The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024943	Burkholderia lata strain A05 chromosome 1, complete sequence	3927314	422413	473008	3927314	plate,protease,integrase,head,transposase,tail	Pseudomonas_phage(19.44%)	62	422984:423029	436295:436340
AYQ37030.1|422413_422935_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.0	9.6e-21
422984:423029	attL	ATTTGTAATCATCAGGTGGCGGGTTCGAGTCCTGCAGCCGGCACCA	NA	NA	NA	NA
AYQ39996.1|423126_424170_+|integrase	integrase	integrase	A0A1L7DQ84	Ralstonia_phage	36.0	9.8e-49
AYQ37031.1|424473_424686_+	plasmid-related protein	NA	NA	NA	NA	NA
AYQ37032.1|424689_425421_+	DNA-binding protein	NA	NA	NA	NA	NA
AYQ37033.1|425727_425967_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ37034.1|425977_427123_+	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
AYQ37035.1|427119_427575_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ37036.1|427917_428619_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ37037.1|428827_429358_+	hypothetical protein	NA	A4JWV5	Burkholderia_virus	64.6	1.2e-58
AYQ37038.1|429354_430086_+	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	65.7	8.9e-81
AYQ37039.1|430091_431216_+	hypothetical protein	NA	A4JWV3	Burkholderia_virus	70.3	1.4e-154
AYQ37040.1|432320_433937_+	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	22.9	3.4e-24
AYQ37041.1|434050_434935_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ37042.1|434998_435949_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ37043.1|436546_436867_-	hypothetical protein	NA	NA	NA	NA	NA
436295:436340	attR	ATTTGTAATCATCAGGTGGCGGGTTCGAGTCCTGCAGCCGGCACCA	NA	NA	NA	NA
AYQ37044.1|436933_437656_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ37045.1|437662_438628_-	hypothetical protein	NA	B5TAB1	Burkholderia_phage	36.5	1.2e-24
AYQ37046.1|438662_439454_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ37047.1|439465_441838_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	37.8	1.0e-72
AYQ37048.1|441908_442505_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYQ37049.1|442501_443566_-|tail	phage tail protein	tail	F6MIL6	Haemophilus_phage	37.3	2.6e-57
AYQ37050.1|443565_443916_-	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	62.6	1.8e-31
AYQ37051.1|443974_444574_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	46.1	6.2e-40
AYQ37052.1|444570_445698_-|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	41.3	2.0e-76
AYQ37053.1|445681_446968_-	multidrug DMT transporter permease	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	31.9	3.3e-46
AYQ37054.1|446969_449216_-|tail	tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	40.9	2.5e-73
AYQ37055.1|449377_449749_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ37056.1|449745_450123_-|tail	phage tail protein	tail	A0A2H4J9F8	uncultured_Caudovirales_phage	45.0	2.0e-20
AYQ37057.1|450155_451577_-|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	44.8	5.4e-90
AYQ37058.1|451579_451825_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ37059.1|451827_452520_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ37060.1|452519_452945_-	DUF1320 domain-containing protein	NA	A0A1B1P724	Rhodovulum_phage	32.1	4.8e-10
AYQ37061.1|452948_453452_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ37062.1|453636_454554_-|head	head protein	head	A0A2H4J778	uncultured_Caudovirales_phage	67.2	7.4e-117
AYQ37063.1|454565_454970_-	hypothetical protein	NA	A0A0U5KRP3	unidentified_phage	62.7	6.1e-39
AYQ37064.1|454966_456064_-	hypothetical protein	NA	A0A2D1GNS3	Pseudomonas_phage	45.4	1.7e-72
AYQ39997.1|456263_456848_-	virion morphogenesis protein	NA	Q5ZQY1	Pseudomonas_phage	30.6	4.2e-09
AYQ37065.1|456860_458174_-|head	phage head morphogenesis protein	head	Q6QIB9	Burkholderia_phage	47.9	3.0e-63
AYQ37066.1|458163_459783_-	hypothetical protein	NA	A0A076FX05	Pseudomonas_phage	48.8	1.4e-147
AYQ37067.1|459791_461567_-	hypothetical protein	NA	A0A0M4U7A1	Ralstonia_phage	69.4	3.9e-247
AYQ37068.1|461566_461794_-	hypothetical protein	NA	A0A1S6UB66	Serratia_phage	54.1	2.1e-17
AYQ37069.1|461805_462303_-	DNA-binding protein	NA	A0A0A1IX73	Pseudomonas_phage	66.3	3.7e-54
AYQ37070.1|462308_462515_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ37071.1|462511_462814_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ37072.1|462804_463038_-	conjugal transfer protein TraR	NA	A0A0M4UVB2	Ralstonia_phage	45.3	2.3e-06
AYQ37073.1|463038_463656_-	hypothetical protein	NA	A4JWP5	Burkholderia_virus	30.7	3.6e-06
AYQ37074.1|463645_463888_-	hypothetical protein	NA	A0A0M4UKB4	Ralstonia_phage	41.7	2.5e-08
AYQ37075.1|463900_464437_-	glycoside hydrolase	NA	Q6J1Q5	Burkholderia_virus	51.4	3.1e-38
AYQ37076.1|464548_464992_-	DNA transposition protein	NA	NA	NA	NA	NA
AYQ37077.1|464988_465402_-	regulatory protein GemA	NA	H1ZZD1	Pseudomonas_virus	46.6	3.3e-24
AYQ37078.1|465468_465927_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ37079.1|465936_466269_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ37080.1|466282_466900_-	sulfate transporter	NA	Q5ZR10	Pseudomonas_phage	54.8	6.6e-61
AYQ37081.1|466892_467477_-	hypothetical protein	NA	B5TA84	Burkholderia_phage	48.5	1.4e-28
AYQ37082.1|467518_468136_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ37083.1|468132_468561_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ39998.1|468639_468894_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ37084.1|468950_469283_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ37085.1|469269_469896_-	hypothetical protein	NA	A0A0M3VI82	Ralstonia_phage	51.0	4.9e-19
AYQ37086.1|469888_470122_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ37087.1|470132_470879_-	ATP-binding protein	NA	A0A0U5DWK7	unidentified_phage	66.7	7.9e-85
AYQ37088.1|470896_473008_-|transposase	transposase	transposase	I6P9C2	Pseudomonas_phage	50.4	2.1e-183
>prophage 2
CP024943	Burkholderia lata strain A05 chromosome 1, complete sequence	3927314	822607	835688	3927314		Hokovirus(12.5%)	11	NA	NA
AYQ37390.1|822607_824560_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.6	2.7e-148
AYQ37391.1|824826_825963_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	39.1	7.0e-24
AYQ37392.1|825976_827911_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	35.7	1.6e-52
AYQ37393.1|828031_828847_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	32.9	1.1e-36
AYQ37394.1|828892_829579_-	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	25.9	2.7e-07
AYQ37395.1|829575_830118_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AYQ37396.1|830153_831692_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.0	8.0e-23
AYQ37397.1|831697_832375_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
AYQ37398.1|832386_833172_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
AYQ37399.1|833371_834427_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	45.9	1.7e-72
AYQ37400.1|834488_835688_-	tetracycline resistance MFS efflux pump	NA	A0A2H4UVM2	Bodo_saltans_virus	24.3	5.3e-06
>prophage 3
CP024943	Burkholderia lata strain A05 chromosome 1, complete sequence	3927314	1186425	1194714	3927314		Bacillus_phage(16.67%)	8	NA	NA
AYQ37695.1|1186425_1187826_+	UDP-glucose 6-dehydrogenase	NA	A0A127AXI2	Bacillus_phage	38.8	3.6e-78
AYQ37696.1|1187833_1188784_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.2	1.0e-15
AYQ37697.1|1188847_1189840_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	31.2	5.9e-27
AYQ37698.1|1189913_1190258_+	competence protein ComE	NA	NA	NA	NA	NA
AYQ37699.1|1190475_1191378_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.2	2.3e-54
AYQ37700.1|1191457_1192801_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
AYQ37701.1|1192844_1193768_+	deacetylase	NA	A0A2K9KZC4	Tupanvirus	34.9	5.1e-41
AYQ37702.1|1193793_1194714_-	lysophospholipase	NA	Q6TUZ7	Yaba_monkey_tumor_virus	27.6	2.3e-17
>prophage 4
CP024943	Burkholderia lata strain A05 chromosome 1, complete sequence	3927314	1922796	1931775	3927314		Pseudomonas_phage(33.33%)	12	NA	NA
AYQ38296.1|1922796_1923207_-	hypothetical protein	NA	A0A2H4IB20	Erwinia_phage	39.7	3.1e-14
AYQ38297.1|1923203_1923962_-	hypothetical protein	NA	Q6JII5	Burkholderia_virus	50.0	2.2e-29
AYQ38298.1|1923961_1924354_-	hypothetical protein	NA	Q8W6R0	Burkholderia_virus	67.9	7.7e-47
AYQ38299.1|1924364_1925360_-	reverse transcriptase	NA	H7BVN7	unidentified_phage	35.7	3.9e-39
AYQ38300.1|1925703_1926060_-	four helix bundle protein	NA	NA	NA	NA	NA
AYQ38301.1|1926074_1926539_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ38302.1|1926569_1926932_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
AYQ38303.1|1927021_1927645_-	1-pyrroline-5-carboxylate dehydrogenase	NA	A9YX18	Burkholderia_phage	90.6	2.4e-18
AYQ38304.1|1927641_1929408_-	DNA repair protein	NA	J7HXJ7	Pseudomonas_phage	34.4	4.1e-71
AYQ38305.1|1929420_1930608_-	hypothetical protein	NA	J7HXB6	Pseudomonas_phage	51.7	8.5e-65
AYQ38306.1|1930622_1931432_-	hypothetical protein	NA	J7HXJ4	Pseudomonas_phage	60.5	2.3e-90
AYQ40089.1|1931592_1931775_-	hypothetical protein	NA	A9YWW6	Burkholderia_phage	66.7	8.8e-06
>prophage 5
CP024943	Burkholderia lata strain A05 chromosome 1, complete sequence	3927314	1935887	1964094	3927314	head	Burkholderia_phage(57.14%)	35	NA	NA
AYQ40091.1|1935887_1936937_+	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	59.0	5.8e-33
AYQ38316.1|1936933_1937407_+	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	77.3	5.4e-63
AYQ40092.1|1937453_1937747_+	hypothetical protein	NA	A9YWZ0	Burkholderia_phage	60.2	6.4e-22
AYQ38317.1|1937743_1938175_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ38318.1|1938299_1938500_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ38319.1|1938513_1939014_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ38320.1|1939075_1939759_+	hypothetical protein	NA	A9YWZ4	Burkholderia_phage	84.9	6.3e-105
AYQ38321.1|1939776_1940256_+	hypothetical protein	NA	A9YWZ5	Burkholderia_phage	88.7	4.9e-72
AYQ38322.1|1940257_1941856_+	TerL protein	NA	A9YWZ6	Burkholderia_phage	88.8	3.1e-288
AYQ38323.1|1941852_1943433_+	hypothetical protein	NA	A0A0P0I486	Acinetobacter_phage	60.7	1.2e-151
AYQ38324.1|1943362_1944016_+|head	phage head morphogenesis protein	head	A9YWZ8	Burkholderia_phage	67.8	1.9e-74
AYQ38325.1|1944017_1945325_+	hypothetical protein	NA	A0A0P0IRE1	Acinetobacter_phage	49.3	7.9e-80
AYQ38326.1|1945338_1945827_+	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	54.3	6.9e-37
AYQ38327.1|1945837_1946875_+	hypothetical protein	NA	A0A0N7IRF2	Acinetobacter_phage	66.5	2.2e-125
AYQ38328.1|1946884_1947325_+	hypothetical protein	NA	A0A2H4J9M7	uncultured_Caudovirales_phage	40.5	1.6e-05
AYQ38329.1|1947380_1947764_+	DUF4054 domain-containing protein	NA	A9YX25	Burkholderia_phage	75.6	9.1e-53
AYQ38330.1|1947792_1948275_+	hypothetical protein	NA	A9YX26	Burkholderia_phage	85.5	2.1e-70
AYQ38331.1|1948278_1948650_+	hypothetical protein	NA	A9YX28	Burkholderia_phage	91.1	2.6e-60
AYQ38332.1|1948654_1949245_+	hypothetical protein	NA	A9YX29	Burkholderia_phage	77.9	9.0e-84
AYQ38333.1|1949254_1951066_+	exotoxin	NA	A0A0P0I492	Acinetobacter_phage	37.3	1.3e-88
AYQ38334.1|1951082_1951523_+	DUF3277 domain-containing protein	NA	A0A0P0IKY2	Acinetobacter_phage	58.2	1.9e-41
AYQ38335.1|1951525_1952056_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	39.9	1.5e-21
AYQ38336.1|1952230_1954054_+	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A0M4REK7	Salmonella_phage	41.4	5.5e-39
AYQ38337.1|1954050_1954650_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	40.1	9.0e-23
AYQ38338.1|1954649_1954964_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ38339.1|1954960_1955953_+	hypothetical protein	NA	A9YX04	Burkholderia_phage	64.4	2.3e-103
AYQ38340.1|1956407_1957199_+	hypothetical protein	NA	A9YX06	Burkholderia_phage	64.3	4.8e-88
AYQ38341.1|1957206_1957557_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	71.8	5.8e-38
AYQ38342.1|1957553_1958741_+	hypothetical protein	NA	A9YX12	Burkholderia_phage	69.4	8.9e-147
AYQ38343.1|1958742_1959459_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	62.0	4.2e-75
AYQ38344.1|1959515_1960514_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	42.6	8.0e-32
AYQ38345.1|1960529_1961108_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ40093.1|1961125_1962682_+	pectate lyase	NA	NA	NA	NA	NA
AYQ38346.1|1962685_1963078_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ38347.1|1963389_1964094_+	lysozyme	NA	A0A059VA40	Pseudomonas_phage	42.8	3.8e-28
>prophage 1
CP024944	Burkholderia lata strain A05 chromosome 2, complete sequence	3706323	39746	76868	3706323	plate,tail,head,transposase,capsid	Burkholderia_phage(97.83%)	48	NA	NA
AYQ43238.1|39746_40457_-	hypothetical protein	NA	B5TAB3	Burkholderia_phage	99.6	1.1e-131
AYQ40280.1|40530_42759_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	100.0	0.0e+00
AYQ40281.1|42766_43744_-	hypothetical protein	NA	B5TAB1	Burkholderia_phage	99.7	1.8e-185
AYQ40282.1|43743_44343_-	DUF2313 domain-containing protein	NA	B5TAB0	Burkholderia_phage	100.0	9.7e-110
AYQ40283.1|44345_45467_-|plate	baseplate J protein	plate	B5TAA9	Burkholderia_phage	100.0	5.2e-205
AYQ40284.1|45463_46045_-|tail	phage tail protein	tail	B5TAA8	Burkholderia_phage	100.0	1.9e-110
AYQ40285.1|46129_46651_-|plate	baseplate assembly protein	plate	B5TAA7	Burkholderia_phage	100.0	5.0e-94
AYQ40286.1|46650_47808_-	hypothetical protein	NA	B5TAA6	Burkholderia_phage	100.0	6.7e-224
AYQ40287.1|47813_49184_-	multidrug DMT transporter	NA	B5TAA5	Burkholderia_phage	100.0	4.9e-258
AYQ40288.1|49183_51619_-|tail	phage tail protein	tail	B5TAA4	Burkholderia_phage	86.8	1.0e-277
AYQ40289.1|51667_52222_-	hypothetical protein	NA	B5TAA3	Burkholderia_phage	100.0	8.2e-95
AYQ40290.1|52304_52676_-	hypothetical protein	NA	B5TAA2	Burkholderia_phage	100.0	3.1e-66
AYQ40291.1|52721_54200_-|tail	phage tail protein	tail	B5TAA1	Burkholderia_phage	98.8	3.7e-267
AYQ40292.1|54243_54522_-	hypothetical protein	NA	B5TAA0	Burkholderia_phage	100.0	4.3e-44
AYQ40293.1|54505_55108_-	DUF1834 domain-containing protein	NA	B5TA99	Burkholderia_phage	100.0	3.6e-112
AYQ40294.1|55107_55539_-	virion morphogenesis protein	NA	B5TA98	Burkholderia_phage	100.0	1.3e-76
AYQ40295.1|55535_56039_-	DUF1320 domain-containing protein	NA	B5TA97	Burkholderia_phage	100.0	2.4e-93
AYQ43239.1|56035_56425_-	hypothetical protein	NA	B5TA96	Burkholderia_phage	100.0	4.6e-28
AYQ40296.1|56499_57447_-|capsid	phage capsid protein	capsid	B5TA95	Burkholderia_phage	100.0	2.5e-176
AYQ40297.1|57497_57854_-	hypothetical protein	NA	B5TA94	Burkholderia_phage	97.5	1.7e-53
AYQ40298.1|57899_59045_-	hypothetical protein	NA	B5TA92	Burkholderia_phage	96.9	1.9e-210
AYQ40299.1|59258_59657_-	hypothetical protein	NA	B5TA91	Burkholderia_phage	100.0	1.1e-69
AYQ40300.1|59653_60094_-	regulatory protein GemA	NA	B5TA90	Burkholderia_phage	97.9	8.3e-74
AYQ40301.1|60095_60419_-	hypothetical protein	NA	B5TA89	Burkholderia_phage	95.2	1.9e-51
AYQ40302.1|61306_61588_-	host nuclease inhibitor protein	NA	A0A0U5KSG7	unidentified_phage	46.4	7.2e-15
AYQ40303.1|61661_61934_-	DNA-binding protein HU	NA	B5TA87	Burkholderia_phage	97.8	2.0e-38
AYQ40304.1|61996_62389_-	hypothetical protein	NA	B5TA86	Burkholderia_phage	100.0	2.4e-72
AYQ40305.1|62399_63026_-	sulfate transporter	NA	B5TA85	Burkholderia_phage	99.5	3.2e-111
AYQ40306.1|63022_63610_-	hypothetical protein	NA	B5TA84	Burkholderia_phage	98.8	1.4e-89
AYQ40307.1|63596_63902_-	hypothetical protein	NA	B5TA83	Burkholderia_phage	98.0	5.6e-45
AYQ40308.1|63898_64087_-	hypothetical protein	NA	B5TA82	Burkholderia_phage	100.0	7.2e-27
AYQ40309.1|64094_65087_-	DNA transposition protein	NA	B5TA81	Burkholderia_phage	100.0	5.3e-185
AYQ40310.1|65096_66722_-|transposase	transposase	transposase	B5TA80	Burkholderia_phage	99.8	0.0e+00
AYQ40311.1|66762_67809_-	hypothetical protein	NA	B5TA79	Burkholderia_phage	82.3	6.4e-149
AYQ43240.1|67805_67997_-	hypothetical protein	NA	B5TA78	Burkholderia_phage	95.2	1.5e-27
AYQ40312.1|68061_68562_+	XRE family transcriptional regulator	NA	K4NXA8	Burkholderia_phage	43.7	7.8e-12
AYQ43241.1|68605_69145_+	hypothetical protein	NA	B5TA76	Burkholderia_phage	67.0	5.8e-61
AYQ40313.1|69152_69482_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ43242.1|69621_69939_+	hypothetical protein	NA	B5TA74	Burkholderia_phage	75.8	9.6e-40
AYQ40314.1|69935_70607_+	lytic transglycosylase	NA	B5TA73	Burkholderia_phage	97.3	2.1e-108
AYQ40315.1|70603_71065_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ40316.1|71169_71394_+	hypothetical protein	NA	B5TA71	Burkholderia_phage	100.0	4.5e-36
AYQ40317.1|71390_71681_+	hypothetical protein	NA	B5TA70	Burkholderia_phage	100.0	2.8e-46
AYQ40318.1|71684_72182_+	DNA-binding protein	NA	B5TA69	Burkholderia_phage	99.4	4.8e-86
AYQ40319.1|72188_73805_+	hypothetical protein	NA	B5TA68	Burkholderia_phage	100.0	0.0e+00
AYQ40320.1|73794_75330_+	DUF935 domain-containing protein	NA	B5TA67	Burkholderia_phage	100.0	1.7e-278
AYQ40321.1|75374_75635_+	hypothetical protein	NA	B5TA66	Burkholderia_phage	100.0	5.1e-39
AYQ40322.1|75635_76868_+|head	phage head morphogenesis protein	head	B5TA65	Burkholderia_phage	99.3	3.2e-240
>prophage 1
CP024945	Burkholderia lata strain A05 chromosome 3, complete sequence	1153372	29696	58232	1153372	transposase,integrase	Salmonella_phage(33.33%)	22	21603:21619	59074:59090
21603:21619	attL	TGCTGTTCGGCGGCATG	NA	NA	NA	NA
AYQ43559.1|29696_32693_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	26.5	6.7e-82
AYQ43560.1|32689_33055_+|transposase	transposase	transposase	NA	NA	NA	NA
AYQ43561.1|33413_33782_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ43562.1|33873_35166_+	TolC family protein	NA	NA	NA	NA	NA
AYQ43563.1|35635_36316_+	cupin	NA	NA	NA	NA	NA
AYQ43564.1|36312_36897_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYQ44426.1|36956_37733_+	sugar dehydrogenase	NA	A0A0M4JSW6	Mollivirus	28.2	2.0e-14
AYQ44427.1|37747_38314_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AYQ44428.1|38416_38590_-	resolvase	NA	NA	NA	NA	NA
AYQ43565.1|38566_40285_+|transposase	transposase	transposase	M4T586	Rhodobacter_phage	25.7	5.8e-06
AYQ43566.1|40287_41196_+|transposase	transposase	transposase	NA	NA	NA	NA
AYQ44429.1|45361_45985_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.7	3.7e-35
AYQ43567.1|46659_47640_-|transposase	IS5 family transposase ISPre1	transposase	A0A077K814	Ralstonia_phage	58.3	1.2e-96
AYQ43568.1|48234_49245_-	hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.8	5.6e-25
AYQ44430.1|49269_50067_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
AYQ43569.1|50079_50940_-	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYQ44431.1|50942_51761_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	5.4e-26
AYQ43570.1|51923_52181_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ43571.1|52437_52902_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ43572.1|52904_53465_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
AYQ43573.1|53468_56435_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	97.5	0.0e+00
AYQ43574.1|56534_58232_+|integrase	integrase	integrase	NA	NA	NA	NA
59074:59090	attR	TGCTGTTCGGCGGCATG	NA	NA	NA	NA
>prophage 2
CP024945	Burkholderia lata strain A05 chromosome 3, complete sequence	1153372	366010	461163	1153372	tRNA,head,tail,terminase,plate,holin,integrase	Burkholderia_phage(46.15%)	95	369259:369275	456174:456190
AYQ43809.1|366010_366382_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	100.0	8.5e-64
AYQ43810.1|366378_366819_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	97.9	9.8e-75
AYQ43811.1|366802_367144_-	single-stranded DNA-binding protein	NA	A4JWM6	Burkholderia_virus	98.2	8.4e-58
AYQ43812.1|367236_367509_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	98.9	2.5e-41
AYQ43813.1|367572_368190_-	sulfate transporter	NA	Q6QIE4	Burkholderia_phage	98.0	1.2e-110
AYQ43814.1|368313_368736_-	hypothetical protein	NA	Q6QIE3	Burkholderia_phage	100.0	5.9e-77
AYQ43815.1|368771_369101_-	hypothetical protein	NA	Q6QIE2	Burkholderia_phage	94.5	3.9e-52
AYQ44454.1|369102_370314_-	hypothetical protein	NA	Q6QIE1	Burkholderia_phage	96.0	3.9e-214
369259:369275	attL	GCGCAGCGCGTCGACGC	NA	NA	NA	NA
AYQ43816.1|370313_372113_-|integrase	integrase	integrase	Q6QIE0	Burkholderia_phage	97.8	0.0e+00
AYQ43817.1|372130_373048_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	86.6	3.6e-140
AYQ43818.1|373060_373366_-	transcriptional regulator	NA	A4JWN4	Burkholderia_virus	99.0	1.4e-48
AYQ43819.1|373362_373842_-	hypothetical protein	NA	Q6QID6	Burkholderia_phage	98.1	2.4e-87
AYQ43820.1|373962_374199_+	hypothetical protein	NA	Q6QID5	Burkholderia_phage	97.4	1.1e-35
AYQ43821.1|374244_374427_-	DNA-binding protein	NA	A4JWN7	Burkholderia_virus	95.0	2.0e-26
AYQ44455.1|375751_375940_+	hypothetical protein	NA	A4JWP0	Burkholderia_virus	80.6	3.4e-21
AYQ43822.1|375920_376457_+	hypothetical protein	NA	A4JWP1	Burkholderia_virus	96.6	2.4e-91
AYQ43823.1|376524_376749_+	hypothetical protein	NA	A4JWP2	Burkholderia_virus	98.6	7.2e-34
AYQ43824.1|376815_377163_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	90.4	3.6e-48
AYQ44456.1|377165_377777_+	lytic transglycosylase	NA	Q6QIC7	Burkholderia_phage	97.5	4.5e-110
AYQ43825.1|377773_378373_+	hypothetical protein	NA	A4JWP5	Burkholderia_virus	83.2	3.5e-83
AYQ43826.1|378369_378708_+	hypothetical protein	NA	A4JWP6	Burkholderia_virus	99.1	1.8e-52
AYQ43827.1|378704_379037_+	hypothetical protein	NA	Q6QIC3	Burkholderia_phage	100.0	8.7e-60
AYQ43828.1|379038_379584_+|terminase	terminase	terminase	A4JWJ3	Burkholderia_virus	97.8	9.5e-88
AYQ43829.1|379580_381083_+	hypothetical protein	NA	Q6QIC1	Burkholderia_phage	97.0	3.8e-288
AYQ43830.1|381079_382555_+	DUF935 domain-containing protein	NA	Q6QIC0	Burkholderia_phage	96.5	4.3e-276
AYQ43831.1|382547_383384_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	97.8	8.1e-163
AYQ43832.1|383380_383908_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	96.6	7.5e-90
AYQ43833.1|384122_385241_+	peptidase	NA	A4JWJ9	Burkholderia_virus	97.0	5.2e-205
AYQ44457.1|385286_386210_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	97.7	6.4e-169
AYQ43834.1|386284_386617_+	DUF2190 domain-containing protein	NA	Q6QIB4	Burkholderia_phage	96.4	4.8e-50
AYQ43835.1|386618_387071_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	99.3	7.2e-81
AYQ43836.1|387070_387535_+	hypothetical protein	NA	A4JWK3	Burkholderia_virus	99.4	6.7e-82
AYQ43837.1|387531_387777_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	98.8	1.0e-36
AYQ43838.1|387780_389214_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	96.9	4.4e-265
AYQ43839.1|389216_389741_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	97.1	6.1e-92
AYQ44458.1|389862_390192_+	hypothetical protein	NA	A4JWK7	Burkholderia_virus	96.3	1.2e-48
AYQ43840.1|390118_390322_+	hypothetical protein	NA	Q6QIA7	Burkholderia_phage	95.5	8.3e-29
AYQ43841.1|390324_390567_-	hypothetical protein	NA	A4JWK9	Burkholderia_virus	97.5	1.2e-34
AYQ43842.1|390596_393209_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	96.2	0.0e+00
AYQ43843.1|393210_394101_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	96.3	7.7e-103
AYQ43844.1|394100_394310_+	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	91.3	5.9e-30
AYQ43845.1|394297_395503_+	phage protein D	NA	Q6QIA2	Burkholderia_phage	96.5	3.4e-210
AYQ43846.1|395499_396102_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	93.0	6.2e-96
AYQ43847.1|396155_396509_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	96.6	2.9e-61
AYQ43848.1|396505_397657_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	92.4	4.1e-197
AYQ43849.1|397649_398231_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	86.5	6.0e-88
AYQ44459.1|400270_400963_+|tail	phage tail protein	tail	A9YX14	Burkholderia_phage	59.4	1.4e-59
AYQ43850.1|401295_402255_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ43851.1|403080_404892_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	1.8e-29
AYQ43852.1|405000_406002_-	alkane 1-monooxygenase	NA	NA	NA	NA	NA
AYQ43853.1|406153_408631_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	33.2	4.0e-16
AYQ43854.1|408750_409692_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYQ43855.1|409728_410229_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYQ43856.1|410863_411409_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYQ43857.1|411646_412528_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYQ43858.1|412524_414213_-	microcin ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	3.0e-15
AYQ43859.1|414209_415043_-	ABC transporter permease	NA	NA	NA	NA	NA
AYQ43860.1|415039_416041_-	ABC transporter permease	NA	NA	NA	NA	NA
AYQ44460.1|416045_417533_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYQ43861.1|417673_418915_-	SfnB family sulfur acquisition oxidoreductase	NA	NA	NA	NA	NA
AYQ44461.1|419305_421597_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AYQ43862.1|421607_422981_+	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
AYQ43863.1|422977_423997_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AYQ43864.1|423993_425043_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AYQ43865.1|425039_425765_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ43866.1|425761_426871_+	alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
AYQ43867.1|426907_427996_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AYQ43868.1|428307_429873_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.5	6.2e-15
AYQ43869.1|430674_432075_-	MFS transporter	NA	NA	NA	NA	NA
AYQ43870.1|432203_433136_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYQ44462.1|433253_435149_-	signal transduction protein	NA	NA	NA	NA	NA
AYQ43871.1|435367_435763_-	thioesterase	NA	NA	NA	NA	NA
AYQ43872.1|436135_437275_-	branched chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYQ43873.1|437271_437991_-	hydrolase	NA	NA	NA	NA	NA
AYQ43874.1|437993_438752_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
AYQ44463.1|438751_440095_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
AYQ44464.1|440167_440539_-	thioesterase	NA	NA	NA	NA	NA
AYQ43875.1|441002_441335_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
AYQ44465.1|441702_442248_-	cell division protein ZipA	NA	NA	NA	NA	NA
AYQ43876.1|442376_443462_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ43877.1|444041_444587_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ43878.1|444659_445004_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ43879.1|445043_445364_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
AYQ43880.1|445432_446665_-	formamidase	NA	A0A1V0S8X7	Catovirus	56.1	9.9e-133
AYQ43881.1|446737_447250_-	transporter	NA	NA	NA	NA	NA
AYQ43882.1|447547_448606_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AYQ43883.1|448937_451667_+	histidine kinase	NA	NA	NA	NA	NA
AYQ43884.1|451663_452935_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ43885.1|453104_453821_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYQ43886.1|453874_455929_+	squalene--hopene cyclase	NA	NA	NA	NA	NA
AYQ43887.1|455954_456617_-	hypothetical protein	NA	NA	NA	NA	NA
456174:456190	attR	GCGCAGCGCGTCGACGC	NA	NA	NA	NA
AYQ43888.1|456793_457174_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AYQ43889.1|457296_458184_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYQ43890.1|458196_458883_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
AYQ43891.1|459024_461163_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
