	A0A2K9L4U8	Tupanvirus	29.8	8.9e-17
>prophage 53
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	797242	819784	7432530	tRNA,transposase	Catovirus(20.0%)	10	NA	NA
AYQ31241.1|797242_799897_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	39.9	1.9e-152
AYQ31242.1|799973_800888_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
AYQ36163.1|800961_802488_-	RtcB family protein	NA	K4F7X0	Cronobacter_phage	34.9	4.3e-45
AYQ31243.1|802833_804366_-	cryptochrome/photolyase family protein	NA	A0A1V0SE91	Indivirus	30.7	9.3e-56
AYQ31244.1|804352_804505_-	DUF2256 domain-containing protein	NA	NA	NA	NA	NA
AYQ31245.1|804828_806226_-	sensor histidine kinase	NA	NA	NA	NA	NA
AYQ31246.1|806225_806912_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.8	3.3e-29
AYQ31247.1|806971_807574_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ31248.1|807570_807840_-	TIGR03643 family protein	NA	NA	NA	NA	NA
AYQ31249.1|807904_819784_+	hypothetical protein	NA	A0A076YIC4	Citrobacter_phage	27.3	1.6e-09
>prophage 54
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	837573	839121	7432530		Burkholderia_phage(100.0%)	1	NA	NA
AYQ31267.1|837573_839121_-	DUF262 domain-containing protein	NA	E5E3X3	Burkholderia_phage	39.4	1.9e-93
>prophage 55
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	855926	857240	7432530		Thermobifida_phage(100.0%)	1	NA	NA
AYQ31284.1|855926_857240_+	alkaline phosphatase family protein	NA	A0A0R8V0A4	Thermobifida_phage	33.0	5.8e-06
>prophage 56
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	866216	871880	7432530	tRNA	Cronobacter_phage(50.0%)	4	NA	NA
AYQ31291.1|866216_867521_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	37.0	3.2e-65
AYQ31292.1|867805_869152_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ31293.1|869236_870274_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ31294.1|870407_871880_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	43.3	1.6e-100
>prophage 57
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	875003	880197	7432530	protease	uncultured_Caudovirales_phage(50.0%)	4	NA	NA
AYQ31298.1|875003_875621_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	30.9	6.5e-16
AYQ36167.1|875839_876682_-	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
AYQ31299.1|876881_877508_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ31300.1|877671_880197_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	35.1	2.0e-127
>prophage 58
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	884695	885874	7432530		Enterobacter_phage(100.0%)	1	NA	NA
AYQ31306.1|884695_885874_+	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	23.1	4.7e-07
>prophage 59
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	914596	923389	7432530		Enterobacter_phage(100.0%)	1	NA	NA
AYQ31331.1|914596_923389_+	tandem-95 repeat protein	NA	A0A0K2FHA6	Enterobacter_phage	33.8	2.6e-09
>prophage 60
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	935803	939735	7432530		Klosneuvirus(50.0%)	4	NA	NA
AYQ31339.1|935803_936637_-	3-keto-5-aminohexanoate cleavage protein	NA	A0A1V0SL81	Klosneuvirus	40.0	8.1e-54
AYQ31340.1|937037_937241_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ31341.1|937929_938292_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ31342.1|938298_939735_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	36.4	7.6e-60
>prophage 61
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	943745	945788	7432530		Klebsiella_phage(100.0%)	1	NA	NA
AYQ31345.1|943745_945788_+	hypothetical protein	NA	A0A0A8J9B0	Klebsiella_phage	38.2	2.0e-05
>prophage 62
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	956810	958052	7432530		Clostridium_phage(50.0%)	2	NA	NA
AYQ31364.1|956810_957164_+	DUF3850 domain-containing protein	NA	J9QD24	Clostridium_phage	37.5	2.2e-08
AYQ31365.1|957245_958052_-	DNA adenine methylase	NA	A0A2H4J7L8	uncultured_Caudovirales_phage	29.5	2.2e-24
>prophage 63
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	964422	967412	7432530		Yersinia_phage(50.0%)	6	NA	NA
AYQ31371.1|964422_964968_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2P9HY81	Yersinia_phage	30.4	1.2e-08
AYQ31372.1|964964_965408_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ31373.1|965438_965765_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ31374.1|965767_966730_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ31375.1|966726_966924_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ31376.1|966926_967412_-	hypothetical protein	NA	A0A2I6PHW5	Pseudomonas_phage	42.0	1.1e-23
>prophage 64
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	974510	975557	7432530		Pseudomonas_phage(100.0%)	1	NA	NA
AYQ31382.1|974510_975557_-	hypothetical protein	NA	X5IGJ4	Pseudomonas_phage	36.4	1.1e-10
>prophage 65
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	989992	993659	7432530		Bacillus_phage(50.0%)	4	NA	NA
AYQ31402.1|989992_990901_-	amidoligase enzyme	NA	A0A218KCI6	Bacillus_phage	38.7	6.6e-33
AYQ31403.1|991195_991852_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ31404.1|991886_992072_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ31405.1|992426_993659_-	hypothetical protein	NA	H7BUI8	unidentified_phage	25.7	1.3e-07
>prophage 66
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1019314	1020334	7432530		Dinoroseobacter_phage(100.0%)	1	NA	NA
AYQ31446.1|1019314_1020334_+	hypothetical protein	NA	A0A0A7CI50	Dinoroseobacter_phage	33.1	2.6e-09
>prophage 67
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1027644	1029304	7432530		Pseudomonas_phage(50.0%)	3	NA	NA
AYQ31452.1|1027644_1028133_+	hypothetical protein	NA	A0A2I6PHW5	Pseudomonas_phage	40.4	1.0e-16
AYQ31453.1|1028132_1028342_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ31454.1|1028341_1029304_+	hypothetical protein	NA	A0A2H4PAN7	Aphanizomenon_phage	26.5	5.7e-11
>prophage 68
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1033795	1101599	7432530	transposase,protease,tail,holin	Bacillus_phage(25.0%)	55	NA	NA
AYQ31461.1|1033795_1036972_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
AYQ31462.1|1036971_1037235_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ31463.1|1037231_1037879_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ31464.1|1037933_1038116_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ31465.1|1038153_1039107_-	hypothetical protein	NA	R9ZYY8	Cellulophaga_phage	28.1	7.9e-13
AYQ31466.1|1039103_1039631_-	3'-5' exonuclease	NA	NA	NA	NA	NA
AYQ31467.1|1039700_1040444_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ31468.1|1040608_1041841_-	hypothetical protein	NA	H7BUI8	unidentified_phage	22.6	2.4e-06
AYQ31469.1|1042040_1042994_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
AYQ31470.1|1043016_1043367_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AYQ31471.1|1043886_1044741_+	FAA hydrolase family protein	NA	NA	NA	NA	NA
AYQ36171.1|1044851_1047017_+	hydrolase	NA	NA	NA	NA	NA
AYQ31472.1|1047045_1047729_+	HAD family hydrolase	NA	NA	NA	NA	NA
AYQ31473.1|1047993_1048614_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYQ31474.1|1048715_1049537_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ31475.1|1049538_1050888_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AYQ31476.1|1050939_1055601_+|tail	tail fiber domain-containing protein	tail	A0A1B1IP05	uncultured_Mediterranean_phage	24.1	5.1e-12
AYQ36172.1|1055683_1057270_-	DNA mismatch repair protein MutS	NA	F2QAF8	Phaeocystis_pouchetii_virus	29.8	3.8e-12
AYQ31477.1|1057503_1057803_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ31478.1|1057941_1058469_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AYQ31479.1|1058492_1058780_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	NA	NA	NA	NA
AYQ31480.1|1058884_1060354_+	sodium:solute symporter	NA	NA	NA	NA	NA
AYQ31481.1|1060374_1061091_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYQ31482.1|1061141_1061438_-	integration host factor subunit beta	NA	A0A1P8CWT5	Bacillus_phage	32.2	1.9e-05
AYQ31483.1|1061790_1064001_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ31484.1|1064384_1064825_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ31485.1|1065157_1065982_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
AYQ36173.1|1066127_1067030_+	NAD(P)-dependent oxidoreductase	NA	L7RCI0	Acanthamoeba_polyphaga_moumouvirus	24.0	2.0e-10
AYQ31486.1|1067387_1068836_-	class A beta-lactamase-related serine hydrolase	NA	NA	NA	NA	NA
AYQ31487.1|1069097_1070279_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
AYQ36174.1|1070387_1071443_-	ChbG/HpnK family deacetylase	NA	NA	NA	NA	NA
AYQ31488.1|1074001_1075927_-	HAD family hydrolase	NA	NA	NA	NA	NA
AYQ31489.1|1076361_1077063_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ31490.1|1077109_1077376_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ31491.1|1077584_1078118_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
AYQ31492.1|1078235_1079762_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
AYQ31493.1|1079836_1080688_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYQ31494.1|1080938_1082198_+	MFS transporter	NA	NA	NA	NA	NA
AYQ31495.1|1082271_1083786_+	alpha,alpha-trehalase TreF	NA	NA	NA	NA	NA
AYQ31496.1|1083897_1085712_-	alpha-amylase	NA	NA	NA	NA	NA
AYQ31497.1|1085778_1086882_+	glycosyltransferase	NA	NA	NA	NA	NA
AYQ31498.1|1086893_1087913_-	formylglycine-generating enzyme family protein	NA	NA	NA	NA	NA
AYQ31499.1|1087938_1089306_-	DNA repair protein RadA	NA	NA	NA	NA	NA
AYQ31500.1|1089353_1089524_-	protein dpnD	NA	NA	NA	NA	NA
AYQ31501.1|1089510_1090290_-	restriction endonuclease	NA	NA	NA	NA	NA
AYQ31502.1|1090417_1091704_-	citrate synthase	NA	NA	NA	NA	NA
AYQ31503.1|1091881_1093153_-	amidohydrolase family protein	NA	NA	NA	NA	NA
AYQ31504.1|1093747_1094308_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYQ31505.1|1094343_1095249_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AYQ31506.1|1095269_1095803_+	DinB family protein	NA	NA	NA	NA	NA
AYQ31507.1|1096176_1096737_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ31508.1|1096840_1097179_-|holin	phage holin family protein	holin	NA	NA	NA	NA
AYQ31509.1|1097301_1099116_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	32.8	5.1e-69
AYQ31510.1|1099180_1100164_-	gliding motility protein	NA	NA	NA	NA	NA
AYQ31511.1|1100459_1101599_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	31.8	4.2e-29
>prophage 69
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1107730	1113308	7432530		Pseudomonas_phage(50.0%)	4	NA	NA
AYQ31519.1|1107730_1109821_-	NAD-dependent DNA ligase LigA	NA	A0A1Y0SVC9	Pseudomonas_phage	30.9	4.2e-91
AYQ36176.1|1109889_1110441_-	heme-copper oxidase subunit III	NA	NA	NA	NA	NA
AYQ31520.1|1110534_1111344_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AYQ31521.1|1111403_1113308_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.2	1.5e-108
>prophage 70
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1122752	1135638	7432530		uncultured_Mediterranean_phage(33.33%)	11	NA	NA
AYQ31530.1|1122752_1123556_-	ParA family protein	NA	Q7M293	Enterobacteria_phage	34.7	3.5e-14
AYQ31531.1|1123851_1124490_+	DUF1080 domain-containing protein	NA	NA	NA	NA	NA
AYQ31532.1|1124513_1125854_+	FAD-binding protein	NA	A0A2K9KZR0	Tupanvirus	24.6	4.4e-09
AYQ31533.1|1125867_1127070_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ31534.1|1127166_1127493_-	iron-sulfur cluster assembly accessory protein	NA	A0A1B1IT29	uncultured_Mediterranean_phage	46.2	1.3e-23
AYQ31535.1|1127670_1128726_+	oxidoreductase	NA	A0A1D7SNA5	Cyanophage	45.6	4.4e-12
AYQ31536.1|1128718_1129222_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYQ31537.1|1129370_1131203_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	29.0	2.2e-51
AYQ31538.1|1131401_1132724_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ31539.1|1132892_1133906_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AYQ36178.1|1133967_1135638_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	29.9	5.6e-54
>prophage 71
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1176808	1178314	7432530		Bacillus_virus(100.0%)	1	NA	NA
AYQ31563.1|1176808_1178314_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.9	2.1e-20
>prophage 72
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1187568	1188624	7432530		Wolbachia_phage(100.0%)	1	NA	NA
AYQ31568.1|1187568_1188624_+	hypothetical protein	NA	A0A1B2LRS3	Wolbachia_phage	33.4	5.3e-42
>prophage 73
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1201561	1206670	7432530		Bacillus_phage(66.67%)	4	NA	NA
AYQ31580.1|1201561_1202620_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.6	3.0e-114
AYQ31581.1|1202672_1203812_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AYQ31582.1|1204189_1205506_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.5	2.4e-84
AYQ31583.1|1205695_1206670_+	SDR family NAD-dependent epimerase/dehydratase	NA	A0A2K9KZK0	Tupanvirus	44.2	2.2e-71
>prophage 74
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1213353	1215017	7432530		Anomala_cuprea_entomopoxvirus(100.0%)	2	NA	NA
AYQ31590.1|1213353_1214271_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.3	2.5e-24
AYQ31591.1|1214276_1215017_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.6	6.6e-23
>prophage 75
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1253841	1255050	7432530		Moumouvirus(100.0%)	1	NA	NA
AYQ31618.1|1253841_1255050_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	36.0	3.9e-33
>prophage 76
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1268374	1269205	7432530		Moraxella_phage(100.0%)	1	NA	NA
AYQ31628.1|1268374_1269205_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	41.7	5.8e-36
>prophage 77
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1276528	1277533	7432530		Enterobacteria_phage(100.0%)	1	NA	NA
AYQ31634.1|1276528_1277533_-	response regulator	NA	Q9EYF3	Enterobacteria_phage	32.6	2.9e-13
>prophage 78
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1290853	1291384	7432530		Bacillus_phage(100.0%)	1	NA	NA
AYQ31649.1|1290853_1291384_-	5'(3')-deoxyribonucleotidase	NA	A0A1P8CX15	Bacillus_phage	47.3	3.8e-25
>prophage 79
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1295019	1295661	7432530		Pandoravirus(100.0%)	1	NA	NA
AYQ31654.1|1295019_1295661_+	orotate phosphoribosyltransferase	NA	S4W4D9	Pandoravirus	36.8	1.4e-24
>prophage 80
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1312230	1312707	7432530		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
AYQ36192.1|1312230_1312707_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	36.8	2.5e-23
>prophage 81
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1316831	1317812	7432530		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AYQ31673.1|1316831_1317812_-	2-hydroxyacid dehydrogenase	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	43.5	1.8e-65
>prophage 82
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1331206	1333898	7432530		Burkholderia_phage(50.0%)	3	NA	NA
AYQ31685.1|1331206_1332481_+	hypothetical protein	NA	C7BGE8	Burkholderia_phage	22.4	4.0e-12
AYQ31686.1|1332477_1333092_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ31687.1|1333103_1333898_+	thymidylate synthase	NA	E5DV96	Deep-sea_thermophilic_phage	62.1	2.4e-100
>prophage 83
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1364770	1365979	7432530		Methanothermobacter_phage(100.0%)	1	NA	NA
AYQ31709.1|1364770_1365979_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	28.0	1.4e-27
>prophage 84
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1371593	1376472	7432530		uncultured_virus(66.67%)	3	NA	NA
AYQ31716.1|1371593_1374086_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.4	6.2e-158
AYQ31717.1|1374437_1376078_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	66.3	7.1e-195
AYQ31718.1|1376193_1376472_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	59.1	1.2e-22
>prophage 85
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1381964	1382846	7432530		Streptococcus_phage(100.0%)	1	NA	NA
AYQ31726.1|1381964_1382846_+	oxidoreductase	NA	W6LLI2	Streptococcus_phage	34.9	2.5e-05
>prophage 86
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1397225	1405627	7432530		Leptospira_phage(33.33%)	6	NA	NA
AYQ36196.1|1397225_1401557_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	27.0	3.8e-86
AYQ31740.1|1401654_1402041_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ31741.1|1402204_1403464_+	aminotransferase class V-fold PLP-dependent enzyme	NA	Q2XUY6	environmental_halophage	26.2	5.5e-22
AYQ31742.1|1403526_1404000_-	CHRD domain-containing protein	NA	NA	NA	NA	NA
AYQ31743.1|1404084_1404765_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYQ31744.1|1404853_1405627_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.7	1.1e-15
>prophage 87
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1409059	1410472	7432530		Streptococcus_phage(100.0%)	1	NA	NA
AYQ31747.1|1409059_1410472_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	31.7	1.5e-55
>prophage 88
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1413834	1419306	7432530		Streptococcus_phage(33.33%)	4	NA	NA
AYQ31751.1|1413834_1416147_+	capsular biosynthesis protein	NA	A0A1X9I5D6	Streptococcus_phage	37.7	2.5e-20
AYQ31752.1|1416374_1417520_+	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	59.7	5.4e-125
AYQ31753.1|1417828_1418320_+	UpxY family transcription antiterminator	NA	NA	NA	NA	NA
AYQ31754.1|1418322_1419306_+	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	28.2	2.3e-31
>prophage 89
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1443114	1445066	7432530		Oenococcus_phage(50.0%)	2	NA	NA
AYQ36197.1|1443114_1444086_+	glycosyltransferase	NA	V5USA4	Oenococcus_phage	26.9	5.8e-19
AYQ31776.1|1444088_1445066_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2K9L4U8	Tupanvirus	35.8	7.8e-40
>prophage 90
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1471619	1473128	7432530		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AYQ31794.1|1471619_1473128_-	licheninase	NA	M1HRU7	Paramecium_bursaria_Chlorella_virus	32.6	1.6e-23
>prophage 91
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1491087	1491891	7432530		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AYQ36200.1|1491087_1491891_+	SDR family NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.1	5.5e-07
>prophage 92
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1502958	1503861	7432530		Powai_lake_megavirus(100.0%)	1	NA	NA
AYQ31815.1|1502958_1503861_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	34.1	1.4e-11
>prophage 93
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1537198	1538248	7432530		Tupanvirus(100.0%)	1	NA	NA
AYQ31847.1|1537198_1538248_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	43.6	2.7e-78
>prophage 94
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1560192	1562581	7432530		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
AYQ31861.1|1560192_1561122_+	carbon-nitrogen hydrolase family protein	NA	M1I5Z5	Acanthocystis_turfacea_Chlorella_virus	24.8	1.3e-07
AYQ36206.1|1561237_1562581_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	56.0	2.6e-142
>prophage 95
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1576507	1579528	7432530		Hokovirus(100.0%)	1	NA	NA
AYQ31869.1|1576507_1579528_-	helix-turn-helix domain-containing protein	NA	A0A1V0SGX0	Hokovirus	30.0	3.2e-31
>prophage 96
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1625339	1627295	7432530		Bacillus_virus(100.0%)	1	NA	NA
AYQ36212.1|1625339_1627295_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	45.5	8.6e-139
>prophage 97
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1631617	1635466	7432530		Chrysochromulina_ericina_virus(50.0%)	3	NA	NA
AYQ31898.1|1631617_1632370_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	29.7	4.5e-11
AYQ31899.1|1633482_1633959_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ31900.1|1634164_1635466_+	hypothetical protein	NA	Q9EYF3	Enterobacteria_phage	36.3	3.6e-16
>prophage 98
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1641198	1642269	7432530		Enterobacteria_phage(100.0%)	1	NA	NA
AYQ31908.1|1641198_1642269_-	GHKL domain-containing protein	NA	Q9EYF3	Enterobacteria_phage	26.9	3.9e-08
>prophage 99
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1663188	1664814	7432530		Tetraselmis_virus(100.0%)	1	NA	NA
AYQ31928.1|1663188_1664814_-	DUF4976 domain-containing protein	NA	A0A2P0VMN7	Tetraselmis_virus	24.5	2.5e-14
>prophage 100
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1668247	1673539	7432530		Mollivirus(50.0%)	3	NA	NA
AYQ31932.1|1668247_1669858_-	carboxylesterase/lipase family protein	NA	A0A0M4JT58	Mollivirus	25.5	1.5e-27
AYQ31933.1|1669893_1671249_-	amidohydrolase	NA	NA	NA	NA	NA
AYQ31934.1|1671910_1673539_-	carboxylesterase family protein	NA	A0A1S5V000	Saudi_moumouvirus	39.6	2.5e-35
>prophage 101
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1717510	1718068	7432530		Serratia_phage(100.0%)	1	NA	NA
AYQ31976.1|1717510_1718068_+	lysozyme	NA	R9VWD7	Serratia_phage	36.4	1.4e-14
>prophage 102
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1723021	1726264	7432530		Aphanizomenon_phage(50.0%)	3	NA	NA
AYQ31983.1|1723021_1723915_+	hypothetical protein	NA	A0A2H4PAN7	Aphanizomenon_phage	26.7	7.4e-05
AYQ31984.1|1723930_1725229_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ31985.1|1725475_1726264_+	hypothetical protein	NA	A0A191SB20	Nostoc_phage	28.0	1.1e-07
>prophage 103
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1732261	1733578	7432530		Pandoravirus(100.0%)	1	NA	NA
AYQ31990.1|1732261_1733578_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	32.8	8.6e-50
>prophage 104
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1748620	1752241	7432530		Hokovirus(100.0%)	1	NA	NA
AYQ31999.1|1748620_1752241_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	32.7	1.6e-58
>prophage 105
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1772644	1773862	7432530		environmental_halophage(100.0%)	1	NA	NA
AYQ32020.1|1772644_1773862_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	43.4	3.3e-104
>prophage 106
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1777568	1777769	7432530		Lactococcus_phage(100.0%)	1	NA	NA
AYQ32026.1|1777568_1777769_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	53.8	4.3e-14
>prophage 107
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1782370	1783618	7432530		Pseudomonas_phage(100.0%)	1	NA	NA
AYQ32032.1|1782370_1783618_-	competence/damage-inducible protein A	NA	B5TK85	Pseudomonas_phage	46.2	5.5e-22
>prophage 108
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1794565	1795708	7432530		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYQ32041.1|1794565_1795708_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	49.3	1.9e-82
>prophage 109
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1813790	1820574	7432530		Microcystis_virus(33.33%)	6	NA	NA
AYQ32056.1|1813790_1814783_-	formylglycine-generating enzyme family protein	NA	A0A7F1	Microcystis_virus	46.1	1.3e-26
AYQ32057.1|1814875_1816543_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ32058.1|1816571_1817348_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	2.3e-18
AYQ32059.1|1817590_1818088_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYQ32060.1|1818151_1818361_-	copper chaperone	NA	NA	NA	NA	NA
AYQ32061.1|1818363_1820574_-	Cu(2+)-exporting ATPase	NA	A0A218MNH6	uncultured_virus	37.0	5.2e-116
>prophage 110
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1825188	1826118	7432530		Klosneuvirus(100.0%)	1	NA	NA
AYQ32065.1|1825188_1826118_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	35.8	8.3e-07
>prophage 111
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1832297	1833230	7432530		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AYQ32073.1|1832297_1833230_+	phosphoglycerate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	30.7	4.8e-31
>prophage 112
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1839823	1842126	7432530		Tupanvirus(50.0%)	2	NA	NA
AYQ32080.1|1839823_1841146_-	T9SS C-terminal target domain-containing protein	NA	A0A2K9L5D3	Tupanvirus	34.9	6.4e-13
AYQ32081.1|1841172_1842126_-	PhoH family protein	NA	W8D063	Erwinia_phage	48.5	2.0e-48
>prophage 113
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1847008	1848772	7432530		Streptococcus_virus(100.0%)	1	NA	NA
AYQ32087.1|1847008_1848772_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	39.9	2.0e-46
>prophage 114
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1854225	1856040	7432530		Streptococcus_phage(100.0%)	1	NA	NA
AYQ32090.1|1854225_1856040_-	translational GTPase TypA	NA	A0A1B0RXH7	Streptococcus_phage	43.8	9.8e-20
>prophage 115
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1861329	1863420	7432530		uncultured_virus(100.0%)	1	NA	NA
AYQ32095.1|1861329_1863420_+	DNA primase	NA	A0A218MKR7	uncultured_virus	33.0	4.1e-46
>prophage 116
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1885458	1886529	7432530		Enterobacteria_phage(100.0%)	1	NA	NA
AYQ32117.1|1885458_1886529_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.0	9.5e-15
>prophage 117
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1889882	1891466	7432530		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYQ32122.1|1889882_1891466_-	Na+/H+ antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	28.5	1.0e-09
>prophage 118
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1894706	1895456	7432530		Indivirus(100.0%)	1	NA	NA
AYQ36222.1|1894706_1895456_+	thioredoxin	NA	A0A1V0SD63	Indivirus	36.3	1.4e-09
>prophage 119
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1904663	1905569	7432530		Tupanvirus(100.0%)	1	NA	NA
AYQ32134.1|1904663_1905569_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K9L162	Tupanvirus	25.1	7.5e-13
>prophage 120
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1923259	1925527	7432530		Acinetobacter_phage(100.0%)	1	NA	NA
AYQ36224.1|1923259_1925527_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.7	2.0e-06
>prophage 121
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1953887	1954388	7432530		Vibrio_phage(100.0%)	1	NA	NA
AYQ32171.1|1953887_1954388_+	peptide deformylase	NA	A0A2I7S809	Vibrio_phage	32.3	7.6e-07
>prophage 122
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1965741	1968240	7432530		Pseudomonas_phage(50.0%)	2	NA	NA
AYQ32180.1|1965741_1967193_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	37.9	4.0e-64
AYQ32181.1|1967262_1968240_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	37.1	1.3e-47
>prophage 123
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	1971336	1972296	7432530		Shigella_phage(100.0%)	1	NA	NA
AYQ36227.1|1971336_1972296_-	glycosyltransferase	NA	S5FKN0	Shigella_phage	38.6	4.6e-53
>prophage 124
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2009129	2011731	7432530	tail	Alteromonas_phage(50.0%)	2	NA	NA
AYQ32204.1|2009129_2010560_+	hypothetical protein	NA	R4VMA8	Alteromonas_phage	34.3	3.5e-12
AYQ32205.1|2010576_2011731_+|tail	tail fiber domain-containing protein	tail	A0A2L0UZ33	Agrobacterium_phage	39.8	2.4e-11
>prophage 125
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2047307	2049557	7432530		Microbacterium_phage(100.0%)	1	NA	NA
AYQ32233.1|2047307_2049557_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.8	1.8e-148
>prophage 126
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2067243	2068521	7432530		Streptococcus_phage(100.0%)	1	NA	NA
AYQ32244.1|2067243_2068521_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	59.0	4.8e-138
>prophage 127
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2088288	2089152	7432530		Cyanophage(100.0%)	1	NA	NA
AYQ32257.1|2088288_2089152_+	RNA polymerase subunit sigma	NA	M4SMP8	Cyanophage	32.7	3.9e-35
>prophage 128
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2093435	2094738	7432530		environmental_Halophage(50.0%)	2	NA	NA
AYQ32262.1|2093435_2093750_+	single-stranded DNA-binding protein	NA	H9YPW3	environmental_Halophage	34.0	3.0e-09
AYQ32263.1|2093838_2094738_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	39.4	1.2e-63
>prophage 129
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2108584	2109436	7432530		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
AYQ32273.1|2108584_2109436_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	2.1e-49
>prophage 130
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2113774	2114329	7432530		Agrobacterium_phage(100.0%)	1	NA	NA
AYQ32279.1|2113774_2114329_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	35.0	1.3e-12
>prophage 131
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2134649	2137736	7432530		Enterobacteria_phage(100.0%)	1	NA	NA
AYQ32301.1|2134649_2137736_+	hypothetical protein	NA	Q9EYF3	Enterobacteria_phage	34.4	2.2e-11
>prophage 132
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2145965	2147084	7432530		Klosneuvirus(100.0%)	1	NA	NA
AYQ32311.1|2145965_2147084_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1V0SL56	Klosneuvirus	24.7	7.9e-20
>prophage 133
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2154042	2154558	7432530		Streptococcus_phage(100.0%)	1	NA	NA
AYQ32319.1|2154042_2154558_-	hypothetical protein	NA	A0A1S5S9X4	Streptococcus_phage	50.6	3.7e-17
>prophage 134
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2168724	2177420	7432530	tRNA	Micromonas_pusilla_virus(33.33%)	7	NA	NA
AYQ32334.1|2168724_2170635_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	45.4	1.1e-135
AYQ32335.1|2170915_2172196_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ32336.1|2172327_2174283_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	39.1	2.3e-131
AYQ32337.1|2174534_2175098_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ32338.1|2175045_2175999_-	ribonuclease Z	NA	NA	NA	NA	NA
AYQ32339.1|2175998_2176427_-	anti-anti-sigma factor	NA	NA	NA	NA	NA
AYQ32340.1|2176478_2177420_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	29.9	5.2e-25
>prophage 135
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2183143	2183959	7432530		Grouper_iridovirus(100.0%)	1	NA	NA
AYQ36237.1|2183143_2183959_-	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	39.5	1.6e-54
>prophage 136
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2202231	2204751	7432530		Bacillus_virus(100.0%)	1	NA	NA
AYQ32356.1|2202231_2204751_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.1	2.7e-113
>prophage 137
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2210898	2215420	7432530	tRNA	Chrysochromulina_ericina_virus(50.0%)	3	NA	NA
AYQ32362.1|2210898_2212233_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	21.7	8.0e-11
AYQ32363.1|2212377_2214702_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
AYQ32364.1|2214925_2215420_+	dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	37.4	7.0e-21
>prophage 138
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2222241	2223135	7432530		Escherichia_phage(100.0%)	1	NA	NA
AYQ32371.1|2222241_2223135_+	phosphodiester glycosidase family protein	NA	A0A291LB83	Escherichia_phage	36.0	6.7e-06
>prophage 139
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2229653	2233542	7432530		Aeropyrum_pernix_spindle-shaped_virus(33.33%)	6	NA	NA
AYQ36243.1|2229653_2230718_+	A/G-specific adenine glycosylase	NA	G3CB03	Aeropyrum_pernix_spindle-shaped_virus	30.7	2.6e-20
AYQ32377.1|2230784_2231258_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	49.5	4.5e-25
AYQ32378.1|2231344_2231728_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ32379.1|2231850_2232222_+	glyoxalase	NA	NA	NA	NA	NA
AYQ32380.1|2232223_2232700_-	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AYQ32381.1|2232777_2233542_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	31.0	4.0e-07
>prophage 140
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2261941	2264864	7432530		Pithovirus(50.0%)	2	NA	NA
AYQ36246.1|2261941_2263468_+	Do family serine endopeptidase	NA	W5SAB9	Pithovirus	28.9	5.2e-06
AYQ36247.1|2263538_2264864_-	ATP-dependent helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	9.2e-52
>prophage 141
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2280097	2282242	7432530		Clostridioides_phage(100.0%)	1	NA	NA
AYQ32415.1|2280097_2282242_-	CRISPR-associated helicase Cas3'	NA	A0A2R2ZGW0	Clostridioides_phage	21.9	9.5e-14
>prophage 142
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2288177	2289359	7432530		Pacmanvirus(100.0%)	1	NA	NA
AYQ32423.1|2288177_2289359_-	histidinol-phosphate aminotransferase family protein	NA	A0A1X6WGT4	Pacmanvirus	24.0	3.5e-18
>prophage 143
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2299227	2300202	7432530		Campylobacter_phage(100.0%)	1	NA	NA
AYQ36250.1|2299227_2300202_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	26.8	3.0e-07
>prophage 144
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2324156	2328014	7432530		Hyphantria_cunea_nuclear_polyhedrosis_virus(100.0%)	1	NA	NA
AYQ32451.1|2324156_2328014_-	serine/threonine protein phosphatase	NA	Q2NP48	Hyphantria_cunea_nuclear_polyhedrosis_virus	30.7	1.0e-50
>prophage 145
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2359047	2359527	7432530		Clostridium_phage(100.0%)	1	NA	NA
AYQ32477.1|2359047_2359527_-	cytidine deaminase	NA	A0A249XXA3	Clostridium_phage	38.6	4.4e-20
>prophage 146
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2369951	2371055	7432530		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AYQ32483.1|2369951_2371055_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	42.3	3.1e-77
>prophage 147
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2381927	2382632	7432530		Planktothrix_phage(100.0%)	1	NA	NA
AYQ32490.1|2381927_2382632_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	43.1	4.3e-32
>prophage 148
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2392975	2393743	7432530		Mollivirus(100.0%)	1	NA	NA
AYQ32497.1|2392975_2393743_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.2	2.4e-12
>prophage 149
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2401019	2406592	7432530		Streptococcus_phage(50.0%)	4	NA	NA
AYQ32505.1|2401019_2402222_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	26.0	2.7e-26
AYQ36260.1|2402320_2403160_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
AYQ36261.1|2403232_2403856_-	SanA protein	NA	NA	NA	NA	NA
AYQ36262.1|2403931_2406592_-	DNA gyrase/topoisomerase IV subunit A	NA	A0A023W5F9	Serratia_phage	24.2	8.7e-17
>prophage 150
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2423391	2424522	7432530		Streptococcus_phage(100.0%)	1	NA	NA
AYQ32524.1|2423391_2424522_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	36.9	5.1e-43
>prophage 151
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2438566	2439427	7432530	transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(100.0%)	1	NA	NA
AYQ32536.1|2438566_2439427_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	E9P639	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	28.2	1.2e-20
>prophage 152
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2445725	2447477	7432530		Bacillus_phage(100.0%)	1	NA	NA
AYQ32544.1|2445725_2447477_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	1.7e-37
>prophage 153
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2453822	2454779	7432530		Enterobacteria_phage(100.0%)	1	NA	NA
AYQ36264.1|2453822_2454779_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	25.5	2.4e-09
>prophage 154
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2462353	2466194	7432530		uncultured_virus(33.33%)	3	NA	NA
AYQ36267.1|2462353_2463460_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	39.5	5.5e-74
AYQ32552.1|2463535_2464303_-	3-hydroxyacyl-CoA dehydrogenase	NA	A0A0M4JSW6	Mollivirus	26.7	8.1e-08
AYQ32553.1|2464343_2466194_-	feruloyl-CoA synthase	NA	A0A1V0SBX8	Catovirus	19.6	5.3e-13
>prophage 155
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2503133	2504621	7432530		Tupanvirus(100.0%)	1	NA	NA
AYQ36271.1|2503133_2504621_-	long-chain fatty acid--CoA ligase	NA	A0A2K9KZV5	Tupanvirus	24.5	3.4e-18
>prophage 156
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2523910	2525449	7432530		Saudi_moumouvirus(100.0%)	1	NA	NA
AYQ32599.1|2523910_2525449_-	carboxylesterase family protein	NA	A0A1S5V000	Saudi_moumouvirus	39.5	5.9e-34
>prophage 157
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2553598	2554024	7432530		Pseudomonas_phage(100.0%)	1	NA	NA
AYQ32618.1|2553598_2554024_+	HNH endonuclease	NA	A0A125RNK0	Pseudomonas_phage	40.6	5.4e-06
>prophage 158
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2560739	2561510	7432530		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AYQ36276.1|2560739_2561510_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	28.6	2.0e-14
>prophage 159
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2584744	2589448	7432530		Planktothrix_phage(50.0%)	4	NA	NA
AYQ32636.1|2584744_2585413_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	7.4e-34
AYQ32637.1|2585529_2586219_+	arylesterase	NA	NA	NA	NA	NA
AYQ36279.1|2586224_2587574_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AYQ36280.1|2587681_2589448_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	29.4	1.5e-44
>prophage 160
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2613111	2614116	7432530		Catovirus(100.0%)	1	NA	NA
AYQ32659.1|2613111_2614116_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	34.6	1.5e-09
>prophage 161
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2621365	2625214	7432530		Dickeya_phage(100.0%)	1	NA	NA
AYQ32666.1|2621365_2625214_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	55.0	1.0e-10
>prophage 162
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2637466	2638012	7432530		Tupanvirus(100.0%)	1	NA	NA
AYQ32676.1|2637466_2638012_+	HDIG domain-containing protein	NA	A0A2K9L141	Tupanvirus	43.0	2.7e-34
>prophage 163
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2646181	2648993	7432530		Mycobacterium_phage(50.0%)	2	NA	NA
AYQ32682.1|2646181_2646946_-	alpha/beta fold hydrolase	NA	A0A2P1JTI7	Mycobacterium_phage	37.4	4.4e-14
AYQ32683.1|2646962_2648993_-	M23 family peptidase	NA	R4JF21	Bacillus_phage	33.9	6.6e-09
>prophage 164
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2658903	2660433	7432530		Powai_lake_megavirus(100.0%)	1	NA	NA
AYQ32690.1|2658903_2660433_+	DUF4394 domain-containing protein	NA	A0A167R2B9	Powai_lake_megavirus	37.2	3.0e-30
>prophage 165
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2669082	2670444	7432530	tRNA	Tupanvirus(100.0%)	1	NA	NA
AYQ32696.1|2669082_2670444_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	33.0	3.0e-50
>prophage 166
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2687344	2695844	7432530	tRNA	Ostreococcus_lucimarinus_virus(50.0%)	5	NA	NA
AYQ32707.1|2687344_2690890_+	helicase SNF2	NA	A0A0P0CJA9	Ostreococcus_lucimarinus_virus	31.5	4.2e-43
AYQ32708.1|2691031_2691226_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ32709.1|2691225_2691627_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
AYQ32710.1|2691684_2692413_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ32711.1|2693015_2695844_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	1.2e-213
>prophage 167
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2710511	2714929	7432530		Bacillus_phage(66.67%)	5	NA	NA
AYQ32721.1|2710511_2711483_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	44.8	4.3e-22
AYQ32722.1|2711563_2712922_-	sensor histidine kinase	NA	NA	NA	NA	NA
AYQ32723.1|2712918_2713611_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.5	5.9e-34
AYQ32724.1|2713709_2714141_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ36287.1|2714140_2714929_-	prohibitin family protein	NA	J9PRU8	Bacillus_phage	24.2	3.5e-06
>prophage 168
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2731716	2733042	7432530		Cotesia_sesamiae_Mombasa_bracovirus(100.0%)	1	NA	NA
AYQ32737.1|2731716_2733042_+	cytochrome P450	NA	I6WI04	Cotesia_sesamiae_Mombasa_bracovirus	25.6	9.0e-31
>prophage 169
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2738506	2740414	7432530		Acanthamoeba_polyphaga_lentillevirus(100.0%)	1	NA	NA
AYQ36291.1|2738506_2740414_+	RecQ family ATP-dependent DNA helicase	NA	J2YAJ8	Acanthamoeba_polyphaga_lentillevirus	39.6	1.2e-65
>prophage 170
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2745478	2746177	7432530		Moraxella_phage(100.0%)	1	NA	NA
AYQ32746.1|2745478_2746177_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	37.9	7.0e-35
>prophage 171
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2765517	2771021	7432530		Enterobacteria_phage(50.0%)	4	NA	NA
AYQ32759.1|2765517_2767419_+	hypothetical protein	NA	Q9EYF3	Enterobacteria_phage	35.0	1.0e-11
AYQ32760.1|2767459_2768536_-	NADPH dehydrogenase NamA	NA	NA	NA	NA	NA
AYQ32761.1|2768736_2769687_+	RraA family protein	NA	NA	NA	NA	NA
AYQ32762.1|2769746_2771021_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	33.8	1.8e-49
>prophage 172
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2801358	2817064	7432530		Enterobacteria_phage(12.5%)	18	NA	NA
AYQ32781.1|2801358_2802465_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.0	1.2e-23
AYQ32782.1|2802513_2803047_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A1D7XFA9	Escherichia_phage	48.4	2.5e-40
AYQ32783.1|2803227_2803971_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
AYQ32784.1|2804020_2804425_+	DUF983 domain-containing protein	NA	NA	NA	NA	NA
AYQ32785.1|2804414_2804885_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	31.5	5.3e-18
AYQ32786.1|2804881_2805787_-	DUF3822 family protein	NA	NA	NA	NA	NA
AYQ36295.1|2805786_2806329_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AYQ32787.1|2806381_2806819_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	27.1	9.6e-06
AYQ32788.1|2806998_2808417_+	ATP-dependent endonuclease	NA	A0A0H3UZA5	Geobacillus_virus	24.1	4.8e-14
AYQ32789.1|2808496_2810050_-	methylmalonyl-CoA carboxyltransferase	NA	NA	NA	NA	NA
AYQ32790.1|2810163_2811021_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
AYQ32791.1|2811313_2812387_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	32.2	1.0e-40
AYQ32792.1|2812328_2813564_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AYQ32793.1|2813695_2814139_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	39.6	6.1e-16
AYQ32794.1|2814268_2814694_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AYQ32795.1|2814753_2815458_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ32796.1|2815472_2816081_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
AYQ32797.1|2816146_2817064_+	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	27.5	7.4e-16
>prophage 173
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2828177	2828624	7432530		Synechococcus_phage(100.0%)	1	NA	NA
AYQ32806.1|2828177_2828624_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	52.2	7.2e-17
>prophage 174
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2833567	2834989	7432530		Mycobacterium_phage(100.0%)	1	NA	NA
AYQ32812.1|2833567_2834989_-	HD domain-containing protein	NA	B5LJ39	Mycobacterium_phage	38.1	3.7e-30
>prophage 175
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2838113	2839682	7432530		Acidithiobacillus_phage(100.0%)	1	NA	NA
AYQ32816.1|2838113_2839682_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	31.0	4.5e-37
>prophage 176
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2861687	2862689	7432530		Klosneuvirus(100.0%)	1	NA	NA
AYQ32828.1|2861687_2862689_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	4.5e-67
>prophage 177
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2878352	2879027	7432530		Streptococcus_phage(100.0%)	1	NA	NA
AYQ32841.1|2878352_2879027_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.0	4.8e-49
>prophage 178
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2883994	2884375	7432530		Feldmannia_irregularis_virus(100.0%)	1	NA	NA
AYQ36301.1|2883994_2884375_+	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	26.5	5.8e-07
>prophage 179
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2910773	2912345	7432530		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYQ32869.1|2910773_2912345_-	Na+/H+ antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	26.0	2.3e-09
>prophage 180
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2929897	2931895	7432530		Bacillus_phage(100.0%)	1	NA	NA
AYQ32888.1|2929897_2931895_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	25.0	1.1e-11
>prophage 181
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2938118	2939417	7432530		Microcystis_phage(100.0%)	1	NA	NA
AYQ32895.1|2938118_2939417_+	gliding motility lipoprotein GldJ	NA	A0A075BSL8	Microcystis_phage	24.9	5.2e-07
>prophage 182
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2946004	2947933	7432530		environmental_halophage(100.0%)	1	NA	NA
AYQ32900.1|2946004_2947933_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	39.7	6.2e-89
>prophage 183
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2956186	2957416	7432530		unidentified_phage(100.0%)	1	NA	NA
AYQ32908.1|2956186_2957416_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	38.3	9.2e-30
>prophage 184
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2972377	2974126	7432530		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AYQ32918.1|2972377_2974126_+	hypothetical protein	NA	A0A0N9QAZ1	Chrysochromulina_ericina_virus	24.6	4.0e-10
>prophage 185
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2986249	2993824	7432530		Acinetobacter_phage(20.0%)	6	NA	NA
AYQ32931.1|2986249_2987713_+	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	28.5	4.3e-34
AYQ32932.1|2987709_2988282_+	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	41.5	6.6e-23
AYQ32933.1|2988272_2989409_+	restriction endonuclease	NA	NA	NA	NA	NA
AYQ32934.1|2989594_2989759_+	DUF1016 family protein	NA	Q9JMP5	Wolbachia_phage	56.9	1.8e-10
AYQ32935.1|2989881_2993217_+	DUF4145 domain-containing protein	NA	G8I3T3	Mycobacterium_phage	28.2	1.7e-17
AYQ32936.1|2993518_2993824_-	hypothetical protein	NA	A0A0F6YNM8	Sinorhizobium_phage	42.0	1.4e-11
>prophage 186
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	2998401	3003138	7432530		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AYQ32939.1|2998401_3003138_-	T9SS C-terminal target domain-containing protein	NA	M1HRU7	Paramecium_bursaria_Chlorella_virus	36.2	4.6e-37
>prophage 187
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3018365	3022392	7432530	tail	Arthrobacter_phage(25.0%)	6	NA	NA
AYQ32943.1|3018365_3018869_+|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	34.8	2.1e-17
AYQ32944.1|3018929_3019439_+|tail	phage tail protein	tail	E3T4R8	Cafeteria_roenbergensis_virus	37.6	1.1e-18
AYQ36305.1|3019449_3019965_+|tail	phage tail protein	tail	A0A097PAT0	Streptococcus_pyogenes_phage	38.1	1.0e-06
AYQ36306.1|3019978_3020470_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYQ32945.1|3020482_3020779_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ32946.1|3020775_3022392_-	replicative DNA helicase	NA	A0A0F7L6J1	uncultured_marine_virus	42.5	7.7e-93
>prophage 188
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3041748	3046449	7432530		Bacillus_phage(50.0%)	4	NA	NA
AYQ32962.1|3041748_3043572_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.8	2.8e-22
AYQ32963.1|3043847_3044300_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AYQ32964.1|3044561_3045845_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
AYQ36307.1|3045939_3046449_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	55.6	1.0e-43
>prophage 189
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3075742	3077227	7432530	tRNA	Orpheovirus(100.0%)	1	NA	NA
AYQ32995.1|3075742_3077227_-|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	30.8	1.3e-46
>prophage 190
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3081773	3082496	7432530		Planktothrix_phage(100.0%)	1	NA	NA
AYQ33001.1|3081773_3082496_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.7	1.6e-34
>prophage 191
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3092961	3093963	7432530	tRNA	Moraxella_phage(100.0%)	1	NA	NA
AYQ33007.1|3092961_3093963_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	44.0	2.7e-72
>prophage 192
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3115060	3116557	7432530		Bacillus_virus(100.0%)	1	NA	NA
AYQ33028.1|3115060_3116557_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.7e-17
>prophage 193
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3147618	3148566	7432530		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
AYQ33050.1|3147618_3148566_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	28.6	1.1e-06
>prophage 194
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3159940	3163054	7432530		Leptospira_phage(100.0%)	1	NA	NA
AYQ33062.1|3159940_3163054_-	AcrB/AcrD/AcrF family protein	NA	S5VTK5	Leptospira_phage	25.6	9.3e-87
>prophage 195
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3178697	3179222	7432530		Clostridium_phage(100.0%)	1	NA	NA
AYQ33071.1|3178697_3179222_+	3'-5' exonuclease	NA	A0A0A7RWA3	Clostridium_phage	34.0	4.3e-21
>prophage 196
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3184265	3184925	7432530		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AYQ33077.1|3184265_3184925_+	HAD family phosphatase	NA	M1I080	Acanthocystis_turfacea_Chlorella_virus	29.8	2.3e-11
>prophage 197
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3193309	3195971	7432530		Tetraselmis_virus(50.0%)	3	NA	NA
AYQ36314.1|3193309_3194848_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.5	1.0e-25
AYQ33086.1|3194872_3195697_+	ZIP family metal transporter	NA	NA	NA	NA	NA
AYQ33087.1|3195779_3195971_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	50.8	1.1e-09
>prophage 198
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3215221	3220486	7432530		Mycobacterium_phage(66.67%)	5	NA	NA
AYQ33106.1|3215221_3216043_+	alpha/beta hydrolase	NA	A0A249XTE1	Mycobacterium_phage	28.9	3.6e-14
AYQ33107.1|3216065_3216971_+	alpha/beta hydrolase	NA	D3JZC6	Mycobacterium_phage	26.9	1.8e-14
AYQ33108.1|3217206_3217737_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYQ33109.1|3217984_3218614_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AYQ33110.1|3218647_3220486_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	39.9	4.2e-111
>prophage 199
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3250529	3250835	7432530		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AYQ33138.1|3250529_3250835_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	59.0	3.3e-05
>prophage 200
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3254506	3258401	7432530		Bacillus_phage(50.0%)	2	NA	NA
AYQ33144.1|3254506_3256735_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.8	4.8e-45
AYQ33145.1|3256745_3258401_-	sodium transporter	NA	A0A240F3J2	Aeromonas_phage	35.0	3.4e-72
>prophage 201
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3265525	3266329	7432530		Microcystis_phage(100.0%)	1	NA	NA
AYQ33153.1|3265525_3266329_+	formylglycine-generating enzyme family protein	NA	A0A075BUR2	Microcystis_phage	35.9	3.9e-21
>prophage 202
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3280803	3281499	7432530		Staphylococcus_phage(100.0%)	1	NA	NA
AYQ33166.1|3280803_3281499_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	1.7e-25
>prophage 203
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3303167	3308146	7432530	protease	Acanthamoeba_polyphaga_lentillevirus(50.0%)	5	NA	NA
AYQ33186.1|3303167_3304079_+	paraslipin	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	23.4	5.8e-13
AYQ36320.1|3304146_3304578_+	NfeD family protein	NA	NA	NA	NA	NA
AYQ33187.1|3304691_3304904_+|protease	protease inhibitor Kazal-type	protease	NA	NA	NA	NA
AYQ33188.1|3304904_3306236_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AYQ33189.1|3306529_3308146_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.8	8.7e-145
>prophage 204
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3316118	3316934	7432530		Staphylococcus_phage(100.0%)	1	NA	NA
AYQ33197.1|3316118_3316934_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.6	5.0e-56
>prophage 205
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3322160	3323183	7432530		Enterobacteria_phage(100.0%)	1	NA	NA
AYQ33204.1|3322160_3323183_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	30.1	5.5e-12
>prophage 206
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3326659	3329593	7432530		Hokovirus(100.0%)	1	NA	NA
AYQ33207.1|3326659_3329593_+	response regulator	NA	A0A1V0SGX0	Hokovirus	27.1	1.9e-25
>prophage 207
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3342169	3349028	7432530		Bacillus_phage(50.0%)	2	NA	NA
AYQ33209.1|3342169_3346168_-	response regulator	NA	W8CYF6	Bacillus_phage	30.2	9.0e-26
AYQ33210.1|3346223_3349028_-	response regulator	NA	A0A1V0SGX0	Hokovirus	27.2	9.1e-25
>prophage 208
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3414939	3417714	7432530		Hokovirus(100.0%)	1	NA	NA
AYQ33222.1|3414939_3417714_-	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	9.7e-27
>prophage 209
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3431975	3434345	7432530	holin	Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
AYQ33232.1|3431975_3434345_-|holin	acetylcholinesterase	holin	A0A0G2Y6W1	Acanthamoeba_polyphaga_mimivirus	41.7	3.0e-37
>prophage 210
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3464323	3465949	7432530		Enterobacteria_phage(100.0%)	1	NA	NA
AYQ36324.1|3464323_3465949_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	32.7	3.4e-16
>prophage 211
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3476921	3479681	7432530		Hokovirus(100.0%)	1	NA	NA
AYQ33255.1|3476921_3479681_-	response regulator	NA	A0A1V0SGX0	Hokovirus	28.2	2.8e-26
>prophage 212
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3489520	3514934	7432530		Bacillus_phage(33.33%)	6	NA	NA
AYQ33259.1|3489520_3493621_-	response regulator	NA	W8CYF6	Bacillus_phage	31.0	1.3e-19
AYQ33260.1|3493702_3494407_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
AYQ33261.1|3494500_3509080_-	T9SS C-terminal target domain-containing protein	NA	G9FH37	Rhodococcus_phage	41.7	2.4e-07
AYQ33262.1|3509246_3509750_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ33263.1|3509789_3510677_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ33264.1|3510857_3514934_-	response regulator	NA	A0A1V0SGX0	Hokovirus	28.9	4.0e-29
>prophage 213
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3560455	3562366	7432530		Bacillus_phage(100.0%)	1	NA	NA
AYQ33274.1|3560455_3562366_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	21.5	1.0e-11
>prophage 214
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3572766	3574008	7432530		Mycobacterium_phage(100.0%)	1	NA	NA
AYQ33280.1|3572766_3574008_-	class A beta-lactamase-related serine hydrolase	NA	A0A088FA76	Mycobacterium_phage	23.0	1.2e-08
>prophage 215
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3611732	3615098	7432530	tail	Tupanvirus(50.0%)	7	NA	NA
AYQ33307.1|3611732_3612101_-	response regulator	NA	A0A2K9L4R0	Tupanvirus	31.5	7.3e-07
AYQ33308.1|3612211_3612442_-	MbtH family protein	NA	NA	NA	NA	NA
AYQ33309.1|3612488_3612911_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ33310.1|3612971_3613211_-|tail	tail fiber protein	tail	NA	NA	NA	NA
AYQ33311.1|3613272_3613767_-	SRPBCC family protein	NA	NA	NA	NA	NA
AYQ33312.1|3613845_3614739_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ33313.1|3614930_3615098_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	52.2	4.0e-05
>prophage 216
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3627144	3628740	7432530		Streptococcus_phage(100.0%)	1	NA	NA
AYQ33322.1|3627144_3628740_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	30.5	3.1e-30
>prophage 217
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3644292	3645649	7432530		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AYQ33331.1|3644292_3645039_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.3	2.3e-23
AYQ33332.1|3645073_3645649_-	SIS domain-containing protein	NA	A0A067XQR2	Caulobacter_phage	30.9	8.7e-15
>prophage 218
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3707983	3712039	7432530		Hokovirus(100.0%)	1	NA	NA
AYQ33351.1|3707983_3712039_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.6	1.9e-23
>prophage 219
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3732832	3746649	7432530		Bacillus_phage(50.0%)	11	NA	NA
AYQ33356.1|3732832_3734668_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.0	3.4e-12
AYQ33357.1|3734687_3736562_+	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	25.3	3.7e-14
AYQ33358.1|3736641_3738489_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.4	4.6e-17
AYQ36336.1|3738501_3739698_-	ATP-dependent helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	3.5e-50
AYQ33359.1|3739846_3740515_-	DUF4386 domain-containing protein	NA	NA	NA	NA	NA
AYQ33360.1|3741066_3741525_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ33361.1|3741637_3742588_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	49.5	4.0e-41
AYQ33362.1|3742663_3743092_+	VOC family protein	NA	NA	NA	NA	NA
AYQ33363.1|3743250_3743703_+	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
AYQ33364.1|3743788_3744634_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
AYQ36337.1|3744900_3746649_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	41.2	1.6e-115
>prophage 220
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3753023	3754463	7432530		Catovirus(100.0%)	1	NA	NA
AYQ33371.1|3753023_3754463_+	DASH family cryptochrome	NA	A0A1V0S949	Catovirus	30.7	2.2e-51
>prophage 221
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3760000	3761026	7432530		Enterobacteria_phage(100.0%)	1	NA	NA
AYQ33377.1|3760000_3761026_-	hypothetical protein	NA	Q9EYF3	Enterobacteria_phage	40.5	3.8e-13
>prophage 222
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3770628	3772304	7432530		Bacillus_virus(100.0%)	2	NA	NA
AYQ33387.1|3770628_3771411_+	nitrate ABC transporter, permease protein	NA	G3M9Y4	Bacillus_virus	23.2	6.1e-11
AYQ36338.1|3771446_3772304_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.9	3.5e-28
>prophage 223
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3783992	3785243	7432530		Klosneuvirus(100.0%)	1	NA	NA
AYQ33396.1|3783992_3785243_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.3	1.4e-28
>prophage 224
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3798959	3801018	7432530		Mycobacterium_phage(50.0%)	2	NA	NA
AYQ33407.1|3798959_3799601_-	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	27.3	3.2e-10
AYQ33408.1|3799773_3801018_-	insulinase family protein	NA	A0A2K9L1M6	Tupanvirus	24.8	3.1e-33
>prophage 225
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3823638	3825003	7432530		Klosneuvirus(100.0%)	1	NA	NA
AYQ33428.1|3823638_3825003_-	phosphatase PAP2 family protein	NA	A0A1V0SKZ4	Klosneuvirus	26.0	7.6e-25
>prophage 226
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3847107	3851796	7432530		Enterobacteria_phage(50.0%)	4	NA	NA
AYQ33449.1|3847107_3849075_+	sensor protein lytS	NA	Q9EYF3	Enterobacteria_phage	32.5	9.6e-13
AYQ36343.1|3849087_3849843_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYQ33450.1|3849906_3850113_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ33451.1|3850269_3851796_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.4	9.1e-19
>prophage 227
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3863994	3869202	7432530		Mycobacterium_phage(50.0%)	5	NA	NA
AYQ33461.1|3863994_3865161_-	class A beta-lactamase-related serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	28.1	3.2e-16
AYQ33462.1|3865363_3865966_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYQ33463.1|3866025_3866724_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
AYQ33464.1|3866760_3867699_+	ketopantoate reductase	NA	NA	NA	NA	NA
AYQ33465.1|3867879_3869202_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	4.1e-36
>prophage 228
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3879852	3880611	7432530		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AYQ33473.1|3879852_3880611_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.2	1.5e-14
>prophage 229
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3889992	3892373	7432530	protease	Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
AYQ33482.1|3889992_3891570_-	DUF814 domain-containing protein	NA	A0A0P0YM59	Yellowstone_lake_phycodnavirus	37.0	3.3e-08
AYQ33483.1|3891698_3892373_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A248SJ97	Salicola_phage	44.2	1.0e-35
>prophage 230
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3924269	3925334	7432530		Enterobacteria_phage(100.0%)	1	NA	NA
AYQ33505.1|3924269_3925334_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.5	1.4e-10
>prophage 231
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3929131	3930007	7432530		Tupanvirus(100.0%)	1	NA	NA
AYQ33510.1|3929131_3930007_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	30.7	1.4e-16
>prophage 232
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3933536	3934652	7432530		Microcystis_phage(100.0%)	1	NA	NA
AYQ33514.1|3933536_3934652_+	gliding motility protein	NA	A0A075BSL8	Microcystis_phage	26.8	9.0e-16
>prophage 233
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3939540	3940251	7432530		Wolbachia_phage(100.0%)	1	NA	NA
AYQ33519.1|3939540_3940251_+	JAB domain-containing protein	NA	A0A1B2LRS6	Wolbachia_phage	26.9	1.6e-10
>prophage 234
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	3946561	3958908	7432530		Brevibacillus_phage(50.0%)	2	NA	NA
AYQ33522.1|3946561_3955951_-	T9SS C-terminal target domain-containing protein	NA	A0A0K2FL64	Brevibacillus_phage	27.4	3.2e-05
AYQ33523.1|3956034_3958908_-	response regulator	NA	W8CYM9	Bacillus_phage	36.9	7.0e-12
>prophage 235
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4003521	4007616	7432530		Bacillus_phage(100.0%)	1	NA	NA
AYQ33538.1|4003521_4007616_+	hybrid sensor histidine kinase/response regulator	NA	W8CYF6	Bacillus_phage	32.1	5.1e-24
>prophage 236
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4018042	4018930	7432530		Enterobacteria_phage(100.0%)	1	NA	NA
AYQ33544.1|4018042_4018930_-	hypothetical protein	NA	H6X3J6	Enterobacteria_phage	32.0	6.9e-27
>prophage 237
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4023666	4033083	7432530		Riemerella_phage(33.33%)	7	NA	NA
AYQ33551.1|4023666_4023972_-	type II toxin-antitoxin system HigB family toxin	NA	F5A3A2	Riemerella_phage	49.5	6.2e-20
AYQ33552.1|4024031_4024667_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
AYQ33553.1|4024750_4026922_+	gliding motility-associated C-terminal domain-containing protein	NA	NA	NA	NA	NA
AYQ33554.1|4026918_4029888_-	ATP-dependent helicase	NA	A0A097PUS9	Autographa_californica_nuclear_polyhedrosis_virus	28.1	2.4e-44
AYQ33555.1|4030196_4031045_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYQ33556.1|4031147_4031792_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ33557.1|4031961_4033083_+	acyl-CoA desaturase	NA	A6N231	Microbacterium_phage	32.0	3.2e-05
>prophage 238
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4043515	4045453	7432530		Megavirus(100.0%)	1	NA	NA
AYQ33570.1|4043515_4045453_+	polysaccharide biosynthesis protein	NA	L7Y3T9	Megavirus	27.1	2.3e-27
>prophage 239
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4066153	4069681	7432530		Mycobacterium_phage(100.0%)	1	NA	NA
AYQ33583.1|4066153_4069681_+	hypothetical protein	NA	A0A2D1GD28	Mycobacterium_phage	30.4	2.4e-38
>prophage 240
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4073209	4074132	7432530		Leptospira_phage(50.0%)	2	NA	NA
AYQ33585.1|4073209_4073725_+	hypothetical protein	NA	S5W9T9	Leptospira_phage	45.9	1.7e-14
AYQ33586.1|4073763_4074132_+	single-stranded DNA-binding protein	NA	Q6V7S6	Burkholderia_virus	47.3	3.6e-22
>prophage 241
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4083950	4085453	7432530		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYQ33594.1|4083950_4085453_+	class A beta-lactamase-related serine hydrolase	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.6	3.5e-07
>prophage 242
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4109419	4111006	7432530		Streptococcus_phage(100.0%)	1	NA	NA
AYQ33621.1|4109419_4111006_+	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	25.8	1.6e-29
>prophage 243
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4114196	4115270	7432530		Lake_Baikal_phage(100.0%)	1	NA	NA
AYQ33625.1|4114196_4115270_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	39.5	4.6e-25
>prophage 244
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4125376	4128309	7432530		uncultured_virus(50.0%)	2	NA	NA
AYQ33637.1|4125376_4127902_+	HAD family hydrolase	NA	A0A218MNH6	uncultured_virus	24.6	4.8e-41
AYQ36359.1|4127952_4128309_-	helix-turn-helix domain-containing protein	NA	A0A0P0ZCT8	Stx2-converting_phage	41.1	6.3e-16
>prophage 245
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4137303	4141655	7432530		Bacillus_phage(66.67%)	3	NA	NA
AYQ33646.1|4137303_4138545_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	26.4	1.1e-19
AYQ33647.1|4138549_4139608_+	response regulator	NA	W8CYM9	Bacillus_phage	33.1	2.3e-13
AYQ33648.1|4139741_4141655_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	31.8	1.5e-63
>prophage 246
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4145608	4150941	7432530	tRNA	Ectocarpus_siliculosus_virus(25.0%)	5	NA	NA
AYQ33652.1|4145608_4146982_-	sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.6	1.3e-08
AYQ33653.1|4146978_4147671_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	1.7e-28
AYQ33654.1|4147779_4149462_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	60.3	4.4e-192
AYQ33655.1|4149863_4150280_+	6-carboxytetrahydropterin synthase	NA	NA	NA	NA	NA
AYQ33656.1|4150242_4150941_+	GTP cyclohydrolase I FolE	NA	A0A218M2Y0	Acidovorax_phage	55.1	5.2e-54
>prophage 247
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4154720	4155467	7432530		Burkholderia_phage(100.0%)	1	NA	NA
AYQ33661.1|4154720_4155467_+	SOS response-associated peptidase	NA	C7BGE4	Burkholderia_phage	30.2	2.7e-08
>prophage 248
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4160254	4162012	7432530		Bodo_saltans_virus(100.0%)	1	NA	NA
AYQ33667.1|4160254_4162012_+	signal peptide peptidase SppA	NA	A0A2H4UUF9	Bodo_saltans_virus	21.1	2.9e-08
>prophage 249
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4179359	4186420	7432530		Bacillus_virus(33.33%)	10	NA	NA
AYQ36362.1|4179359_4179992_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	39.0	4.7e-14
AYQ33682.1|4180116_4180764_+	oxidoreductase	NA	NA	NA	NA	NA
AYQ33683.1|4180817_4181576_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ33684.1|4181572_4182043_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ33685.1|4182054_4182492_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYQ33686.1|4182501_4182906_-	DUF4174 domain-containing protein	NA	NA	NA	NA	NA
AYQ33687.1|4182930_4183794_-	glycerophosphodiester phosphodiesterase	NA	M1ICP4	Paramecium_bursaria_Chlorella_virus	25.8	3.8e-06
AYQ33688.1|4183845_4184577_+	NIPSNAP family protein	NA	NA	NA	NA	NA
AYQ33689.1|4184718_4185567_+	cytochrome c	NA	NA	NA	NA	NA
AYQ33690.1|4185568_4186420_-	alpha-1,2-fucosyltransferase	NA	E3SJA0	Synechococcus_phage	32.2	1.5e-26
>prophage 250
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4204828	4206996	7432530		Leptospira_phage(50.0%)	2	NA	NA
AYQ33707.1|4204828_4205950_-	AraC family transcriptional regulator	NA	S5WIW9	Leptospira_phage	41.4	4.8e-09
AYQ33708.1|4205961_4206996_-	class A beta-lactamase-related serine hydrolase	NA	A0A088FA76	Mycobacterium_phage	26.8	1.6e-11
>prophage 251
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4222888	4224358	7432530		Acinetobacter_phage(100.0%)	1	NA	NA
AYQ33722.1|4222888_4224358_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	40.4	4.7e-97
>prophage 252
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4233781	4234753	7432530		Cronobacter_phage(100.0%)	1	NA	NA
AYQ36366.1|4233781_4234753_-	glycosyltransferase	NA	F1C5B0	Cronobacter_phage	31.0	2.7e-24
>prophage 253
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4259553	4266868	7432530		Ectocarpus_siliculosus_virus(50.0%)	3	NA	NA
AYQ33743.1|4259553_4263066_-	response regulator	NA	Q8QNA2	Ectocarpus_siliculosus_virus	35.0	1.3e-07
AYQ33744.1|4263297_4265625_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ33745.1|4265650_4266868_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	36.4	1.3e-52
>prophage 254
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4303087	4312197	7432530		Methylophilaceae_phage(20.0%)	8	NA	NA
AYQ33776.1|4303087_4303525_+	DUF882 domain-containing protein	NA	A0A2H4FSA1	Methylophilaceae_phage	47.1	1.1e-25
AYQ33777.1|4303673_4304687_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ33778.1|4304728_4305940_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ33779.1|4305942_4306458_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ33780.1|4306454_4308095_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.4	4.1e-57
AYQ33781.1|4308495_4309521_+	glutamine synthetase	NA	A0A1V0SAX1	Catovirus	46.3	2.2e-77
AYQ33782.1|4309617_4310352_+	class I SAM-dependent methyltransferase	NA	A0A219VHB4	Ochrobactrum_phage	39.8	4.3e-43
AYQ33783.1|4310433_4312197_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.7	6.1e-51
>prophage 255
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4322667	4328193	7432530		Catovirus(33.33%)	5	NA	NA
AYQ36373.1|4322667_4324209_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.1	4.8e-84
AYQ33790.1|4324294_4324792_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYQ33791.1|4325080_4326190_-	D-TA family PLP-dependent enzyme	NA	NA	NA	NA	NA
AYQ33792.1|4326445_4327444_+	ribonucleoside-diphosphate reductase	NA	A0A1B4X9B4	Tenacibaculum_phage	67.3	2.3e-127
AYQ33793.1|4327578_4328193_-	deoxynucleoside kinase	NA	A0A1I9KK98	Lactobacillus_phage	29.1	2.7e-14
>prophage 256
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4373695	4375132	7432530	protease	Erwinia_phage(100.0%)	1	NA	NA
AYQ33829.1|4373695_4375132_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	27.6	4.4e-39
>prophage 257
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4378187	4379417	7432530		Streptococcus_phage(100.0%)	1	NA	NA
AYQ33836.1|4378187_4379417_+	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	32.3	1.6e-42
>prophage 258
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4391123	4392089	7432530		Synechococcus_phage(100.0%)	1	NA	NA
AYQ33847.1|4391123_4392089_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	32.0	1.8e-28
>prophage 259
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4413481	4415733	7432530		Enterococcus_phage(50.0%)	4	NA	NA
AYQ33861.1|4413481_4414363_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	33.1	1.9e-29
AYQ33862.1|4414382_4414718_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AYQ33863.1|4414707_4415016_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
AYQ33864.1|4415022_4415733_-	NAD-dependent deacylase	NA	A0A2I7QWN6	Vibrio_phage	36.5	3.0e-25
>prophage 260
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4431750	4432755	7432530		Bacillus_virus(100.0%)	1	NA	NA
AYQ33877.1|4431750_4432755_-	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.1	1.2e-19
>prophage 261
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4461190	4466084	7432530		Stx2-converting_phage(50.0%)	6	NA	NA
AYQ33898.1|4461190_4461763_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.4	8.1e-21
AYQ33899.1|4461768_4462182_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AYQ33900.1|4462505_4464008_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.9e-24
AYQ33901.1|4464111_4465296_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AYQ36383.1|4465413_4465731_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	38.5	2.6e-13
AYQ33902.1|4465727_4466084_+	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	48.2	1.0e-18
>prophage 262
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4469630	4470500	7432530		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AYQ33905.1|4469630_4470500_+	acyltransferase	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	40.4	5.3e-56
>prophage 263
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4478857	4480066	7432530		Mycobacterium_phage(100.0%)	1	NA	NA
AYQ33909.1|4478857_4480066_-	class A beta-lactamase-related serine hydrolase	NA	Q19XB5	Mycobacterium_phage	29.7	1.1e-22
>prophage 264
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4498171	4500219	7432530		Bacillus_phage(100.0%)	2	NA	NA
AYQ33918.1|4498171_4498858_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.5	1.4e-27
AYQ33919.1|4498854_4500219_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	27.9	1.7e-24
>prophage 265
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4526460	4528383	7432530		Wolbachia_phage(100.0%)	1	NA	NA
AYQ33940.1|4526460_4528383_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	28.2	2.1e-60
>prophage 266
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4534987	4535758	7432530		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
AYQ33947.1|4534987_4535758_-	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	34.0	8.9e-31
>prophage 267
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4555065	4561618	7432530		Bacillus_phage(33.33%)	5	NA	NA
AYQ33960.1|4555065_4557399_+	ATP-dependent DNA helicase	NA	A7KV33	Bacillus_phage	39.4	5.9e-118
AYQ33961.1|4557462_4558068_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
AYQ33962.1|4558112_4559276_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AYQ33963.1|4559614_4560319_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	28.9	3.0e-09
AYQ33964.1|4560325_4561618_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	9.4e-25
>prophage 268
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4568807	4569623	7432530		Croceibacter_phage(100.0%)	1	NA	NA
AYQ33970.1|4568807_4569623_-	3'-5' exonuclease	NA	I6R9X8	Croceibacter_phage	39.8	6.7e-45
>prophage 269
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4579346	4580927	7432530		Mycobacterium_phage(100.0%)	1	NA	NA
AYQ33977.1|4579346_4580927_+	serine hydrolase	NA	V5R513	Mycobacterium_phage	33.3	1.6e-05
>prophage 270
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4584144	4586271	7432530		Bacillus_virus(100.0%)	1	NA	NA
AYQ33980.1|4584144_4586271_+	OmpA family protein	NA	G3M9Z1	Bacillus_virus	31.0	2.7e-05
>prophage 271
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4591673	4598020	7432530		Lactococcus_phage(50.0%)	6	NA	NA
AYQ36387.1|4591673_4592546_-	cysteine synthase CysM	NA	C3U2M1	Lactococcus_phage	37.0	1.7e-41
AYQ33983.1|4592608_4592821_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ33984.1|4592824_4593238_+	nucleotide-binding protein, PIN domain-containing protein	NA	NA	NA	NA	NA
AYQ33985.1|4593258_4594782_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYQ33986.1|4594794_4595295_+	gliding motility lipoprotein GldH	NA	NA	NA	NA	NA
AYQ33987.1|4595365_4598020_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	24.9	3.9e-49
>prophage 272
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4617234	4622990	7432530		Acinetobacter_phage(75.0%)	8	NA	NA
AYQ34004.1|4617234_4617801_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	41.8	2.1e-37
AYQ34005.1|4617805_4618786_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A0F7L837	uncultured_marine_virus	27.1	2.0e-11
AYQ34006.1|4618802_4619222_+	fatty-acid oxidation protein subunit alpha	NA	NA	NA	NA	NA
AYQ34007.1|4619209_4619548_+	XisI protein	NA	NA	NA	NA	NA
AYQ34008.1|4619597_4620521_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AYQ34009.1|4620546_4621536_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	33.9	1.1e-44
AYQ34010.1|4621584_4622184_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
AYQ34011.1|4622183_4622990_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	40.2	3.4e-41
>prophage 273
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4628769	4629555	7432530		Deep-sea_thermophilic_phage(100.0%)	1	NA	NA
AYQ34020.1|4628769_4629555_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	30.3	3.1e-15
>prophage 274
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4633644	4634808	7432530		Mycobacterium_phage(100.0%)	1	NA	NA
AYQ34026.1|4633644_4634808_+	class A beta-lactamase-related serine hydrolase	NA	A0A088FA76	Mycobacterium_phage	28.4	1.1e-19
>prophage 275
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4640786	4643027	7432530		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
AYQ34030.1|4640786_4643027_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	38.0	5.3e-92
>prophage 276
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4661446	4662322	7432530		Bacillus_phage(100.0%)	1	NA	NA
AYQ34046.1|4661446_4662322_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	53.7	2.7e-76
>prophage 277
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4667005	4673693	7432530		Streptococcus_phage(50.0%)	5	NA	NA
AYQ34054.1|4667005_4669048_+	K(+)-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	27.6	5.6e-40
AYQ34055.1|4669065_4669629_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
AYQ34056.1|4669650_4670724_+	porin	NA	NA	NA	NA	NA
AYQ34057.1|4670728_4671859_+	sensor protein KdpD	NA	NA	NA	NA	NA
AYQ34058.1|4671995_4673693_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.9	2.2e-18
>prophage 278
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4677930	4682516	7432530	tRNA	Bacillus_phage(50.0%)	5	NA	NA
AYQ34064.1|4677930_4679394_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0S2SXN2	Bacillus_phage	40.2	4.9e-14
AYQ36391.1|4679472_4680930_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
AYQ34065.1|4681082_4681283_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
AYQ36392.1|4681462_4681876_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
AYQ34066.1|4681985_4682516_-	putative metal-dependent hydrolase	NA	D0R7I3	Paenibacillus_phage	50.9	3.2e-24
>prophage 279
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4686916	4690234	7432530		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
AYQ34072.1|4686916_4690234_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.1	2.7e-23
>prophage 280
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4693621	4695025	7432530		Erysipelothrix_phage(100.0%)	1	NA	NA
AYQ34075.1|4693621_4695025_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.0	9.5e-47
>prophage 281
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4706808	4710338	7432530		Bacillus_phage(33.33%)	3	NA	NA
AYQ34083.1|4706808_4709115_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	29.1	1.2e-41
AYQ34084.1|4709147_4709558_-	cytidyltransferase-like protein	NA	A0A1V0SLZ7	Klosneuvirus	43.9	1.8e-22
AYQ34085.1|4709609_4710338_-	hypothetical protein	NA	A0A1V0SD50	Indivirus	30.2	4.3e-11
>prophage 282
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4749368	4751246	7432530		Flavobacterium_phage(100.0%)	1	NA	NA
AYQ34112.1|4749368_4751246_-	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	59.3	1.0e-43
>prophage 283
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4763348	4763861	7432530		Synechococcus_phage(100.0%)	1	NA	NA
AYQ34120.1|4763348_4763861_-	HNH endonuclease	NA	F5B475	Synechococcus_phage	40.4	1.5e-21
>prophage 284
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4767232	4772361	7432530		Leptospira_phage(50.0%)	3	NA	NA
AYQ34124.1|4767232_4770280_+	AcrB/AcrD/AcrF family protein	NA	S5VTK5	Leptospira_phage	24.7	3.3e-76
AYQ34125.1|4770367_4771825_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
AYQ34126.1|4771869_4772361_-	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	43.6	4.2e-34
>prophage 285
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4778570	4780762	7432530		Catovirus(50.0%)	2	NA	NA
AYQ34131.1|4778570_4779581_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	A0A1V0SAI8	Catovirus	33.6	1.0e-42
AYQ34132.1|4779577_4780762_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	23.0	6.6e-09
>prophage 286
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4786208	4787312	7432530	tail	Lake_Baikal_phage(100.0%)	1	NA	NA
AYQ34138.1|4786208_4787312_+|tail	tail fiber domain-containing protein	tail	A0A2H4N7J7	Lake_Baikal_phage	43.6	9.2e-13
>prophage 287
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4811531	4811789	7432530		uncultured_virus(100.0%)	1	NA	NA
AYQ34159.1|4811531_4811789_+	ArsR family transcriptional regulator	NA	A0A218MNF3	uncultured_virus	32.9	2.8e-05
>prophage 288
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4817558	4818440	7432530	integrase	Brevibacillus_phage(100.0%)	1	4811313:4811327	4819678:4819692
4811313:4811327	attL	CCCATAAAAATAAAA	NA	NA	NA	NA
AYQ34165.1|4817558_4818440_-|integrase	integrase	integrase	A0A0K2CP59	Brevibacillus_phage	30.3	1.1e-32
AYQ34165.1|4817558_4818440_-|integrase	integrase	integrase	A0A0K2CP59	Brevibacillus_phage	30.3	1.1e-32
4819678:4819692	attR	CCCATAAAAATAAAA	NA	NA	NA	NA
>prophage 289
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4826643	4827378	7432530		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AYQ34174.1|4826643_4827378_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.1	4.2e-14
>prophage 290
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4835119	4837027	7432530		Mollivirus(100.0%)	1	NA	NA
AYQ34183.1|4835119_4837027_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	26.8	1.0e-11
>prophage 291
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4843670	4844846	7432530		Enterobacteria_phage(100.0%)	1	NA	NA
AYQ36401.1|4843670_4844846_+	hypothetical protein	NA	Q9EYF3	Enterobacteria_phage	29.2	7.0e-11
>prophage 292
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4857009	4860479	7432530		Clostridioides_phage(50.0%)	4	NA	NA
AYQ34203.1|4857009_4857699_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.1	8.0e-15
AYQ34204.1|4857688_4858750_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ34205.1|4858780_4859560_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ34206.1|4859573_4860479_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	47.1	9.1e-43
>prophage 293
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4866321	4867575	7432530		Streptococcus_phage(100.0%)	1	NA	NA
AYQ34211.1|4866321_4867575_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	3.2e-94
>prophage 294
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4874759	4875245	7432530		Synechococcus_phage(100.0%)	1	NA	NA
AYQ34219.1|4874759_4875245_+	D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase	NA	E3SJ88	Synechococcus_phage	40.3	8.9e-21
>prophage 295
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4880812	4882117	7432530		Burkholderia_phage(100.0%)	1	NA	NA
AYQ34223.1|4880812_4882117_+	hypothetical protein	NA	C7BGE8	Burkholderia_phage	28.6	8.6e-18
>prophage 296
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4886769	4888730	7432530		Acidianus_two-tailed_virus(50.0%)	2	NA	NA
AYQ34227.1|4886769_4887726_-	MoxR family ATPase	NA	A0A1C9EG61	Acidianus_two-tailed_virus	25.0	2.6e-08
AYQ34228.1|4887833_4888730_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.0	1.6e-10
>prophage 297
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4897773	4898286	7432530		Sinorhizobium_phage(100.0%)	1	NA	NA
AYQ34238.1|4897773_4898286_-	RNA polymerase sigma factor	NA	A0A0F6TH34	Sinorhizobium_phage	32.5	2.3e-14
>prophage 298
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4924186	4925092	7432530		Faustovirus(100.0%)	1	NA	NA
AYQ34255.1|4924186_4925092_+	hypothetical protein	NA	A0A1X7QFZ0	Faustovirus	34.2	3.6e-31
>prophage 299
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4933711	4940189	7432530		Brazilian_cedratvirus(25.0%)	8	NA	NA
AYQ34263.1|4933711_4934458_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.0	1.4e-17
AYQ34264.1|4934437_4934893_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ34265.1|4934959_4935295_+	arsenate reductase	NA	NA	NA	NA	NA
AYQ34266.1|4935291_4936410_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.6	2.3e-27
AYQ34267.1|4936447_4937032_-	glycerol acyltransferase	NA	NA	NA	NA	NA
AYQ34268.1|4937177_4938047_+	YitT family protein	NA	NA	NA	NA	NA
AYQ34269.1|4938089_4939145_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	49.4	1.1e-87
AYQ36408.1|4939160_4940189_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	43.0	5.8e-78
>prophage 300
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4944206	4944956	7432530		Flavobacterium_phage(100.0%)	1	NA	NA
AYQ34273.1|4944206_4944956_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	48.9	8.6e-31
>prophage 301
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4962528	4964439	7432530		Aureococcus_anophage(100.0%)	1	NA	NA
AYQ34289.1|4962528_4964439_-	DUF2075 domain-containing protein	NA	A0A076FFX0	Aureococcus_anophage	22.8	5.1e-11
>prophage 302
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4981370	4982231	7432530		Tupanvirus(100.0%)	1	NA	NA
AYQ34305.1|4981370_4982231_-	inositol oxygenase	NA	A0A2K9L6K3	Tupanvirus	47.0	1.7e-62
>prophage 303
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	4989511	4992074	7432530		Organic_Lake_phycodnavirus(50.0%)	3	NA	NA
AYQ34312.1|4989511_4990138_-	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.2	2.8e-06
AYQ34313.1|4990202_4991393_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ34314.1|4991486_4992074_+	thymidine kinase	NA	Q6GYZ9	Mycoplasma_phage	41.9	1.9e-33
>prophage 304
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5021781	5026241	7432530	tRNA	Orpheovirus(50.0%)	3	NA	NA
AYQ36412.1|5021781_5023560_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	26.4	2.6e-41
AYQ34341.1|5023707_5025237_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ34342.1|5025233_5026241_-	DNA cytosine methyltransferase	NA	Q6DMX0	Streptococcus_phage	47.9	6.7e-71
>prophage 305
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5039142	5041995	7432530		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AYQ34354.1|5039142_5041995_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	52.4	3.6e-279
>prophage 306
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5051860	5054449	7432530		Acinetobacter_phage(100.0%)	1	NA	NA
AYQ34362.1|5051860_5054449_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	39.6	7.4e-13
>prophage 307
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5058662	5059319	7432530		Vibrio_phage(100.0%)	1	NA	NA
AYQ34365.1|5058662_5059319_+	nicotinamide riboside transporter PnuC	NA	A0A2I7SAC7	Vibrio_phage	29.4	1.6e-20
>prophage 308
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5063887	5064652	7432530		Tupanvirus(100.0%)	1	NA	NA
AYQ34371.1|5063887_5064652_+	patatin	NA	A0A2K9L145	Tupanvirus	28.3	1.8e-15
>prophage 309
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5077133	5077736	7432530		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
AYQ34380.1|5077133_5077736_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	55.8	1.1e-57
>prophage 310
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5082065	5085226	7432530	protease	Bacillus_virus(33.33%)	3	NA	NA
AYQ34388.1|5082065_5083304_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.1	8.8e-113
AYQ34389.1|5083303_5084023_+	alpha/beta hydrolase	NA	A0A0B5A484	Mycobacterium_phage	27.8	2.2e-07
AYQ34390.1|5084155_5085226_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.3	1.0e-37
>prophage 311
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5091012	5094804	7432530		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
AYQ34394.1|5091012_5093049_+	M13 family peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	32.6	5.7e-85
AYQ34395.1|5093268_5094804_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	43.7	1.2e-58
>prophage 312
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5119311	5120049	7432530		Enterobacteria_phage(100.0%)	1	NA	NA
AYQ34416.1|5119311_5120049_-	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	28.9	2.0e-08
>prophage 313
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5128742	5131375	7432530		Hokovirus(50.0%)	4	NA	NA
AYQ34425.1|5128742_5129777_-	GHKL domain-containing protein	NA	A0A1V0SGX0	Hokovirus	32.6	7.8e-22
AYQ34426.1|5129900_5130083_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AYQ34427.1|5130169_5130322_+	DUF4295 domain-containing protein	NA	NA	NA	NA	NA
AYQ34428.1|5130418_5131375_+	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	35.8	6.9e-17
>prophage 314
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5165626	5167636	7432530		Vaccinia_virus(100.0%)	1	NA	NA
AYQ34455.1|5165626_5167636_-	beta-galactosidase	NA	B9U1V4	Vaccinia_virus	26.0	1.1e-40
>prophage 315
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5197033	5198227	7432530		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
AYQ34473.1|5197033_5198227_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	27.7	1.2e-34
>prophage 316
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5206962	5207655	7432530		Bacillus_phage(100.0%)	1	NA	NA
AYQ36422.1|5206962_5207655_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	32.9	2.2e-28
>prophage 317
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5213628	5217789	7432530		Acanthocystis_turfacea_Chlorella_virus(50.0%)	4	NA	NA
AYQ34487.1|5213628_5215272_-	hypothetical protein	NA	M1HZ90	Acanthocystis_turfacea_Chlorella_virus	23.7	1.7e-10
AYQ36424.1|5215331_5215526_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ34488.1|5215583_5216942_-	PhoPQ-activated pathogenicity-like protein PqaA type	NA	NA	NA	NA	NA
AYQ36425.1|5216970_5217789_-	glycerophosphodiester phosphodiesterase	NA	A0A1J0F961	Only_Syngen_Nebraska_virus	27.5	1.2e-12
>prophage 318
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5263621	5276609	7432530		Cronobacter_phage(25.0%)	8	NA	NA
AYQ34522.1|5263621_5266252_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.6	6.4e-121
AYQ34523.1|5266416_5267568_+	ribonuclease D	NA	NA	NA	NA	NA
AYQ34524.1|5267595_5268198_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
AYQ34525.1|5268200_5268989_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ34526.1|5268995_5271881_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	43.3	1.0e-220
AYQ34527.1|5272028_5272445_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	22.4	7.7e-05
AYQ34528.1|5272554_5273514_-	fasciclin domain-containing protein	NA	NA	NA	NA	NA
AYQ34529.1|5273699_5276609_-	glycine dehydrogenase (aminomethyl-transferring)	NA	E3SN07	Prochlorococcus_phage	50.7	2.9e-260
>prophage 319
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5282523	5285361	7432530		Bacillus_phage(100.0%)	1	NA	NA
AYQ34536.1|5282523_5285361_-	DNA polymerase I	NA	F8WQ35	Bacillus_phage	39.4	4.3e-54
>prophage 320
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5291937	5293706	7432530		Sinorhizobium_phage(50.0%)	3	NA	NA
AYQ34544.1|5291937_5292567_+	RNA polymerase subunit sigma	NA	A0A0F6TH34	Sinorhizobium_phage	39.4	4.1e-18
AYQ34545.1|5292845_5293133_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ34546.1|5293139_5293706_+	guanylate kinase	NA	A0A1W6JK60	Lactococcus_phage	35.8	1.4e-12
>prophage 321
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5320924	5322535	7432530		Cellulophaga_phage(100.0%)	1	NA	NA
AYQ34566.1|5320924_5322535_-	polysaccharide lyase	NA	S0A0V0	Cellulophaga_phage	27.8	1.1e-25
>prophage 322
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5343007	5343769	7432530		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AYQ34578.1|5343007_5343769_-	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.6	1.6e-16
>prophage 323
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5347813	5348389	7432530		Synechococcus_phage(100.0%)	1	NA	NA
AYQ34583.1|5347813_5348389_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.6	3.0e-23
>prophage 324
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5391807	5400443	7432530		Hokovirus(25.0%)	8	NA	NA
AYQ34618.1|5391807_5393190_-	sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	28.6	2.6e-17
AYQ34619.1|5393273_5394038_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ34620.1|5394038_5395085_-	hypothetical protein	NA	A0A2H4PQM9	Staphylococcus_phage	23.2	4.9e-08
AYQ34621.1|5395088_5395535_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AYQ34622.1|5395651_5397262_+	T9SS C-terminal target domain-containing protein	NA	A0A2D1GD28	Mycobacterium_phage	27.2	6.6e-28
AYQ34623.1|5397276_5397714_-	restriction endonuclease subunit R	NA	NA	NA	NA	NA
AYQ34624.1|5397789_5398560_+	AMP nucleosidase	NA	NA	NA	NA	NA
AYQ34625.1|5398883_5400443_+	GNAT family N-acetyltransferase	NA	M1I1L7	Acanthocystis_turfacea_Chlorella_virus	27.2	4.3e-08
>prophage 325
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5406354	5408190	7432530		Acanthamoeba_polyphaga_lentillevirus(100.0%)	1	NA	NA
AYQ34628.1|5406354_5408190_+	phospholipase	NA	J2YB99	Acanthamoeba_polyphaga_lentillevirus	31.1	5.4e-10
>prophage 326
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5412729	5418676	7432530		Orpheovirus(50.0%)	4	NA	NA
AYQ34633.1|5412729_5413329_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	30.4	5.3e-15
AYQ34634.1|5413464_5414586_+	XdhC family protein	NA	NA	NA	NA	NA
AYQ34635.1|5414596_5415796_+	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AYQ34636.1|5416255_5418676_+	ribonucleoside-diphosphate reductase subunit alpha	NA	G4YAV1	Emiliania_huxleyi_virus	65.9	2.1e-296
>prophage 327
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5422704	5426335	7432530		Escherichia_phage(33.33%)	4	NA	NA
AYQ34640.1|5422704_5423565_-	ribose-phosphate pyrophosphokinase	NA	A0A291LA84	Escherichia_phage	35.2	6.6e-35
AYQ34641.1|5423617_5424031_-	GxxExxY protein	NA	NA	NA	NA	NA
AYQ34642.1|5424183_5425659_-	nicotinate phosphoribosyltransferase	NA	K7QN54	Staphylococcus_phage	53.3	2.4e-141
AYQ34643.1|5425687_5426335_-	NUDIX domain-containing protein	NA	G3MA14	Bacillus_virus	31.6	1.5e-26
>prophage 328
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5436955	5437657	7432530		Bacillus_phage(100.0%)	1	NA	NA
AYQ34656.1|5436955_5437657_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	40.1	3.0e-41
>prophage 329
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5450886	5459505	7432530		Synechococcus_phage(25.0%)	7	NA	NA
AYQ34669.1|5450886_5451906_-	alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.3	5.3e-15
AYQ34670.1|5451981_5452482_-	thioredoxin family protein	NA	NA	NA	NA	NA
AYQ34671.1|5452478_5454773_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.6	5.2e-10
AYQ34672.1|5455049_5455433_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ34673.1|5455690_5455984_+	type II toxin-antitoxin system HigB family toxin	NA	F5A3A2	Riemerella_phage	50.5	2.7e-20
AYQ34674.1|5455987_5456383_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYQ34675.1|5456379_5459505_-	AcrB/AcrD/AcrF family protein	NA	S5VTK5	Leptospira_phage	22.7	2.1e-70
>prophage 330
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5478525	5481597	7432530		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AYQ34691.1|5478525_5481597_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	40.8	1.6e-38
>prophage 331
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5492900	5495009	7432530		Escherichia_phage(100.0%)	1	NA	NA
AYQ34697.1|5492900_5495009_-	molybdopterin oxidoreductase family protein	NA	A0A077SK27	Escherichia_phage	22.6	5.6e-19
>prophage 332
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5499031	5500132	7432530		Halovirus(100.0%)	1	NA	NA
AYQ34702.1|5499031_5500132_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	1.8e-48
>prophage 333
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5531492	5532578	7432530		Pacmanvirus(100.0%)	1	NA	NA
AYQ34743.1|5531492_5532578_-	patatin	NA	A0A1X6WGP5	Pacmanvirus	31.1	2.5e-31
>prophage 334
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5560549	5567863	7432530		Cannes_8_virus(33.33%)	5	NA	NA
AYQ34764.1|5560549_5562334_-	serine/threonine protein kinase	NA	T2AWK4	Cannes_8_virus	30.4	1.3e-24
AYQ34765.1|5562358_5563207_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
AYQ34766.1|5563221_5564112_-	serine/threonine protein kinase	NA	A0A0M4JBJ9	Mollivirus	28.2	2.2e-17
AYQ34767.1|5564118_5565795_-	FHA domain-containing protein	NA	NA	NA	NA	NA
AYQ34768.1|5566081_5567863_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.6	4.1e-31
>prophage 335
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5576095	5581608	7432530	tRNA	Moumouvirus(33.33%)	6	NA	NA
AYQ34774.1|5576095_5577547_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	36.3	3.0e-80
AYQ34775.1|5577670_5578765_+	hypothetical protein	NA	A0A2I7RNF1	Vibrio_phage	27.9	1.0e-08
AYQ34776.1|5578757_5579270_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ34777.1|5579295_5579619_+	DUF3467 domain-containing protein	NA	NA	NA	NA	NA
AYQ34778.1|5579736_5580600_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ34779.1|5580687_5581608_+	aspartate carbamoyltransferase catalytic subunit	NA	Q84489	Paramecium_bursaria_Chlorella_virus	30.6	1.5e-29
>prophage 336
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5599133	5604605	7432530		Enterobacteria_phage(50.0%)	6	NA	NA
AYQ34790.1|5599133_5600312_+	hypothetical protein	NA	Q9EYF3	Enterobacteria_phage	31.4	2.2e-12
AYQ34791.1|5600315_5600996_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYQ34792.1|5601033_5601264_+	DUF2281 domain-containing protein	NA	NA	NA	NA	NA
AYQ34793.1|5601258_5602341_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ34794.1|5602343_5602859_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
AYQ34795.1|5602979_5604605_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	25.2	1.1e-46
>prophage 337
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5609260	5609923	7432530		Planktothrix_phage(100.0%)	1	NA	NA
AYQ34800.1|5609260_5609923_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	3.0e-27
>prophage 338
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5664242	5665838	7432530		Mycobacterium_phage(100.0%)	1	NA	NA
AYQ34834.1|5664242_5665838_-	class A beta-lactamase-related serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	28.2	1.9e-11
>prophage 339
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5670887	5673005	7432530		Klosneuvirus(100.0%)	1	NA	NA
AYQ34840.1|5670887_5673005_+	M3 family peptidase	NA	A0A1V0SID3	Klosneuvirus	25.8	4.7e-58
>prophage 340
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5725591	5728645	7432530	tail	Vibrio_phage(50.0%)	3	NA	NA
AYQ34865.1|5725591_5726593_+|tail	tail fiber domain-containing protein	tail	A0A0U4IGZ2	Vibrio_phage	42.7	6.4e-13
AYQ34866.1|5726676_5727552_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ34867.1|5727571_5728645_+|tail	tail fiber domain-containing protein	tail	A0A0F6R513	Sinorhizobium_phage	42.0	5.2e-13
>prophage 341
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5761744	5762422	7432530		Planktothrix_phage(100.0%)	1	NA	NA
AYQ34887.1|5761744_5762422_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.0	2.2e-33
>prophage 342
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5769751	5771365	7432530		Aeromonas_phage(100.0%)	1	NA	NA
AYQ34892.1|5769751_5771365_-	sodium transporter	NA	A0A240F3J2	Aeromonas_phage	35.9	2.9e-76
>prophage 343
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5779194	5781729	7432530		Mycobacterium_phage(100.0%)	1	NA	NA
AYQ36450.1|5779194_5781729_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	45.2	5.8e-71
>prophage 344
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5784998	5785826	7432530		Ochrobactrum_phage(100.0%)	1	NA	NA
AYQ34900.1|5784998_5785826_-	helix-turn-helix domain-containing protein	NA	A0A219VHC0	Ochrobactrum_phage	33.3	2.8e-06
>prophage 345
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5799464	5800619	7432530		Pseudomonas_phage(100.0%)	1	NA	NA
AYQ34909.1|5799464_5800619_+	acyltransferase	NA	W6MVL2	Pseudomonas_phage	27.4	1.1e-08
>prophage 346
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5822103	5823732	7432530		Pike_perch_iridovirus(100.0%)	1	NA	NA
AYQ34924.1|5822103_5823732_+	acyl-CoA carboxylase subunit beta	NA	A0A1B2ITV7	Pike_perch_iridovirus	48.7	6.7e-12
>prophage 347
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5829629	5830589	7432530		Pandoravirus(100.0%)	1	NA	NA
AYQ34932.1|5829629_5830589_+	isopenicillin N synthase family oxygenase	NA	S4VNP9	Pandoravirus	26.9	7.4e-19
>prophage 348
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5844156	5845464	7432530	integrase	Cellulophaga_phage(100.0%)	1	5843686:5843700	5855573:5855587
5843686:5843700	attL	AATTTTTGATTTTTA	NA	NA	NA	NA
AYQ34949.1|5844156_5845464_-|integrase	site-specific integrase	integrase	S0A3I4	Cellulophaga_phage	29.6	3.7e-37
AYQ34949.1|5844156_5845464_-|integrase	site-specific integrase	integrase	S0A3I4	Cellulophaga_phage	29.6	3.7e-37
5855573:5855587	attR	TAAAAATCAAAAATT	NA	NA	NA	NA
>prophage 349
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5874669	5875746	7432530		Pseudomonas_phage(100.0%)	1	NA	NA
AYQ34971.1|5874669_5875746_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	2.4e-05
>prophage 350
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5883214	5883745	7432530		uncultured_virus(100.0%)	1	NA	NA
AYQ34977.1|5883214_5883745_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.9	8.0e-15
>prophage 351
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5891386	5892619	7432530		White-tailed_deer_poxvirus(100.0%)	1	NA	NA
AYQ36457.1|5891386_5892619_-	serpin family protein	NA	A0A2I6BQM3	White-tailed_deer_poxvirus	30.2	7.3e-27
>prophage 352
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5895998	5897183	7432530		Insectomime_virus(100.0%)	1	NA	NA
AYQ34986.1|5895998_5897183_+	elongation factor Tu	NA	V5L5J1	Insectomime_virus	27.0	1.4e-19
>prophage 353
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5903988	5912287	7432530		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
AYQ34995.1|5903988_5907846_+	DNA-directed RNA polymerase subunit beta	NA	E3T4Z4	Cafeteria_roenbergensis_virus	21.6	2.2e-37
AYQ34996.1|5907955_5912287_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.6	1.3e-62
>prophage 354
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5918269	5919727	7432530		Staphylococcus_phage(100.0%)	1	NA	NA
AYQ35000.1|5918269_5919727_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	21.9	1.3e-09
>prophage 355
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5940353	5941550	7432530		Tupanvirus(100.0%)	1	NA	NA
AYQ35020.1|5940353_5941550_-	S8 family peptidase	NA	A0A2K9L570	Tupanvirus	42.8	5.4e-35
>prophage 356
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5944566	5945967	7432530		Streptococcus_phage(100.0%)	1	NA	NA
AYQ35024.1|5944566_5945967_-	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	25.0	1.4e-05
>prophage 357
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5964932	5966003	7432530		Hokovirus(100.0%)	1	NA	NA
AYQ35040.1|5964932_5966003_+	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	31.2	2.0e-36
>prophage 358
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5978957	5980865	7432530		Enterobacteria_phage(100.0%)	1	NA	NA
AYQ35052.1|5978957_5980865_+	hypothetical protein	NA	Q9EYF3	Enterobacteria_phage	36.4	1.3e-22
>prophage 359
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5987308	5991617	7432530		Hokovirus(50.0%)	4	NA	NA
AYQ35059.1|5987308_5988556_-	GTP-binding protein	NA	A0A1V0SGC3	Hokovirus	27.3	2.9e-39
AYQ35060.1|5988719_5989652_-	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
AYQ35061.1|5989704_5990418_-	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
AYQ35062.1|5990426_5991617_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A2K9L1P0	Tupanvirus	25.6	1.7e-12
>prophage 360
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	5998155	5998851	7432530		Bacillus_phage(100.0%)	1	NA	NA
AYQ35068.1|5998155_5998851_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.8	2.9e-28
>prophage 361
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6010487	6011162	7432530		Planktothrix_phage(100.0%)	1	NA	NA
AYQ35080.1|6010487_6011162_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	4.9e-33
>prophage 362
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6018281	6021880	7432530		Acanthamoeba_polyphaga_moumouvirus(50.0%)	2	NA	NA
AYQ35088.1|6018281_6021086_-	insulinase family protein	NA	L7RBE7	Acanthamoeba_polyphaga_moumouvirus	33.9	3.5e-16
AYQ36464.1|6021265_6021880_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	36.3	3.0e-21
>prophage 363
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6028551	6030438	7432530		Bacillus_phage(100.0%)	1	NA	NA
AYQ35091.1|6028551_6030438_-	type IIA DNA topoisomerase subunit B	NA	A0A172JHT4	Bacillus_phage	32.5	1.3e-67
>prophage 364
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6035583	6036834	7432530		Staphylococcus_phage(100.0%)	1	NA	NA
AYQ35095.1|6035583_6036834_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.7	2.3e-12
>prophage 365
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6050581	6051616	7432530		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYQ35108.1|6050581_6051616_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	25.7	1.1e-10
>prophage 366
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6059387	6060065	7432530		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
AYQ35116.1|6059387_6060065_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.1	1.1e-53
>prophage 367
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6075652	6077329	7432530		Catovirus(100.0%)	1	NA	NA
AYQ35119.1|6075652_6077329_-	AMP-dependent synthetase	NA	A0A1V0SBX8	Catovirus	28.3	2.6e-51
>prophage 368
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6081263	6083669	7432530		Lactobacillus_phage(100.0%)	1	NA	NA
AYQ35126.1|6081263_6083669_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	39.2	5.6e-07
>prophage 369
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6102396	6105780	7432530		Herpes_simplex_virus(100.0%)	1	NA	NA
AYQ35141.1|6102396_6105780_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	35.0	6.8e-176
>prophage 370
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6117446	6120205	7432530		Staphylococcus_phage(50.0%)	3	NA	NA
AYQ36467.1|6117446_6118694_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	2.3e-105
AYQ35153.1|6118758_6119415_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ35154.1|6119494_6120205_-	ATP-binding cassette domain-containing protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	29.1	2.1e-18
>prophage 371
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6143494	6146146	7432530	tRNA	Klosneuvirus(100.0%)	1	NA	NA
AYQ35173.1|6143494_6146146_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	42.7	1.4e-94
>prophage 372
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6154512	6155223	7432530		Bacillus_phage(100.0%)	1	NA	NA
AYQ36468.1|6154512_6155223_+	short chain dehydrogenase	NA	W8CYX9	Bacillus_phage	35.7	1.8e-09
>prophage 373
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6160873	6167037	7432530		Klosneuvirus(33.33%)	5	NA	NA
AYQ35188.1|6160873_6161827_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	27.6	9.3e-30
AYQ35189.1|6161796_6163065_-	sterol desaturase family protein	NA	A0A1V0CNR7	Kaumoebavirus	29.1	6.0e-08
AYQ35190.1|6163163_6164225_-	radical SAM/Cys-rich domain protein	NA	NA	NA	NA	NA
AYQ35191.1|6164252_6164588_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AYQ36469.1|6164709_6167037_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.8e-64
>prophage 374
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6189014	6190488	7432530		Escherichia_phage(50.0%)	2	NA	NA
AYQ35204.1|6189014_6189875_+	glucose-1-phosphate thymidylyltransferase	NA	K7QKA7	Escherichia_phage	62.9	1.4e-96
AYQ35205.1|6189879_6190488_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.6	1.3e-29
>prophage 375
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6198676	6199048	7432530		Flavobacterium_phage(100.0%)	1	NA	NA
AYQ35211.1|6198676_6199048_+	DUF3127 domain-containing protein	NA	Q5ZGC0	Flavobacterium_phage	26.8	5.3e-05
>prophage 376
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6233844	6235322	7432530		Mycoplasma_phage(50.0%)	2	NA	NA
AYQ36474.1|6233844_6234510_+	molybdate ABC transporter permease subunit	NA	Q6GZ02	Mycoplasma_phage	25.5	1.3e-06
AYQ35237.1|6234506_6235322_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.7	3.4e-20
>prophage 377
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6245920	6249373	7432530	tRNA	Orpheovirus(100.0%)	1	NA	NA
AYQ35244.1|6245920_6249373_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	31.6	1.1e-160
>prophage 378
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6268913	6278587	7432530	tRNA	Ralstonia_phage(25.0%)	8	NA	NA
AYQ35261.1|6268913_6270086_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	29.2	5.1e-30
AYQ35262.1|6270131_6271094_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AYQ35263.1|6271432_6272590_+	cysteine desulfurase	NA	H7BUW1	unidentified_phage	34.5	9.0e-27
AYQ35264.1|6272593_6273625_-	ferredoxin	NA	NA	NA	NA	NA
AYQ35265.1|6273676_6274759_-	AhpC/TSA family protein	NA	NA	NA	NA	NA
AYQ35266.1|6274887_6276597_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	40.9	7.6e-91
AYQ35267.1|6276686_6277808_-	glycosyl transferase	NA	NA	NA	NA	NA
AYQ35268.1|6277774_6278587_-	UDP-2,3-diacylglucosamine diphosphatase	NA	A0A218MKA7	uncultured_virus	43.6	4.0e-50
>prophage 379
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6301018	6304038	7432530		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
AYQ35283.1|6301018_6302974_+	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	36.5	2.0e-71
AYQ35284.1|6302976_6304038_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1M7XU65	Cedratvirus	25.3	9.4e-15
>prophage 380
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6307238	6308279	7432530	tRNA	Orpheovirus(100.0%)	1	NA	NA
AYQ35287.1|6307238_6308279_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	31.0	2.1e-19
>prophage 381
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6316214	6316994	7432530		Sulfolobus_monocaudavirus(100.0%)	1	NA	NA
AYQ35293.1|6316214_6316994_+	polyprenol monophosphomannose synthase	NA	A0A0N7A8R9	Sulfolobus_monocaudavirus	39.0	1.3e-26
>prophage 382
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6325667	6327020	7432530		Lake_Baikal_phage(50.0%)	3	NA	NA
AYQ35299.1|6325667_6325871_-	cold shock domain-containing protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	39.1	4.4e-06
AYQ35300.1|6326172_6326394_+	PspC domain-containing protein	NA	NA	NA	NA	NA
AYQ35301.1|6326402_6327020_-	uridine kinase	NA	A0A1V0SD85	Indivirus	29.4	6.2e-19
>prophage 383
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6371107	6372223	7432530		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AYQ35336.1|6371107_6372223_-	GDP-mannose 4,6-dehydratase	NA	M1HAR7	Acanthocystis_turfacea_Chlorella_virus	63.3	3.5e-129
>prophage 384
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6381190	6383674	7432530		Microcystis_phage(100.0%)	3	NA	NA
AYQ35343.1|6381190_6381922_+	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	38.8	4.6e-29
AYQ35344.1|6382072_6382774_+	formylglycine-generating enzyme family protein	NA	A0A075BUR2	Microcystis_phage	40.9	1.0e-25
AYQ35345.1|6382918_6383674_+	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	36.2	9.0e-28
>prophage 385
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6398644	6401643	7432530	transposase	Cafeteria_roenbergensis_virus(50.0%)	3	NA	NA
AYQ35358.1|6398644_6399220_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	43.1	4.3e-30
AYQ35359.1|6400073_6400262_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ35360.1|6400431_6401643_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	62.6	1.2e-61
>prophage 386
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6407803	6409090	7432530		Heliothis_zea_nudivirus(100.0%)	1	NA	NA
AYQ35364.1|6407803_6409090_+	serine hydroxymethyltransferase	NA	Q8JKP0	Heliothis_zea_nudivirus	46.2	8.8e-92
>prophage 387
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6455546	6456026	7432530		Staphylococcus_phage(100.0%)	1	NA	NA
AYQ35394.1|6455546_6456026_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	38.2	2.8e-19
>prophage 388
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6461088	6463331	7432530		Acanthamoeba_polyphaga_mimivirus(50.0%)	2	NA	NA
AYQ35403.1|6461088_6461904_-	DNA-formamidopyrimidine glycosylase	NA	A0A0G2Y3N6	Acanthamoeba_polyphaga_mimivirus	29.2	2.7e-09
AYQ35404.1|6462065_6463331_+	ATP-dependent helicase	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.8	4.8e-50
>prophage 389
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6470310	6474968	7432530	transposase	Planktothrix_phage(50.0%)	4	NA	NA
AYQ35412.1|6470310_6470976_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.7	4.5e-39
AYQ35413.1|6471068_6472526_-	TolC family protein	NA	NA	NA	NA	NA
AYQ35414.1|6472533_6473784_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYQ35415.1|6473936_6474968_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	29.8	3.7e-24
>prophage 390
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6498898	6500332	7432530		Oenococcus_phage(100.0%)	1	NA	NA
AYQ35437.1|6498898_6500332_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	27.5	7.0e-29
>prophage 391
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6505076	6506396	7432530		Mycobacterium_phage(100.0%)	1	NA	NA
AYQ35443.1|6505076_6506396_+	class A beta-lactamase-related serine hydrolase	NA	G8IDB2	Mycobacterium_phage	24.9	1.5e-06
>prophage 392
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6514293	6516387	7432530		Klosneuvirus(100.0%)	1	NA	NA
AYQ35453.1|6514293_6516387_+	S9 family peptidase	NA	A0A1V0SHT0	Klosneuvirus	31.1	1.5e-51
>prophage 393
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6525898	6526660	7432530		Streptomyces_phage(100.0%)	1	NA	NA
AYQ35464.1|6525898_6526660_+	NUDIX domain-containing protein	NA	A0A0E3JJF3	Streptomyces_phage	33.6	1.2e-06
>prophage 394
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6531284	6538228	7432530		Rhizobium_phage(25.0%)	6	NA	NA
AYQ35470.1|6531284_6532409_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	25.8	2.7e-28
AYQ35471.1|6532460_6533546_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	52.0	4.2e-95
AYQ35472.1|6533545_6534955_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ36492.1|6535084_6535285_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ35473.1|6535323_6537432_-	M3 family peptidase	NA	A0A1V0SD92	Indivirus	24.4	9.2e-46
AYQ35474.1|6537526_6538228_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.6	8.3e-36
>prophage 395
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6553675	6558973	7432530		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	5	NA	NA
AYQ35489.1|6553675_6555052_-	ATP-dependent helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.7	1.0e-53
AYQ35490.1|6555151_6555838_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AYQ35491.1|6555919_6556780_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ35492.1|6556891_6557884_-	cytochrome C	NA	NA	NA	NA	NA
AYQ35493.1|6558031_6558973_-	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	59.2	9.3e-107
>prophage 396
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6566481	6573718	7432530		Organic_Lake_phycodnavirus(33.33%)	5	NA	NA
AYQ35498.1|6566481_6568533_+	S9 family peptidase	NA	F2Y2Z7	Organic_Lake_phycodnavirus	33.6	1.9e-27
AYQ35499.1|6568544_6568745_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ35500.1|6568887_6569118_-	DUF433 domain-containing protein	NA	NA	NA	NA	NA
AYQ35501.1|6569152_6571300_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	39.6	4.8e-90
AYQ35502.1|6571492_6573718_+	DNA repair helicase	NA	A0A0M7RF77	Lactobacillus_phage	23.7	4.0e-07
>prophage 397
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6578797	6579904	7432530		uncultured_marine_virus(100.0%)	1	NA	NA
AYQ35509.1|6578797_6579904_-	phosphoadenosine phosphosulfate reductase	NA	A0A0F7L647	uncultured_marine_virus	30.3	7.5e-15
>prophage 398
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6617309	6622964	7432530		Synechococcus_phage(25.0%)	4	NA	NA
AYQ35527.1|6617309_6617966_+	fructose-6-phosphate aldolase	NA	A0A1Z1LWE4	Synechococcus_phage	47.3	3.2e-45
AYQ35528.1|6618054_6618741_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.9	3.1e-27
AYQ35529.1|6619073_6620807_+	RNA helicase	NA	A0A1V0SBR7	Catovirus	35.3	5.4e-60
AYQ35530.1|6621113_6622964_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	40.6	1.1e-47
>prophage 399
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6633219	6645630	7432530	tRNA	Enterobacteria_phage(25.0%)	14	NA	NA
AYQ35539.1|6633219_6634248_+	GHKL domain-containing protein	NA	Q9EYF3	Enterobacteria_phage	29.4	2.7e-11
AYQ35540.1|6634307_6634814_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ35541.1|6635042_6635246_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ35542.1|6635304_6635733_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ35543.1|6635733_6636411_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYQ35544.1|6636413_6636740_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ35545.1|6636723_6636966_-	DUF433 domain-containing protein	NA	NA	NA	NA	NA
AYQ35546.1|6637017_6638325_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	36.4	8.7e-79
AYQ35547.1|6638395_6639391_-	ChbG/HpnK family deacetylase	NA	NA	NA	NA	NA
AYQ35548.1|6639491_6640652_+	class C beta-lactamase-related serine hydrolase	NA	NA	NA	NA	NA
AYQ35549.1|6640760_6641687_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	1.2e-21
AYQ35550.1|6641701_6643045_+	ABC transporter permease	NA	NA	NA	NA	NA
AYQ35551.1|6643111_6644281_+	signal peptidase I	NA	NA	NA	NA	NA
AYQ35552.1|6644358_6645630_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	39.6	6.8e-60
>prophage 400
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6685403	6685991	7432530		Cassava_brown_streak_virus(100.0%)	1	NA	NA
AYQ35579.1|6685403_6685991_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	A0A1K0ISQ7	Cassava_brown_streak_virus	32.5	8.0e-16
>prophage 401
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6689177	6689597	7432530		Mollivirus(100.0%)	1	NA	NA
AYQ35582.1|6689177_6689597_+	nucleoside-diphosphate kinase	NA	A0A0M5KH58	Mollivirus	39.4	2.8e-10
>prophage 402
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6741758	6742964	7432530		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
AYQ35604.1|6741758_6742964_-	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	29.8	9.0e-38
>prophage 403
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6753296	6756725	7432530		Norovirus(100.0%)	1	NA	NA
AYQ35617.1|6753296_6756725_+	SusC/RagA family TonB-linked outer membrane protein	NA	Q2PGD7	Norovirus	30.4	2.0e-05
>prophage 404
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6777464	6778126	7432530		Stx2-converting_phage(50.0%)	2	NA	NA
AYQ35632.1|6777464_6777779_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	36.3	1.9e-11
AYQ35633.1|6777766_6778126_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	43.1	4.7e-19
>prophage 405
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6801811	6802675	7432530		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AYQ35662.1|6801811_6802675_-	alpha/beta fold hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	27.6	1.4e-08
>prophage 406
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6805826	6807125	7432530		Mycobacterium_phage(100.0%)	1	NA	NA
AYQ35668.1|6805826_6807125_-	class A beta-lactamase-related serine hydrolase	NA	S5Z991	Mycobacterium_phage	25.6	3.5e-11
>prophage 407
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6812856	6814509	7432530		Moraxella_phage(100.0%)	1	NA	NA
AYQ36504.1|6812856_6814509_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.0	3.3e-22
>prophage 408
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6838791	6839820	7432530		Bacillus_phage(100.0%)	1	NA	NA
AYQ35690.1|6838791_6839820_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	29.8	2.7e-06
>prophage 409
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6848872	6849976	7432530		Enterobacteria_phage(100.0%)	1	NA	NA
AYQ36506.1|6848872_6849976_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.4	8.9e-16
>prophage 410
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6880011	6885476	7432530		Catovirus(50.0%)	5	NA	NA
AYQ35720.1|6880011_6880782_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	37.0	3.5e-11
AYQ35721.1|6880825_6881401_-	colanic acid biosynthesis acetyltransferase WcaF	NA	NA	NA	NA	NA
AYQ35722.1|6881342_6882281_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AYQ35723.1|6882376_6883600_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AYQ35724.1|6883706_6885476_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.3	1.7e-16
>prophage 411
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6892368	6896214	7432530	protease,tail	Moraxella_phage(100.0%)	3	NA	NA
AYQ36508.1|6892368_6894462_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	32.1	2.6e-77
AYQ35731.1|6894465_6894771_+	(2Fe-2S) ferredoxin domain-containing protein	NA	NA	NA	NA	NA
AYQ35732.1|6894882_6896214_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.2	1.4e-52
>prophage 412
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6902348	6904172	7432530		Bacillus_phage(100.0%)	1	NA	NA
AYQ35738.1|6902348_6904172_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.1	8.8e-61
>prophage 413
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6927717	6939499	7432530		Bacillus_phage(40.0%)	9	NA	NA
AYQ35759.1|6927717_6929277_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.1	5.2e-38
AYQ35760.1|6929305_6929524_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ35761.1|6929611_6929821_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ35762.1|6929813_6932513_+	histidine kinase	NA	W8CYF6	Bacillus_phage	36.3	4.4e-32
AYQ36511.1|6932527_6932908_+	response regulator	NA	W8CYM9	Bacillus_phage	36.4	1.7e-14
AYQ35763.1|6933205_6935137_+	propionyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	32.4	4.6e-60
AYQ35764.1|6935265_6936234_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ35765.1|6936353_6937310_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ36512.1|6937609_6939499_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	35.1	2.3e-72
>prophage 414
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6959381	6959729	7432530		Stx2-converting_phage(100.0%)	1	NA	NA
AYQ35778.1|6959381_6959729_+	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	41.6	3.9e-18
>prophage 415
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	6994280	6997180	7432530		Acanthocystis_turfacea_Chlorella_virus(50.0%)	4	NA	NA
AYQ35796.1|6994280_6994745_-	RidA family protein	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	42.1	1.4e-23
AYQ35797.1|6994780_6995572_-	acetylglutamate kinase	NA	NA	NA	NA	NA
AYQ35798.1|6995650_6996346_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AYQ35799.1|6996451_6997180_-	serine/threonine protein phosphatase	NA	S0A0Y6	Cellulophaga_phage	35.3	4.0e-41
>prophage 416
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	7008209	7009070	7432530		Nonlabens_phage(100.0%)	1	NA	NA
AYQ35811.1|7008209_7009070_+	VirE protein	NA	I6R9Q6	Nonlabens_phage	32.4	5.8e-15
>prophage 417
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	7012187	7017646	7432530	tRNA	uncultured_Mediterranean_phage(33.33%)	4	NA	NA
AYQ36514.1|7012187_7013321_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	41.6	2.9e-78
AYQ35814.1|7013492_7015004_+	OmpA family protein	NA	NA	NA	NA	NA
AYQ35815.1|7015114_7016404_+	nucleotide sugar dehydrogenase	NA	A0A218MKK1	uncultured_virus	25.8	7.2e-09
AYQ35816.1|7016545_7017646_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	67.0	7.7e-145
>prophage 418
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	7028340	7029087	7432530		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AYQ35825.1|7028340_7029087_-	ribonuclease III	NA	M1HVW9	Paramecium_bursaria_Chlorella_virus	34.8	3.4e-27
>prophage 419
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	7033059	7033833	7432530		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AYQ35831.1|7033059_7033833_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	36.1	6.8e-23
>prophage 420
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	7047596	7048697	7432530		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
AYQ36518.1|7047596_7048697_+	slipin family protein	NA	A0A0G2YDT0	Acanthamoeba_polyphaga_mimivirus	24.0	1.6e-12
>prophage 421
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	7075438	7076086	7432530		Planktothrix_phage(100.0%)	1	NA	NA
AYQ35866.1|7075438_7076086_-	N-acetyltransferase	NA	G9BWD5	Planktothrix_phage	29.7	4.0e-08
>prophage 422
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	7092727	7094500	7432530		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
AYQ35883.1|7092727_7094500_-	biosynthetic-type acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	28.3	1.7e-56
>prophage 423
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	7107573	7112285	7432530		Pandoravirus(33.33%)	5	NA	NA
AYQ35892.1|7107573_7108608_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	31.3	2.0e-09
AYQ35893.1|7108636_7109728_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ35894.1|7109730_7110438_+	glycosyltransferase	NA	NA	NA	NA	NA
AYQ36524.1|7110572_7111580_+	CBS domain-containing protein	NA	A0A1D8KTE2	Synechococcus_phage	30.3	8.1e-24
AYQ36525.1|7111703_7112285_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A142F2D5	Mycobacterium_phage	35.7	6.3e-13
>prophage 424
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	7116424	7118581	7432530		Orpheovirus(50.0%)	2	NA	NA
AYQ35897.1|7116424_7117366_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	49.2	2.8e-79
AYQ35898.1|7117465_7118581_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A7K9	Microcystis_virus	41.2	1.7e-19
>prophage 425
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	7143573	7147278	7432530		Streptomyces_phage(100.0%)	1	NA	NA
AYQ35907.1|7143573_7147278_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	35.1	9.4e-195
>prophage 426
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	7183562	7184321	7432530		Bacillus_phage(100.0%)	1	NA	NA
AYQ35931.1|7183562_7184321_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.3	2.6e-06
>prophage 427
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	7202314	7206523	7432530		Indivirus(50.0%)	3	NA	NA
AYQ35945.1|7202314_7204549_+	peptidase domain-containing ABC transporter	NA	A0A1V0SD74	Indivirus	20.6	2.8e-08
AYQ35946.1|7204702_7205977_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYQ35947.1|7206058_7206523_+	hypothetical protein	NA	A0A218MM90	uncultured_virus	38.7	1.4e-18
>prophage 428
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	7212293	7214322	7432530		Bathycoccus_sp._RCC1105_virus(50.0%)	2	NA	NA
AYQ35953.1|7212293_7213421_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	29.6	1.6e-41
AYQ35954.1|7213389_7214322_+	glycosyltransferase	NA	A0A192Y8W7	Salmonella_phage	30.1	9.8e-24
>prophage 429
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	7224650	7231662	7432530		Tupanvirus(50.0%)	6	NA	NA
AYQ36534.1|7224650_7226525_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	32.6	1.6e-57
AYQ35962.1|7226623_7226845_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ35963.1|7226857_7227283_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ35964.1|7227482_7228196_+	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
AYQ35965.1|7228211_7228928_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYQ36535.1|7229001_7231662_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	30.2	9.9e-13
>prophage 430
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	7241908	7243060	7432530		Catovirus(100.0%)	1	NA	NA
AYQ35978.1|7241908_7243060_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	63.0	7.6e-18
>prophage 431
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	7268447	7270160	7432530		Staphylococcus_phage(100.0%)	1	NA	NA
AYQ35993.1|7268447_7270160_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.2	1.2e-35
>prophage 432
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	7285559	7286306	7432530		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AYQ36010.1|7285559_7286306_-	short chain dehydrogenase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	32.4	1.9e-22
>prophage 433
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	7296805	7297600	7432530		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AYQ36021.1|7296805_7297600_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.5	3.4e-17
>prophage 434
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	7318427	7319417	7432530		Bacillus_virus(100.0%)	1	NA	NA
AYQ36037.1|7318427_7319417_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.6	2.2e-21
>prophage 435
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	7336155	7338132	7432530		Bathycoccus_sp._RCC1105_virus(100.0%)	1	NA	NA
AYQ36052.1|7336155_7338132_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	43.2	8.5e-110
>prophage 436
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	7347634	7355541	7432530	holin	Catovirus(50.0%)	8	NA	NA
AYQ36061.1|7347634_7348969_+	ATP-dependent helicase	NA	A0A1V0SBR7	Catovirus	34.5	3.0e-50
AYQ36062.1|7349163_7349868_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	1.2e-13
AYQ36063.1|7349870_7350674_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ36064.1|7350705_7351524_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ36065.1|7351529_7351892_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYQ36066.1|7351878_7352538_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ36067.1|7352579_7354193_+|holin	choline dehydrogenase	holin	A0A1V0S9J5	Catovirus	36.0	8.0e-74
AYQ36068.1|7354383_7355541_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	25.8	2.5e-08
>prophage 437
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	7377333	7379442	7432530		Streptococcus_phage(100.0%)	1	NA	NA
AYQ36086.1|7377333_7379442_+	elongation factor G	NA	A0A1S5SF82	Streptococcus_phage	25.6	2.4e-54
>prophage 438
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	7410322	7411813	7432530		Norovirus(100.0%)	1	NA	NA
AYQ36107.1|7410322_7411813_+	SusC/RagA family TonB-linked outer membrane protein	NA	Q2PGD7	Norovirus	30.4	5.8e-10
>prophage 439
CP031030	Runella sp. SP2 chromosome, complete genome	7432530	7415111	7428630	7432530		Tetraselmis_virus(25.0%)	8	NA	NA
AYQ36110.1|7415111_7416584_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	33.1	9.6e-50
AYQ36550.1|7416816_7418484_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
AYQ36111.1|7418493_7419756_+	Hsp70 family protein	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	22.8	3.7e-10
AYQ36112.1|7419818_7421111_-	TolC family protein	NA	NA	NA	NA	NA
AYQ36113.1|7421178_7424280_-	AcrB/AcrD/AcrF family protein	NA	S5VTK5	Leptospira_phage	24.7	1.1e-84
AYQ36114.1|7424276_7425350_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYQ36115.1|7425628_7426387_-	response regulator	NA	NA	NA	NA	NA
AYQ36116.1|7426413_7428630_-	hypothetical protein	NA	Q9EYF3	Enterobacteria_phage	33.6	6.3e-29
