The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033371	Lactobacillus fermentum strain DR9 chromosome, complete genome	1285454	729	79427	1285454	tRNA,transposase,protease	Lactobacillus_phage(17.65%)	59	NA	NA
AYP97984.1|729_981_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	4.6e-37
AYP97985.1|1034_1877_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.6	9.7e-156
AYP97986.1|1936_2131_+	hypothetical protein	NA	NA	NA	NA	NA
AYP97987.1|2410_3697_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.2	1.3e-47
AYP97988.1|3817_4960_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	36.6	1.9e-37
AYP97989.1|4959_6858_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	34.6	1.6e-49
AYP97990.1|7009_9088_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AYP97991.1|9087_10062_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AYP97992.1|10330_11149_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AYP97993.1|12181_12580_-	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
AYP97994.1|12557_13031_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
AYP97995.1|13030_14014_-	PhoH family protein	NA	L7TP00	Rhizobium_phage	49.3	9.2e-49
AYP97996.1|14160_14610_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	34.7	7.2e-17
AYP97997.1|14674_14863_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AYP97998.1|14976_15660_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
AYP97999.1|16335_18111_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AYP98000.1|19788_20817_+	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	29.1	7.7e-14
AYP98001.1|20878_21748_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	35.2	1.7e-17
AYP98002.1|21749_22589_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
AYP98003.1|22666_23599_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AYP98851.1|23725_25099_+	amino acid permease	NA	NA	NA	NA	NA
AYP98004.1|25225_25432_+	hypothetical protein	NA	NA	NA	NA	NA
AYP98005.1|25433_26258_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
AYP98006.1|29503_30445_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.3	2.8e-47
AYP98007.1|30997_32356_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AYP98008.1|33864_34719_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYP98009.1|34734_35475_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	6.1e-37
AYP98010.1|35485_36157_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYP98011.1|36137_36797_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYP98012.1|37978_38686_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYP98013.1|39380_40124_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	4.1e-33
AYP98014.1|41471_42599_-	PLP-dependent transferase	NA	A0A2I2L687	Orpheovirus	28.3	3.4e-07
AYP98015.1|42573_43770_-	PLP-dependent transferase	NA	NA	NA	NA	NA
AYP98016.1|44117_44606_-	transcriptional regulator	NA	NA	NA	NA	NA
AYP98017.1|44972_45410_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AYP98018.1|47670_48012_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98019.1|48071_48821_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYP98020.1|49839_50166_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98021.1|50464_50647_+	hypothetical protein	NA	NA	NA	NA	NA
AYP98022.1|50728_51682_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AYP98023.1|52065_53094_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.6	7.7e-38
AYP98024.1|53351_54710_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AYP98025.1|55147_56311_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	71.4	9.0e-160
AYP98852.1|56430_56997_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98026.1|57326_57542_+	hypothetical protein	NA	NA	NA	NA	NA
AYP98027.1|57682_58075_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98028.1|58090_58450_-	steryl acetyl hydrolase	NA	NA	NA	NA	NA
AYP98029.1|61125_62031_-	type II CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
AYP98030.1|62238_66384_-	type II CRISPR RNA-guided endonuclease Cas9	NA	NA	NA	NA	NA
AYP98031.1|69840_70638_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AYP98032.1|70802_71444_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
AYP98033.1|71505_72318_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AYP98034.1|72332_72776_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AYP98035.1|72865_73195_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYP98036.1|73921_74749_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYP98037.1|75302_75842_-	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AYP98038.1|76696_77308_+	cadmium transporter	NA	NA	NA	NA	NA
AYP98039.1|77645_78896_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.2	2.8e-58
AYP98040.1|78974_79427_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
>prophage 2
CP033371	Lactobacillus fermentum strain DR9 chromosome, complete genome	1285454	83560	146320	1285454	tRNA,transposase,protease	Staphylococcus_phage(20.0%)	44	NA	NA
AYP98043.1|83560_84586_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.1	1.3e-42
AYP98044.1|84667_85153_+	flavodoxin	NA	NA	NA	NA	NA
AYP98045.1|85341_86700_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AYP98046.1|88193_88802_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.1	1.8e-26
AYP98047.1|88788_89982_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	2.5e-96
AYP98048.1|89974_90445_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.0e-25
AYP98049.1|94181_95255_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	48.2	5.3e-90
AYP98050.1|96628_97252_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AYP98051.1|97287_97791_+	hypothetical protein	NA	NA	NA	NA	NA
AYP98052.1|98303_100100_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.1	5.5e-23
AYP98053.1|100204_101290_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AYP98054.1|101302_101623_-	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
AYP98055.1|101624_101942_-	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
AYP98056.1|103682_104843_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	29.3	8.4e-17
AYP98057.1|104954_106811_-	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	45.4	9.3e-135
AYP98058.1|106848_107436_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AYP98059.1|107446_108493_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AYP98060.1|108618_108984_+	hypothetical protein	NA	NA	NA	NA	NA
AYP98061.1|109769_112037_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	30.7	1.4e-124
AYP98854.1|112099_112219_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98062.1|112346_113105_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.2	1.9e-30
AYP98063.1|113115_114000_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	24.5	2.4e-11
AYP98064.1|113987_114701_-|transposase	transposase	transposase	NA	NA	NA	NA
AYP98855.1|114981_115275_-|transposase	transposase	transposase	NA	NA	NA	NA
AYP98065.1|116897_117863_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
AYP98066.1|117873_118770_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
AYP98067.1|118839_119202_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
AYP98068.1|119214_121503_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.6	4.2e-20
AYP98069.1|121550_121874_-	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
AYP98070.1|121866_122169_-	YlxR family protein	NA	NA	NA	NA	NA
AYP98071.1|123450_123930_-	ribosome maturation factor	NA	NA	NA	NA	NA
AYP98072.1|127164_128235_-	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.7	3.1e-50
AYP98073.1|128479_129505_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AYP98074.1|129531_130734_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
AYP98075.1|130743_131490_+	acetylglutamate kinase	NA	NA	NA	NA	NA
AYP98076.1|131502_132654_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	1.5e-21
AYP98077.1|139016_140288_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AYP98078.1|140309_141098_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AYP98079.1|142016_142580_-	ribosome recycling factor	NA	NA	NA	NA	NA
AYP98080.1|142576_143302_-	UMP kinase	NA	NA	NA	NA	NA
AYP98081.1|143382_144261_-	elongation factor Ts	NA	NA	NA	NA	NA
AYP98082.1|144351_145131_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
AYP98083.1|145284_145575_-	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	38.0	8.3e-06
AYP98084.1|145567_146320_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
CP033371	Lactobacillus fermentum strain DR9 chromosome, complete genome	1285454	166055	217767	1285454	portal,terminase,holin,tail,integrase,transposase	Lactobacillus_phage(63.89%)	54	180306:180327	216462:216483
AYP98099.1|166055_167579_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	3.9e-38
AYP98100.1|167646_168003_-	IS66 family insertion sequence hypothetical protein	NA	S5WJH4	Leptospira_phage	43.8	4.4e-09
AYP98101.1|167992_168187_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98102.1|168381_169071_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	51.8	1.3e-60
AYP98103.1|170517_171741_-	DUF389 domain-containing protein	NA	NA	NA	NA	NA
AYP98104.1|171869_172190_+	hypothetical protein	NA	NA	NA	NA	NA
AYP98105.1|172364_172727_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98106.1|173253_173829_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYP98107.1|176784_177669_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	24.5	2.4e-11
AYP98108.1|178407_179628_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	6.2e-95
180306:180327	attL	AAAGGAGAGTACAGGATTTGAA	NA	NA	NA	NA
AYP98109.1|180664_181441_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98110.1|181427_181841_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98111.1|181837_182749_-	hypothetical protein	NA	A0A1X9IGI7	Lactococcus_phage	37.1	1.8e-30
AYP98112.1|182930_183881_-	glycoside hydrolase family 25	NA	Q6SE63	Lactobacillus_prophage	40.4	1.5e-56
AYP98113.1|183855_184332_-|holin	holin	holin	A0A1P8VVQ3	Streptococcus_phage	47.1	1.8e-10
AYP98114.1|184418_184646_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98115.1|184796_189074_-	hypothetical protein	NA	A0A0A1ELH9	Lactobacillus_phage	38.1	3.2e-223
AYP98116.1|189070_189862_-	hypothetical protein	NA	A0A0A1EN95	Lactobacillus_phage	46.0	5.7e-65
AYP98117.1|189868_192973_-|tail	phage tail tape measure protein	tail	A0A0A1ENQ9	Lactobacillus_phage	80.8	3.4e-166
AYP98118.1|192956_193313_-	hypothetical protein	NA	A0A0A1EKY4	Lactobacillus_phage	50.4	1.7e-21
AYP98119.1|193402_193735_-	hypothetical protein	NA	A0A0A1ER95	Lactobacillus_phage	77.1	1.7e-39
AYP98120.1|193749_194340_-|tail	phage tail protein	tail	A0A0A1ELH3	Lactobacillus_phage	82.4	5.3e-84
AYP98121.1|194355_194754_-	DUF3168 domain-containing protein	NA	A0A0A1EN91	Lactobacillus_phage	64.9	2.1e-44
AYP98122.1|194750_195119_-	hypothetical protein	NA	A0A0A1ENQ3	Lactobacillus_phage	81.4	1.8e-45
AYP98123.1|195096_195414_-	hypothetical protein	NA	A0A0A1EKX8	Lactobacillus_phage	60.2	1.9e-27
AYP98124.1|195397_195784_-	hypothetical protein	NA	A0A0A1ER91	Lactobacillus_phage	72.1	1.9e-42
AYP98125.1|195940_196804_-	hypothetical protein	NA	A0A0A1ELG8	Lactobacillus_phage	77.4	3.3e-119
AYP98126.1|196816_197443_-	DUF4355 domain-containing protein	NA	A0A0A1EN85	Lactobacillus_phage	69.2	5.3e-66
AYP98127.1|197525_197750_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98128.1|198766_200152_-|portal	phage portal protein	portal	A0A0A1ER87	Lactobacillus_phage	75.8	5.6e-209
AYP98129.1|201556_202000_-|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	58.6	2.4e-36
AYP98130.1|202009_202675_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98131.1|202828_203281_-	ArpU family transcriptional regulator	NA	U3PIU0	Lactobacillus_phage	33.3	1.0e-10
AYP98132.1|203468_203801_-	DUF3310 domain-containing protein	NA	E9LUN2	Lactobacillus_phage	51.0	3.1e-17
AYP98133.1|203977_204250_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98134.1|204267_204786_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98135.1|204782_205139_-	VRR-NUC domain-containing protein	NA	A0A0A1ENT6	Lactobacillus_phage	84.1	1.7e-53
AYP98136.1|205335_205737_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98857.1|206024_206924_-	virulence protein E	NA	A0A0A1EL11	Lactobacillus_phage	52.3	4.2e-80
AYP98137.1|208095_208653_-	hypothetical protein	NA	A0A2P0ZLB9	Lactobacillus_phage	40.3	6.9e-33
AYP98138.1|208669_209362_-	NTP-binding protein	NA	U3PIS9	Lactobacillus_phage	62.4	2.5e-77
AYP98139.1|210757_210970_-	hypothetical protein	NA	A0A0A1EL06	Lactobacillus_phage	61.4	4.0e-18
AYP98140.1|210956_211241_-	hypothetical protein	NA	A0A0A1EL06	Lactobacillus_phage	51.8	1.9e-15
AYP98141.1|211621_211810_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98142.1|211973_212231_-	DNA-binding protein	NA	NA	NA	NA	NA
AYP98143.1|212441_212651_-	DUF739 family protein	NA	A0A141E1D4	Streptococcus_phage	67.2	9.4e-20
AYP98144.1|212810_213212_+	helix-turn-helix domain-containing protein	NA	Q6SEF6	Lactobacillus_prophage	49.6	3.7e-28
AYP98145.1|213238_213637_+	ImmA/IrrE family metallo-endopeptidase	NA	E9LUL3	Lactobacillus_phage	48.9	1.9e-29
AYP98146.1|213822_214134_+	hypothetical protein	NA	NA	NA	NA	NA
AYP98147.1|214105_214723_+	hypothetical protein	NA	NA	NA	NA	NA
AYP98148.1|214744_215089_+	hypothetical protein	NA	Q6SEG3	Lactobacillus_prophage	69.0	1.9e-25
AYP98149.1|215250_216339_+|integrase	site-specific integrase	integrase	E9LUK6	Lactobacillus_phage	49.5	6.3e-83
AYP98150.1|216599_217220_-	DUF308 domain-containing protein	NA	NA	NA	NA	NA
216462:216483	attR	AAAGGAGAGTACAGGATTTGAA	NA	NA	NA	NA
AYP98151.1|217320_217767_+	nucleoside 2-deoxyribosyltransferase	NA	A0A1D3SPR3	Enterococcus_phage	36.7	1.4e-20
>prophage 4
CP033371	Lactobacillus fermentum strain DR9 chromosome, complete genome	1285454	393853	440388	1285454	portal,tRNA,head,tail,capsid,transposase	Lactobacillus_phage(66.67%)	51	NA	NA
AYP98267.1|393853_395074_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
AYP98268.1|396417_398127_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
AYP98269.1|398456_399062_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
AYP98270.1|399265_400429_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A075KJD2	Lactobacillus_phage	39.6	1.2e-39
AYP98271.1|400379_400814_-	hypothetical protein	NA	A0A0A1ELI5	Lactobacillus_phage	39.1	1.2e-13
AYP98272.1|400797_401124_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98273.1|401264_401408_-	XkdX family protein	NA	NA	NA	NA	NA
AYP98274.1|401420_402053_-	hypothetical protein	NA	A0A2H4J5I5	uncultured_Caudovirales_phage	47.5	5.3e-05
AYP98275.1|402071_402509_-	hypothetical protein	NA	D2KRC4	Lactobacillus_phage	33.6	1.3e-10
AYP98276.1|402606_403536_-	DUF2479 domain-containing protein	NA	NA	NA	NA	NA
AYP98277.1|403548_403980_-	hypothetical protein	NA	E9LUJ8	Lactobacillus_phage	26.2	7.2e-06
AYP98278.1|403992_404757_-	collagen-like protein	NA	A0A059PAH9	Leuconostoc_phage	49.1	2.6e-06
AYP98279.1|405083_405272_+	hypothetical protein	NA	NA	NA	NA	NA
AYP98280.1|405556_406819_-	hypothetical protein	NA	D2KRC0	Lactobacillus_phage	39.4	6.7e-44
AYP98281.1|406796_408089_-	hypothetical protein	NA	E9LUJ4	Lactobacillus_phage	34.2	6.1e-16
AYP98282.1|408051_408888_-|tail	phage tail family protein	tail	E9LUJ3	Lactobacillus_phage	39.2	9.9e-52
AYP98283.1|408951_413142_-	tape measure protein	NA	E9LUR1	Lactobacillus_phage	34.0	4.0e-24
AYP98284.1|413346_413676_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98285.1|413748_414360_-	hypothetical protein	NA	O64291	Streptococcus_virus	29.3	5.4e-15
AYP98286.1|414372_414750_-	DUF806 family protein	NA	A0A2I6QQW4	Streptococcus_phage	38.1	7.0e-13
AYP98287.1|414749_415196_-	hypothetical protein	NA	A0A286QQ14	Streptococcus_phage	52.2	2.5e-30
AYP98288.1|415179_415548_-|head,tail	head-tail adaptor protein	head,tail	B8R652	Lactobacillus_phage	43.2	5.7e-20
AYP98289.1|415519_415822_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98290.1|415842_417525_-|capsid	phage major capsid protein	capsid	A0A0M7RF71	Lactobacillus_phage	50.9	7.9e-133
AYP98291.1|417535_418756_-|portal	phage portal protein	portal	B8R650	Lactobacillus_phage	48.8	6.6e-97
AYP98292.1|418755_418938_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98293.1|421513_422020_-	HNH endonuclease	NA	B8R694	Lactobacillus_phage	55.9	1.1e-40
AYP98294.1|422110_422611_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98295.1|422636_423647_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98296.1|423835_424354_-	hypothetical protein	NA	Q8SDG5	Lactococcus_phage	29.0	1.7e-06
AYP98297.1|424527_424941_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98298.1|424966_425233_-	hypothetical protein	NA	A0A0A1EL18	Lactobacillus_phage	51.7	2.3e-15
AYP98299.1|425229_425493_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98300.1|425492_425759_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98301.1|425857_426199_-	VRR-NUC domain-containing protein	NA	A0A0A1ENT6	Lactobacillus_phage	84.8	4.3e-54
AYP98302.1|427932_428724_-	DNA primase	NA	U3PBE3	Lactobacillus_phage	55.3	1.8e-71
AYP98303.1|428726_429284_-	hypothetical protein	NA	A0A2P0ZLB9	Lactobacillus_phage	39.2	5.8e-32
AYP98304.1|429300_429993_-	NTP-binding protein	NA	U3PIS9	Lactobacillus_phage	62.4	5.6e-77
AYP98305.1|431425_431956_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98306.1|431925_432135_-	hypothetical protein	NA	E9LUM2	Lactobacillus_phage	75.4	6.3e-24
AYP98307.1|432476_432797_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98308.1|432777_432999_-	XRE family transcriptional regulator	NA	A0A1S5SDM7	Streptococcus_phage	50.0	1.2e-09
AYP98309.1|433225_433537_+	XRE family transcriptional regulator	NA	A0A097QQ00	Enterococcus_phage	46.7	5.4e-19
AYP98310.1|433557_433968_+	hypothetical protein	NA	NA	NA	NA	NA
AYP98311.1|433989_434484_+	hypothetical protein	NA	NA	NA	NA	NA
AYP98312.1|434550_435036_+	hypothetical protein	NA	E9LUL2	Lactobacillus_phage	93.8	1.6e-78
AYP98313.1|435208_435496_+	hypothetical protein	NA	NA	NA	NA	NA
AYP98314.1|435489_436224_+	hypothetical protein	NA	NA	NA	NA	NA
AYP98315.1|436486_436867_+	hypothetical protein	NA	E9LUL0	Lactobacillus_phage	97.1	7.0e-29
AYP98861.1|438460_439159_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	31.7	5.2e-22
AYP98316.1|440067_440388_-|head	head protein	head	Q6SED4	Lactobacillus_prophage	54.2	1.2e-26
>prophage 5
CP033371	Lactobacillus fermentum strain DR9 chromosome, complete genome	1285454	492030	614322	1285454	holin,tRNA,transposase,protease	Streptococcus_phage(27.59%)	88	NA	NA
AYP98357.1|492030_493281_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
AYP98358.1|493354_493810_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.0	2.8e-32
AYP98359.1|493921_494863_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.6	1.3e-44
AYP98360.1|494805_495342_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYP98361.1|495416_496277_-	sugar transporter	NA	NA	NA	NA	NA
AYP98362.1|497979_498702_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYP98363.1|499326_499677_-	DUF956 family protein	NA	NA	NA	NA	NA
AYP98364.1|499677_500598_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
AYP98365.1|500626_501430_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AYP98366.1|501426_502434_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AYP98367.1|504081_504597_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
AYP98368.1|504759_505599_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	40.9	7.9e-49
AYP98369.1|505685_506648_+	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
AYP98370.1|507768_508797_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
AYP98371.1|509194_509785_-	LysM domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	53.7	1.6e-27
AYP98372.1|510105_510933_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AYP98373.1|510955_512806_-	acetyltransferase	NA	NA	NA	NA	NA
AYP98374.1|512815_513127_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98375.1|513407_515228_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HVL7	Paramecium_bursaria_Chlorella_virus	35.5	2.0e-89
AYP98376.1|515441_516800_-	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	26.9	3.6e-19
AYP98377.1|516839_517718_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98378.1|518562_519459_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
AYP98379.1|519586_520126_+	exonuclease	NA	A0A1S5SEW3	Streptococcus_phage	38.6	8.1e-23
AYP98380.1|520255_520771_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYP98381.1|520770_521223_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AYP98382.1|521231_522206_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
AYP98383.1|522238_522928_-	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	45.6	2.3e-46
AYP98384.1|523065_523650_+	hypothetical protein	NA	NA	NA	NA	NA
AYP98385.1|523677_524151_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	56.8	4.0e-42
AYP98863.1|526616_526841_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AYP98386.1|531587_532355_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
AYP98387.1|532460_533666_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYP98388.1|536194_537073_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.6e-42
AYP98389.1|537096_537384_-|transposase	transposase	transposase	NA	NA	NA	NA
AYP98390.1|540134_540329_+	hypothetical protein	NA	NA	NA	NA	NA
AYP98391.1|540763_541984_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	1.4e-94
AYP98392.1|542193_543378_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AYP98393.1|543548_544370_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98394.1|545668_547021_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AYP98864.1|547209_547707_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98395.1|549830_550421_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	56.8	3.6e-56
AYP98396.1|550534_551182_+	thiaminase II	NA	NA	NA	NA	NA
AYP98397.1|551302_552241_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	37.1	1.0e-49
AYP98398.1|553256_554126_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.8	2.2e-09
AYP98399.1|554340_555426_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98400.1|555502_558376_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	53.8	1.4e-283
AYP98401.1|558385_560401_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
AYP98402.1|560500_560734_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98403.1|561593_563318_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	60.2	2.3e-196
AYP98404.1|564282_565224_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AYP98405.1|565249_566278_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
AYP98406.1|566536_567469_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.7	3.0e-41
AYP98407.1|567536_568463_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	58.0	2.2e-100
AYP98408.1|568483_569302_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
AYP98409.1|569314_570256_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	48.4	3.1e-78
AYP98410.1|570424_571330_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.3	1.4e-46
AYP98411.1|571901_572318_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AYP98412.1|572542_573793_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.4e-57
AYP98413.1|574416_575391_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AYP98414.1|575415_576594_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AYP98415.1|576609_577389_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
AYP98416.1|577913_578828_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	45.9	7.5e-69
AYP98417.1|579901_580747_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AYP98418.1|580739_581702_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
AYP98419.1|581716_582070_-|holin	phage holin family protein	holin	NA	NA	NA	NA
AYP98420.1|582069_582399_-	PspC domain-containing protein	NA	NA	NA	NA	NA
AYP98421.1|586169_586715_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AYP98422.1|588951_589539_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	44.0	1.4e-39
AYP98423.1|589735_590002_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98424.1|590207_592046_-	APC family permease	NA	NA	NA	NA	NA
AYP98425.1|592186_593818_-	molecular chaperone GroEL	NA	A0A240F779	uncultured_virus	54.7	1.1e-158
AYP98426.1|593842_594124_-	co-chaperone GroES	NA	A0A221S386	uncultured_virus	43.0	5.2e-13
AYP98427.1|597373_597568_+	hypothetical protein	NA	NA	NA	NA	NA
AYP98428.1|597557_597914_+	IS66 family insertion sequence hypothetical protein	NA	S5WJH4	Leptospira_phage	43.8	4.4e-09
AYP98429.1|599603_600566_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
AYP98430.1|601218_601983_-	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AYP98431.1|602000_602774_-	AccA family protein	NA	NA	NA	NA	NA
AYP98432.1|603584_604982_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AYP98865.1|605002_605425_-	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ	NA	NA	NA	NA	NA
AYP98433.1|605439_605886_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AYP98434.1|607139_607871_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	4.8e-18
AYP98435.1|608802_609051_-	acyl carrier protein	NA	NA	NA	NA	NA
AYP98436.1|610061_610502_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYP98437.1|610577_611024_-	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ	NA	NA	NA	NA	NA
AYP98438.1|611396_611636_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98439.1|611998_613033_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.5	2.5e-60
AYP98440.1|613001_613601_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AYP98441.1|613590_614322_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 6
CP033371	Lactobacillus fermentum strain DR9 chromosome, complete genome	1285454	659603	727573	1285454	tRNA,transposase,protease	Lactobacillus_phage(15.38%)	32	NA	NA
AYP98474.1|659603_661022_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	31.1	6.0e-49
AYP98475.1|663572_664706_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
AYP98476.1|664737_666111_-	DNA repair protein RadA	NA	NA	NA	NA	NA
AYP98867.1|666123_666663_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	47.2	2.0e-37
AYP98477.1|667888_668440_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
AYP98868.1|672004_672910_-	AEC family transporter	NA	NA	NA	NA	NA
AYP98478.1|673103_674066_-	beta-galactosidase small subunit	NA	NA	NA	NA	NA
AYP98479.1|674049_675930_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	32.8	7.3e-95
AYP98480.1|676216_676672_-	SprT family protein	NA	NA	NA	NA	NA
AYP98481.1|679690_681151_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	46.2	5.7e-111
AYP98482.1|681181_681883_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYP98483.1|684709_686206_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	2.1e-68
AYP98484.1|689183_689936_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98485.1|689976_690900_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.5	3.7e-31
AYP98486.1|691063_691348_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYP98487.1|691344_691683_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AYP98488.1|694715_696002_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.0	3.0e-47
AYP98489.1|696846_697824_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AYP98490.1|706932_707814_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
AYP98491.1|707890_710059_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0CCN8	Ostreococcus_mediterraneus_virus	48.8	5.6e-107
AYP98492.1|710142_710691_-	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L634	Tupanvirus	30.8	1.0e-12
AYP98493.1|712055_712562_-	RNA-binding protein S1	NA	NA	NA	NA	NA
AYP98494.1|712690_713047_-	septum formation initiator family protein	NA	NA	NA	NA	NA
AYP98495.1|713135_713408_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
AYP98496.1|713404_716947_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
AYP98497.1|717711_718347_+	CBS domain-containing protein	NA	NA	NA	NA	NA
AYP98498.1|718479_718833_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5RCS0	Lactobacillus_phage	40.0	1.0e-13
AYP98499.1|718844_719966_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.3	1.1e-29
AYP98500.1|719968_720328_-	holo-ACP synthase	NA	NA	NA	NA	NA
AYP98501.1|723537_724437_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
AYP98502.1|724447_725005_-	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	33.8	2.7e-13
AYP98503.1|727120_727573_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	4.7e-32
>prophage 7
CP033371	Lactobacillus fermentum strain DR9 chromosome, complete genome	1285454	766788	805495	1285454	transposase	Streptococcus_phage(33.33%)	33	NA	NA
AYP98531.1|766788_767829_-	Zn-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.3	3.1e-10
AYP98532.1|768072_769059_-|transposase	transposase	transposase	A0A286QMQ9	Streptococcus_phage	40.9	1.9e-54
AYP98533.1|769219_770440_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	6.2e-95
AYP98534.1|770504_770792_+|transposase	transposase	transposase	NA	NA	NA	NA
AYP98535.1|770815_771694_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	5.2e-43
AYP98536.1|772057_772513_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.0	8.1e-32
AYP98537.1|772592_772907_-	DNA-binding protein	NA	A0A2R3ZXQ3	Staphylococcus_phage	40.4	6.6e-17
AYP98538.1|772917_773649_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
AYP98539.1|773658_774306_-	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	27.1	8.0e-17
AYP98540.1|774382_775324_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
AYP98541.1|775442_776378_-	carbamate kinase	NA	NA	NA	NA	NA
AYP98542.1|776401_776542_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
AYP98543.1|776680_776992_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98544.1|776970_777201_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98545.1|777203_777500_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98546.1|778960_779932_-	hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.9	7.0e-33
AYP98547.1|785738_786578_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	62.8	3.2e-98
AYP98548.1|787497_787992_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98549.1|788117_788375_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98550.1|788319_788997_-	hypothetical protein	NA	A0A1X9I6F6	Streptococcus_phage	54.4	1.6e-47
AYP98551.1|789175_789586_+	hypothetical protein	NA	A0A1X9I6F6	Streptococcus_phage	57.9	3.1e-38
AYP98552.1|789619_789928_+	hypothetical protein	NA	A0A1X9I6F6	Streptococcus_phage	51.0	2.5e-21
AYP98553.1|790593_791502_-	glycine/betaine ABC transporter	NA	NA	NA	NA	NA
AYP98554.1|791514_792357_-	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
AYP98555.1|793250_794129_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
AYP98556.1|794152_794440_-|transposase	transposase	transposase	NA	NA	NA	NA
AYP98557.1|795649_795940_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AYP98558.1|798209_798971_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.8	1.1e-12
AYP98559.1|798963_799890_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AYP98560.1|799891_800770_-	heme ABC transporter substrate-binding protein IsdE	NA	NA	NA	NA	NA
AYP98561.1|800784_801576_-	cell surface protein	NA	NA	NA	NA	NA
AYP98562.1|801565_803413_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98563.1|805039_805495_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	49.3	2.8e-32
>prophage 8
CP033371	Lactobacillus fermentum strain DR9 chromosome, complete genome	1285454	813329	887858	1285454	holin,transposase	Bacillus_phage(20.0%)	52	NA	NA
AYP98570.1|813329_813863_+|transposase	transposase	transposase	NA	NA	NA	NA
AYP98571.1|813820_814801_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	38.8	4.6e-40
AYP98572.1|814834_815821_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AYP98869.1|815967_817848_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AYP98573.1|825814_826291_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	35.2	5.9e-17
AYP98574.1|826335_826770_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98575.1|828819_829128_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
AYP98576.1|829141_829513_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
AYP98577.1|829998_831003_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98578.1|831116_832295_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AYP98579.1|832584_833835_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.8e-57
AYP98580.1|833908_834364_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.0	2.8e-32
AYP98581.1|834432_835401_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AYP98582.1|835503_836199_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	A0A1X9IGJ2	Lactococcus_phage	30.5	4.0e-06
AYP98583.1|836438_837692_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AYP98584.1|839501_840083_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	32.4	6.1e-24
AYP98585.1|840091_841129_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	39.8	1.6e-59
AYP98586.1|841128_842592_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.7	1.9e-61
AYP98587.1|844795_845476_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AYP98588.1|845476_845719_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AYP98589.1|845721_846444_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	NA	NA	NA	NA
AYP98590.1|847104_848655_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
AYP98591.1|850045_851341_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.7	8.2e-21
AYP98592.1|851359_852499_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AYP98593.1|852482_852968_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.2	2.4e-21
AYP98594.1|853254_854916_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
AYP98595.1|855003_856044_-	AI-2E family transporter	NA	NA	NA	NA	NA
AYP98596.1|857736_858987_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	36.3	1.8e-57
AYP98597.1|859065_859518_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
AYP98598.1|859629_860049_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
AYP98599.1|860048_860924_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYP98600.1|861259_862555_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
AYP98601.1|862554_863697_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.7	4.2e-29
AYP98870.1|863894_864584_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.6	1.8e-35
AYP98602.1|864780_865287_+	cupin domain-containing protein	NA	A0A291ATU0	Pandoravirus	33.6	9.7e-10
AYP98603.1|865461_866346_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	24.5	2.4e-11
AYP98604.1|866333_867047_-|transposase	transposase	transposase	NA	NA	NA	NA
AYP98605.1|867826_869056_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.9	3.4e-93
AYP98606.1|871494_872991_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.5	2.3e-06
AYP98607.1|872987_873704_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
AYP98608.1|873690_875445_-|holin	choline kinase	holin	NA	NA	NA	NA
AYP98871.1|875827_876442_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	38.0	9.6e-28
AYP98609.1|876378_877284_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	2.3e-14
AYP98610.1|877440_878628_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AYP98872.1|878694_880149_-	flippase	NA	NA	NA	NA	NA
AYP98611.1|880212_881247_-	glycosyltransferase	NA	NA	NA	NA	NA
AYP98612.1|881233_882349_-	EpsG family protein	NA	NA	NA	NA	NA
AYP98613.1|882345_883545_-	glycosyltransferase	NA	NA	NA	NA	NA
AYP98614.1|883570_884569_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98615.1|884571_884874_-	glycosyltransferase	NA	NA	NA	NA	NA
AYP98616.1|884930_885698_-	glycosyltransferase	NA	NA	NA	NA	NA
AYP98617.1|886886_887858_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 9
CP033371	Lactobacillus fermentum strain DR9 chromosome, complete genome	1285454	910970	949972	1285454	holin,tRNA,transposase	Staphylococcus_phage(11.11%)	23	NA	NA
AYP98631.1|910970_911060_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AYP98632.1|912598_913597_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.3e-50
AYP98633.1|913998_915372_-	amino acid permease	NA	NA	NA	NA	NA
AYP98634.1|915691_916435_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	3.1e-33
AYP98635.1|916438_917896_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
AYP98636.1|918363_919617_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.0	3.9e-84
AYP98637.1|921251_922550_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.8	6.2e-93
AYP98638.1|927301_927433_+	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
AYP98639.1|927447_928980_+	D-alanine--poly(phosphoribitol) ligase subunit 1	NA	A0A2K9KZV5	Tupanvirus	26.0	5.9e-34
AYP98640.1|928979_930206_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	31.2	3.4e-24
AYP98641.1|930235_930472_+	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
AYP98642.1|931897_932842_-	aldo/keto reductase	NA	NA	NA	NA	NA
AYP98643.1|932929_934306_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
AYP98644.1|936295_937447_-	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
AYP98645.1|939355_940198_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYP98646.1|940609_942106_-	accessory Sec system glycosyltransferase Asp1	NA	NA	NA	NA	NA
AYP98647.1|942105_943644_-	glycosyltransferase	NA	NA	NA	NA	NA
AYP98648.1|943747_944179_+	hypothetical protein	NA	NA	NA	NA	NA
AYP98649.1|944673_945558_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	24.5	2.4e-11
AYP98873.1|945545_946166_-|transposase	transposase	transposase	NA	NA	NA	NA
AYP98650.1|947661_948057_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98651.1|948192_948648_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	48.6	1.4e-31
AYP98652.1|948721_949972_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	36.8	2.6e-56
>prophage 10
CP033371	Lactobacillus fermentum strain DR9 chromosome, complete genome	1285454	1109830	1184905	1285454	tRNA,transposase	Streptococcus_phage(23.08%)	46	NA	NA
AYP98747.1|1109830_1110331_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AYP98748.1|1110474_1111203_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYP98749.1|1112213_1114616_+	phosphoketolase family protein	NA	NA	NA	NA	NA
AYP98750.1|1115207_1116566_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AYP98751.1|1117358_1118864_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
AYP98752.1|1119420_1120425_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AYP98753.1|1124120_1124774_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
AYP98754.1|1124877_1125837_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
AYP98755.1|1126081_1126999_+	ribokinase	NA	NA	NA	NA	NA
AYP98756.1|1127022_1127418_+	D-ribose pyranase	NA	NA	NA	NA	NA
AYP98757.1|1127432_1128761_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AYP98758.1|1128948_1130670_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AYP98759.1|1136126_1137410_+	nickel-dependent lactate racemase	NA	NA	NA	NA	NA
AYP98760.1|1137417_1138176_+	nickel pincer cofactor biosynthesis protein LarB	NA	A0A288TYA6	Enterococcus_phage	47.2	3.7e-21
AYP98761.1|1139543_1140254_+	aquaporin family protein	NA	NA	NA	NA	NA
AYP98762.1|1140278_1141106_+	ATP-dependent sacrificial sulfur transferase LarE	NA	NA	NA	NA	NA
AYP98763.1|1145392_1146073_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
AYP98764.1|1146464_1147211_+	transaldolase	NA	E3SKN5	Synechococcus_phage	30.2	4.3e-14
AYP98878.1|1151016_1151835_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
AYP98765.1|1152014_1152365_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
AYP98766.1|1152959_1153358_+	hypothetical protein	NA	NA	NA	NA	NA
AYP98767.1|1153364_1153841_+	hypothetical protein	NA	NA	NA	NA	NA
AYP98768.1|1154294_1155149_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYP98769.1|1155145_1155571_-	XRE family transcriptional regulator	NA	A0A0H4ITV7	Staphylococcus_phage	42.9	1.9e-06
AYP98770.1|1157033_1157456_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
AYP98771.1|1158647_1159103_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.7	3.6e-32
AYP98772.1|1159176_1160427_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	3.1e-57
AYP98773.1|1160902_1162864_-	sodium:proton antiporter	NA	NA	NA	NA	NA
AYP98774.1|1164004_1165387_-	ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	29.7	8.0e-14
AYP98775.1|1165390_1165957_-	ABC transporter permease	NA	NA	NA	NA	NA
AYP98776.1|1166497_1167457_-	nucleoside hydrolase	NA	NA	NA	NA	NA
AYP98777.1|1167629_1168622_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	41.1	1.0e-18
AYP98778.1|1168815_1170669_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.7	5.2e-85
AYP98779.1|1170730_1170961_+	copper-binding protein	NA	NA	NA	NA	NA
AYP98780.1|1170960_1171509_+	DNA-binding protein	NA	NA	NA	NA	NA
AYP98781.1|1171486_1172134_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AYP98782.1|1172234_1172714_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98783.1|1175465_1176119_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AYP98784.1|1176518_1177376_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYP98879.1|1177340_1178639_-	purine permease	NA	Q9KX94	Enterobacteria_phage	29.1	1.9e-25
AYP98785.1|1178960_1179881_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
AYP98786.1|1179989_1180877_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AYP98787.1|1180933_1181743_+	DUF475 domain-containing protein	NA	S5MAL1	Bacillus_phage	44.0	3.4e-41
AYP98788.1|1182253_1183252_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	2.2e-50
AYP98789.1|1183307_1183745_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	71.7	6.3e-50
AYP98790.1|1183741_1184905_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	71.7	8.1e-161
>prophage 11
CP033371	Lactobacillus fermentum strain DR9 chromosome, complete genome	1285454	1209790	1272991	1285454	transposase	Streptococcus_phage(18.75%)	40	NA	NA
AYP98808.1|1209790_1210246_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	47.8	6.8e-31
AYP98809.1|1210319_1211570_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
AYP98810.1|1211762_1214159_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
AYP98811.1|1214523_1215912_-	amino acid permease	NA	NA	NA	NA	NA
AYP98812.1|1216012_1216429_+	NUDIX domain-containing protein	NA	A0A2H4UTN1	Bodo_saltans_virus	31.3	5.3e-06
AYP98813.1|1216428_1217037_+	guanylate kinase	NA	S4W1R9	Pandoravirus	34.5	5.8e-09
AYP98814.1|1217053_1217503_+	transcriptional repressor	NA	NA	NA	NA	NA
AYP98815.1|1217590_1218052_+	hypothetical protein	NA	NA	NA	NA	NA
AYP98816.1|1219233_1220277_-	galactose mutarotase	NA	NA	NA	NA	NA
AYP98817.1|1220487_1221039_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYP98818.1|1223970_1224855_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	24.5	2.4e-11
AYP98819.1|1226670_1227921_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.0e-56
AYP98820.1|1227999_1228452_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
AYP98821.1|1228640_1228889_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98822.1|1229256_1230609_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AYP98823.1|1232971_1233802_-	YbgC/FadM family acyl-CoA thioesterase	NA	NA	NA	NA	NA
AYP98824.1|1237557_1239753_+	hypothetical protein	NA	NA	NA	NA	NA
AYP98883.1|1239954_1240383_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	65.2	1.9e-46
AYP98825.1|1240404_1241571_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	73.8	9.6e-162
AYP98826.1|1241690_1243568_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98827.1|1243560_1244133_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYP98828.1|1248481_1249258_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
AYP98829.1|1249261_1249735_-	FMN-binding protein	NA	NA	NA	NA	NA
AYP98830.1|1249951_1251937_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.3	7.1e-32
AYP98831.1|1252023_1252692_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYP98884.1|1253889_1254792_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	31.2	7.5e-21
AYP98832.1|1254855_1255176_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98833.1|1255261_1255948_-	arginase family protein	NA	NA	NA	NA	NA
AYP98834.1|1256111_1257065_-	nitronate monooxygenase	NA	NA	NA	NA	NA
AYP98835.1|1257133_1257454_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AYP98836.1|1257501_1258074_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
AYP98837.1|1258284_1259046_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
AYP98838.1|1258985_1259192_-	hypothetical protein	NA	NA	NA	NA	NA
AYP98839.1|1261412_1262771_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AYP98840.1|1263568_1264480_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	31.2	7.6e-21
AYP98841.1|1264416_1265130_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	34.4	4.8e-23
AYP98842.1|1265216_1265531_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AYP98885.1|1265880_1267749_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.2	6.0e-97
AYP98843.1|1269072_1269627_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	45.6	3.5e-37
AYP98844.1|1272085_1272991_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	2.3e-14
>prophage 1
CP033372	Lactobacillus fermentum strain DR9 plasmid unnamed1, complete sequence	759694	120295	253075	759694	transposase,tRNA,protease	Streptococcus_phage(15.62%)	113	NA	NA
AYP98972.1|120295_122800_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	39.8	1.1e-125
AYP98973.1|122985_123582_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYP98974.1|123797_127379_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.6	2.0e-53
AYP98975.1|131132_131861_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
AYP98976.1|132015_133191_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
AYP99442.1|133377_134085_-	prepilin peptidase	NA	NA	NA	NA	NA
AYP98977.1|134296_134710_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
AYP98978.1|135328_137413_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.2	7.9e-66
AYP98979.1|137801_138110_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
AYP98980.1|138159_138822_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
AYP98981.1|138840_139464_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
AYP98982.1|139463_139757_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
AYP98983.1|139782_140628_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
AYP98984.1|140668_140950_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
AYP98985.1|140966_141314_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
AYP98986.1|141326_141986_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
AYP98987.1|142039_142426_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
AYP98988.1|142415_142622_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
AYP98989.1|142644_142911_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
AYP98990.1|142971_143340_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
AYP98991.1|143713_144256_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
AYP98992.1|144272_144458_+	30S ribosomal protein S14 type Z	NA	NA	NA	NA	NA
AYP98993.1|144490_144889_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
AYP98994.1|145506_145863_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
AYP98995.1|145885_146395_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
AYP98996.1|146408_146591_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
AYP98997.1|146622_147057_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
AYP98998.1|147057_148356_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
AYP98999.1|148377_149037_+	adenylate kinase	NA	NA	NA	NA	NA
AYP99000.1|149178_149397_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AYP99001.1|149434_149551_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
AYP99002.1|149576_149942_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
AYP99003.1|149973_150363_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
AYP99004.1|150445_151390_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
AYP99005.1|151422_151803_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
AYP99006.1|151993_152830_+	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	32.6	2.6e-20
AYP99007.1|152870_153668_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.2	8.4e-16
AYP99008.1|153660_154464_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AYP99009.1|154479_155256_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AYP99010.1|155362_155806_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AYP99011.1|155819_156215_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AYP99012.1|156463_157753_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.7	2.1e-48
AYP99443.1|158585_158993_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	61.8	2.2e-44
AYP99013.1|158982_160158_+|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	55.2	8.9e-115
AYP99014.1|160546_161161_+	N-acetylmuramidase	NA	S5M633	Brevibacillus_phage	51.7	2.9e-32
AYP99015.1|161781_162936_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
AYP99016.1|168715_169036_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
AYP99017.1|169035_170499_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
AYP99018.1|170513_171938_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
AYP99019.1|171950_172964_+	diacylglycerol kinase	NA	NA	NA	NA	NA
AYP99020.1|173072_174446_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	51.5	8.7e-130
AYP99444.1|174819_175518_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	31.7	5.2e-22
AYP99021.1|175454_176363_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	26.9	8.9e-14
AYP99022.1|176447_176960_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYP99023.1|177352_178711_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AYP99024.1|179731_180028_+|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	97.2	2.6e-31
AYP99025.1|180068_180758_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.2	7.5e-122
AYP99026.1|180787_181696_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	32.3	3.4e-05
AYP99445.1|181632_182331_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	31.7	5.2e-22
AYP99027.1|186453_187239_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AYP99028.1|188658_189720_+	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
AYP99029.1|190207_191398_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.7e-42
AYP99030.1|191657_192635_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AYP99031.1|195196_196117_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.8	5.1e-49
AYP99032.1|196502_196790_+|transposase	transposase	transposase	NA	NA	NA	NA
AYP99446.1|197764_198463_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	31.7	5.2e-22
AYP99033.1|198399_199308_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	26.9	8.9e-14
AYP99034.1|201198_202086_-	sugar transporter	NA	NA	NA	NA	NA
AYP99035.1|203291_204815_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	3.9e-38
AYP99036.1|204882_205239_-	IS66 family insertion sequence hypothetical protein	NA	S5WJH4	Leptospira_phage	43.8	4.4e-09
AYP99037.1|205228_205423_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99038.1|205475_206207_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	30.1	6.7e-12
AYP99039.1|206294_207653_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AYP99040.1|208838_209705_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	47.1	2.7e-60
AYP99041.1|211362_211503_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99042.1|211514_211766_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AYP99043.1|211780_212323_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AYP99044.1|212349_212535_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
AYP99045.1|212546_213107_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
AYP99447.1|214087_214339_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYP99046.1|214523_215645_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AYP99047.1|216049_217189_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.6	1.4e-43
AYP99048.1|217354_218263_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	26.9	8.9e-14
AYP99049.1|219016_220237_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.1e-95
AYP99050.1|220435_220765_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99051.1|220761_221349_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99052.1|222012_223053_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AYP99053.1|223125_223365_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99054.1|226155_226662_+|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AYP99055.1|226701_228264_+	copper oxidase	NA	NA	NA	NA	NA
AYP99056.1|228276_228645_+	DUF1304 family protein	NA	NA	NA	NA	NA
AYP99057.1|228806_229250_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AYP99058.1|229252_229825_+	diguanylate cyclase	NA	NA	NA	NA	NA
AYP99059.1|230719_230941_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99060.1|230957_231551_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYP99061.1|231641_232160_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	46.2	2.1e-31
AYP99062.1|232191_232563_-	MFS transporter	NA	NA	NA	NA	NA
AYP99063.1|233567_234116_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYP99064.1|234338_235598_+	transcriptional regulator	NA	NA	NA	NA	NA
AYP99065.1|236070_236631_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99066.1|236711_237179_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
AYP99067.1|239128_240109_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	1.6e-40
AYP99068.1|240922_241702_+	flavoprotein	NA	NA	NA	NA	NA
AYP99069.1|241816_243325_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AYP99070.1|245197_245563_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
AYP99071.1|245728_246739_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AYP99072.1|246798_248070_+	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	27.3	1.3e-34
AYP99073.1|248397_248487_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99074.1|248724_249159_-	GtrA family protein	NA	NA	NA	NA	NA
AYP99075.1|249168_249615_-	flavodoxin	NA	NA	NA	NA	NA
AYP99076.1|249727_250588_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
AYP99077.1|251293_251746_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
AYP99078.1|251824_253075_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.2	9.0e-57
>prophage 2
CP033372	Lactobacillus fermentum strain DR9 plasmid unnamed1, complete sequence	759694	269867	350542	759694	transposase,tRNA	Streptococcus_phage(25.0%)	48	NA	NA
AYP99091.1|269867_271088_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.0	3.1e-94
AYP99448.1|271428_272127_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	31.3	4.0e-22
AYP99092.1|275409_276348_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99093.1|276391_276997_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99094.1|277056_277980_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.8	6.2e-31
AYP99095.1|280036_280276_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99096.1|283363_284473_+	AI-2E family transporter	NA	NA	NA	NA	NA
AYP99097.1|284555_285539_+	glycosyltransferase	NA	A0A075B8F6	Enterobacteria_phage	34.6	4.6e-48
AYP99449.1|287375_288407_+	galactofuranosyltransferase	NA	NA	NA	NA	NA
AYP99450.1|288424_289333_+	glycosyltransferase	NA	NA	NA	NA	NA
AYP99098.1|291148_292081_+	dTDP-glucose 4,6-dehydratase	NA	M1I5F1	Acanthocystis_turfacea_Chlorella_virus	40.2	1.3e-57
AYP99099.1|293436_294135_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99100.1|294467_294941_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.2e-32
AYP99101.1|295019_296270_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	9.0e-57
AYP99102.1|296782_298024_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
AYP99103.1|298105_298990_-	DMT family transporter	NA	NA	NA	NA	NA
AYP99104.1|300653_301247_+	ECF transporter S component	NA	NA	NA	NA	NA
AYP99105.1|301533_302961_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.7	2.3e-96
AYP99106.1|302953_303529_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	35.8	4.4e-27
AYP99107.1|303655_304363_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AYP99108.1|307023_307266_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99109.1|307395_307662_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AYP99110.1|310821_311847_+	glycosyltransferase	NA	NA	NA	NA	NA
AYP99111.1|311848_312868_+	UPF0104 family protein	NA	NA	NA	NA	NA
AYP99112.1|313200_313449_+	DUF1797 family protein	NA	NA	NA	NA	NA
AYP99113.1|319911_320292_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99114.1|320604_320736_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99115.1|320836_321274_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	71.7	6.3e-50
AYP99116.1|322560_322746_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99117.1|323010_323832_+	glutamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYP99118.1|323854_324538_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYP99119.1|327658_328531_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99120.1|328682_330020_+	purine permease	NA	NA	NA	NA	NA
AYP99121.1|331438_331651_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99122.1|331706_332570_+	LysM domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	67.2	2.8e-17
AYP99123.1|332723_333227_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AYP99124.1|333438_333876_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AYP99125.1|334030_334675_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYP99126.1|335239_336490_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.2	2.8e-58
AYP99127.1|336797_337040_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99128.1|340264_341698_+	MFS transporter	NA	NA	NA	NA	NA
AYP99129.1|341736_342273_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
AYP99130.1|342366_343098_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99131.1|343291_344479_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.6	7.8e-143
AYP99132.1|344755_345553_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	38.7	1.0e-42
AYP99133.1|345555_346797_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	55.1	1.9e-107
AYP99134.1|347055_347787_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AYP99135.1|348124_350542_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	67.1	0.0e+00
>prophage 3
CP033372	Lactobacillus fermentum strain DR9 plasmid unnamed1, complete sequence	759694	408943	553035	759694	transposase,tRNA,protease	Paenibacillus_phage(19.44%)	98	NA	NA
AYP99189.1|408943_409990_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.1	4.7e-27
AYP99190.1|409995_412434_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AYP99191.1|413289_413766_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AYP99192.1|416648_418733_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
AYP99193.1|418875_419025_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AYP99194.1|419248_419800_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
AYP99195.1|419806_420472_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AYP99196.1|420468_420705_+	DUF910 family protein	NA	NA	NA	NA	NA
AYP99197.1|420722_421685_+	ROK family protein	NA	NA	NA	NA	NA
AYP99198.1|421709_422129_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AYP99199.1|422308_422485_-	DUF3042 family protein	NA	NA	NA	NA	NA
AYP99200.1|423705_425058_+	type I glutamate--ammonia ligase	NA	A0A0G2Y5U6	Acanthamoeba_polyphaga_mimivirus	25.6	1.9e-12
AYP99201.1|425627_426524_+	exonuclease SbcC	NA	NA	NA	NA	NA
AYP99202.1|426516_427485_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99203.1|427477_428011_+	dUTPase	NA	NA	NA	NA	NA
AYP99204.1|428762_429404_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYP99205.1|429567_429876_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
AYP99206.1|430234_430516_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
AYP99207.1|430601_431678_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	31.7	7.1e-10
AYP99208.1|431768_432209_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AYP99209.1|432208_432628_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
AYP99210.1|432805_433663_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	38.9	8.4e-38
AYP99211.1|433663_435112_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	30.7	2.8e-33
AYP99212.1|435111_435405_+	exodeoxyribonuclease 7 small subunit	NA	NA	NA	NA	NA
AYP99213.1|435404_436280_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
AYP99214.1|437117_437567_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
AYP99215.1|437584_439279_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AYP99216.1|439370_439688_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99217.1|439880_440501_+	guanylate kinase	NA	A0A212Q4J6	Cowpox_virus	29.0	2.2e-19
AYP99218.1|440497_440782_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AYP99219.1|444495_445446_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	32.7	1.5e-11
AYP99220.1|447541_449464_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	G9BWE0	Planktothrix_phage	29.6	9.4e-21
AYP99221.1|450386_451040_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AYP99222.1|451107_451767_+	thiamine diphosphokinase	NA	NA	NA	NA	NA
AYP99223.1|451887_452076_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AYP99224.1|452222_452585_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AYP99225.1|452612_454307_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
AYP99226.1|454371_456408_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
AYP99227.1|456420_457458_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
AYP99228.1|457500_457746_+	acyl carrier protein	NA	NA	NA	NA	NA
AYP99229.1|457892_458591_+	ribonuclease 3	NA	L7RCJ8	Acanthamoeba_polyphaga_moumouvirus	33.2	1.2e-21
AYP99230.1|463727_464069_+	putative DNA-binding protein	NA	NA	NA	NA	NA
AYP99231.1|467435_468782_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AYP99232.1|469022_469946_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.7	1.4e-30
AYP99233.1|471826_472021_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99234.1|472010_472367_+	IS66 family insertion sequence hypothetical protein	NA	S5WJH4	Leptospira_phage	43.8	4.4e-09
AYP99235.1|474941_475820_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	5.2e-43
AYP99236.1|475843_476131_-|transposase	transposase	transposase	NA	NA	NA	NA
AYP99237.1|476195_477416_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	6.2e-95
AYP99238.1|479581_480490_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	26.9	8.9e-14
AYP99239.1|480763_481468_-	winged helix family transcriptional regulator	NA	W8CYM9	Bacillus_phage	28.6	9.6e-16
AYP99240.1|481773_482637_+	phosphate ABC transporter substrate-binding protein	NA	H6WG65	Cyanophage	31.2	3.3e-10
AYP99241.1|482636_483536_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AYP99242.1|483537_484419_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
AYP99243.1|485202_485907_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
AYP99244.1|486036_486312_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AYP99245.1|486326_486587_+	KH domain-containing protein	NA	NA	NA	NA	NA
AYP99246.1|489481_489841_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AYP99247.1|490070_493421_+	CRISPR-associated helicase Cas3'	NA	NA	NA	NA	NA
AYP99248.1|493300_494458_+	type I-E CRISPR-associated protein Cse1/CasA	NA	NA	NA	NA	NA
AYP99249.1|494474_495059_+	CRISPR-associated protein CasB	NA	NA	NA	NA	NA
AYP99250.1|495070_496168_+	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
AYP99251.1|496148_496856_+	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
AYP99252.1|496868_497525_+	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
AYP99253.1|498097_499318_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	1.4e-94
AYP99254.1|499805_500684_+	type I-E CRISPR-associated endoribonuclease Cas2	NA	A0A0K2SUJ2	Clostridium_phage	30.6	5.2e-11
AYP99255.1|503421_504144_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
AYP99256.1|506454_506649_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99257.1|508058_509423_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.0	9.9e-09
AYP99258.1|509402_509525_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYP99259.1|509551_510481_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	29.8	6.7e-25
AYP99260.1|510559_510751_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99261.1|510877_512407_+	copper oxidase	NA	NA	NA	NA	NA
AYP99262.1|512446_513820_+	MFS transporter	NA	NA	NA	NA	NA
AYP99263.1|513951_514644_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYP99264.1|514568_515519_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	30.7	6.9e-17
AYP99265.1|515800_516730_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	3.0e-25
AYP99266.1|517003_518842_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	28.9	3.4e-68
AYP99267.1|519707_520631_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	8.7e-33
AYP99268.1|521966_522215_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AYP99269.1|523140_523851_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.3e-49
AYP99270.1|523847_525068_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	6.2e-95
AYP99271.1|526157_527186_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	3.8e-45
AYP99272.1|528850_529762_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	31.2	7.6e-21
AYP99273.1|529890_531630_-	pyruvate oxidase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	26.6	9.6e-33
AYP99274.1|532260_533595_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AYP99275.1|534081_535854_+	oleate hydratase	NA	NA	NA	NA	NA
AYP99276.1|536030_536258_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYP99277.1|537186_538407_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	8.1e-95
AYP99278.1|538533_540057_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	3.9e-38
AYP99279.1|540125_540482_-	IS66 family insertion sequence hypothetical protein	NA	S5WJH4	Leptospira_phage	43.8	4.4e-09
AYP99280.1|540471_540666_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99281.1|541337_542084_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
AYP99282.1|542097_542382_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99283.1|548724_549180_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.0	8.1e-32
AYP99284.1|549462_549738_+	hypothetical protein	NA	A0A0N9STL0	Staphylococcus_phage	37.8	1.7e-08
AYP99285.1|549752_550973_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.1e-95
AYP99451.1|551991_553035_+|transposase	transposase	transposase	A0A286QMQ9	Streptococcus_phage	39.5	7.0e-55
>prophage 4
CP033372	Lactobacillus fermentum strain DR9 plasmid unnamed1, complete sequence	759694	580073	647825	759694	transposase	Paenibacillus_phage(30.77%)	48	NA	NA
AYP99299.1|580073_581324_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.3	2.4e-57
AYP99300.1|581397_581853_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.0	8.1e-32
AYP99301.1|582091_583570_-	amidase	NA	NA	NA	NA	NA
AYP99302.1|584366_584525_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99303.1|584909_586130_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	8.1e-95
AYP99304.1|586792_587080_-|transposase	transposase	transposase	NA	NA	NA	NA
AYP99305.1|587201_587900_+	glycosyltransferase	NA	NA	NA	NA	NA
AYP99306.1|587986_588676_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYP99307.1|588889_589753_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYP99308.1|589986_590577_+	nitroreductase family protein	NA	NA	NA	NA	NA
AYP99309.1|590745_591147_-	reverse transcriptase-like protein	NA	NA	NA	NA	NA
AYP99310.1|591159_591594_+	VPDSG-CTERM exosortase interaction domain protein	NA	NA	NA	NA	NA
AYP99311.1|591593_592031_+	signal peptidase II	NA	NA	NA	NA	NA
AYP99452.1|592071_592947_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.0	1.6e-07
AYP99312.1|592976_594059_+	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
AYP99313.1|596756_597392_-	carbonic anhydrase family protein	NA	NA	NA	NA	NA
AYP99314.1|598990_600241_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.2	9.0e-57
AYP99315.1|600395_602102_-	fibronectin/fibrinogen-binding protein	NA	M1I5P2	Paramecium_bursaria_Chlorella_virus	36.2	2.5e-09
AYP99316.1|602292_603171_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	38.2	1.2e-15
AYP99317.1|603167_603779_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99318.1|604046_604790_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
AYP99319.1|604786_605443_-	HD domain-containing protein	NA	A0A1S5V2G8	Saudi_moumouvirus	27.9	1.7e-06
AYP99320.1|606306_606831_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYP99321.1|607931_609209_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
AYP99322.1|610840_611299_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99323.1|611319_611544_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99324.1|612149_612470_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AYP99325.1|612820_613912_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
AYP99326.1|614908_616198_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
AYP99327.1|616204_617611_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.0	3.3e-47
AYP99328.1|617639_618659_+	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	30.4	4.5e-14
AYP99329.1|620661_620883_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99330.1|620871_622098_-	MFS transporter	NA	NA	NA	NA	NA
AYP99331.1|622284_623673_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
AYP99332.1|623838_625080_-	MFS transporter	NA	NA	NA	NA	NA
AYP99333.1|626742_627606_+	metallophosphoesterase	NA	NA	NA	NA	NA
AYP99334.1|627708_627978_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
AYP99335.1|628146_629460_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AYP99336.1|630371_631784_+	C69 family dipeptidase	NA	NA	NA	NA	NA
AYP99337.1|631892_633764_+	potassium transporter	NA	NA	NA	NA	NA
AYP99338.1|633789_634014_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AYP99339.1|634099_634813_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	34.4	4.8e-23
AYP99340.1|634749_635661_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	31.2	7.6e-21
AYP99341.1|637268_637715_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99342.1|640132_640399_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99343.1|640449_640725_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99344.1|643938_644175_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99345.1|646604_647825_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	8.1e-95
>prophage 5
CP033372	Lactobacillus fermentum strain DR9 plasmid unnamed1, complete sequence	759694	704183	748240	759694	integrase,transposase	Lactobacillus_phage(25.0%)	42	720159:720177	729873:729891
AYP99393.1|704183_704627_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	52.0	3.5e-32
AYP99394.1|706290_707256_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99395.1|707265_707694_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99396.1|709231_710740_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AYP99397.1|711040_711574_+	VanZ family protein	NA	NA	NA	NA	NA
AYP99398.1|711776_712964_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AYP99399.1|713224_713566_-	Fe-S cluster assembly protein HesB	NA	NA	NA	NA	NA
AYP99400.1|713578_714583_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AYP99401.1|714709_716056_-	gluconate permease	NA	NA	NA	NA	NA
AYP99402.1|716077_717598_-	gluconate kinase	NA	NA	NA	NA	NA
AYP99403.1|717798_718740_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
AYP99404.1|718986_719193_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99405.1|719201_719480_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99406.1|719515_720004_+	hypothetical protein	NA	NA	NA	NA	NA
720159:720177	attL	AATTGGGGTCAAATTGGGG	NA	NA	NA	NA
AYP99407.1|721154_721523_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99408.1|722077_722284_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99409.1|722283_722568_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99410.1|722567_722795_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99411.1|722809_723154_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99412.1|723158_723509_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99413.1|723813_725394_-	DNA primase	NA	B0YL90	Streptococcus_virus	33.9	3.5e-58
AYP99414.1|726284_726500_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99415.1|726944_727211_-	DNA-binding protein	NA	NA	NA	NA	NA
AYP99416.1|727222_727408_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYP99417.1|728757_729861_+|integrase	site-specific integrase	integrase	E9LUK6	Lactobacillus_phage	43.8	1.1e-79
AYP99418.1|730458_730917_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
729873:729891	attR	AATTGGGGTCAAATTGGGG	NA	NA	NA	NA
AYP99419.1|730943_731222_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99420.1|731293_732199_+	ROK family protein	NA	NA	NA	NA	NA
AYP99421.1|732359_733610_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
AYP99422.1|733700_734141_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	48.6	1.7e-31
AYP99423.1|734483_735182_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AYP99424.1|735244_736960_-	AarF/ABC1/UbiB kinase family protein	NA	A9YVW0	Ostreococcus_tauri_virus	27.5	1.5e-33
AYP99425.1|737233_737791_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYP99426.1|737865_738294_-	VOC family protein	NA	NA	NA	NA	NA
AYP99427.1|738742_739075_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	39.1	5.7e-11
AYP99428.1|741457_742678_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	6.2e-95
AYP99429.1|742911_743631_+	glycosyltransferase	NA	A0A1V0SL98	Klosneuvirus	34.9	3.7e-07
AYP99430.1|743938_744133_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99431.1|744122_744479_+	IS66 family insertion sequence hypothetical protein	NA	S5WJH4	Leptospira_phage	43.8	4.4e-09
AYP99432.1|746093_746303_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99433.1|746292_746649_+	IS66 family insertion sequence hypothetical protein	NA	S5WJH4	Leptospira_phage	43.8	4.4e-09
AYP99434.1|746716_748240_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	29.1	1.3e-38
>prophage 1
CP033373	Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence	251760	2303	75545	251760	integrase,transposase	Staphylococcus_phage(17.65%)	45	24538:24555	77145:77162
AYP99458.1|2303_2987_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.2	1.6e-31
AYP99459.1|3180_4467_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.0	3.0e-47
AYP99460.1|4699_5611_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
AYP99461.1|5813_6821_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
AYP99462.1|10007_10721_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
AYP99463.1|11876_12812_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AYP99464.1|12804_13584_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AYP99465.1|15993_17334_+	ATPase	NA	NA	NA	NA	NA
AYP99466.1|18703_19525_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AYP99467.1|20856_21084_-	DUF2929 family protein	NA	NA	NA	NA	NA
AYP99468.1|21174_24474_+	DNA polymerase III subunit alpha	NA	A0A0K1Y9G6	Streptomyces_phage	32.2	2.8e-142
24538:24555	attL	AAAAGGTGCTATGATAGG	NA	NA	NA	NA
AYP99469.1|24611_26033_+	pyruvate kinase	NA	NA	NA	NA	NA
AYP99470.1|26188_27076_+	DNA-binding protein	NA	NA	NA	NA	NA
AYP99471.1|27926_28310_+	reductase	NA	NA	NA	NA	NA
AYP99472.1|29651_30377_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
AYP99473.1|31427_32492_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99474.1|32481_33939_+	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	38.7	6.8e-56
AYP99475.1|34576_35257_+	(d)CMP kinase	NA	NA	NA	NA	NA
AYP99476.1|35333_36566_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
AYP99477.1|38181_38457_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	68.5	3.4e-25
AYP99478.1|38537_39800_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99479.1|45074_45578_+	dihydrofolate reductase	NA	A0A1Y0SUI9	Pseudomonas_phage	36.0	5.4e-21
AYP99480.1|45557_46187_-	hemolysin III family protein	NA	NA	NA	NA	NA
AYP99481.1|47328_48507_-	3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	36.8	8.7e-62
AYP99482.1|48576_49203_+	chloramphenicol acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	40.8	4.0e-13
AYP99483.1|49333_50251_+	GDSL family lipase	NA	NA	NA	NA	NA
AYP99484.1|50857_51082_+	YozE family protein	NA	NA	NA	NA	NA
AYP99485.1|51531_51795_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99486.1|51866_52226_+	ArsR family transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	42.3	8.1e-19
AYP99487.1|52212_52575_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AYP99488.1|52620_53841_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.1e-95
AYP99489.1|57490_58786_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	63.3	2.8e-146
AYP99490.1|58802_59132_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99491.1|59154_59454_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AYP99492.1|60740_61880_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.6	1.4e-43
AYP99493.1|62864_63890_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.1	1.3e-42
AYP99494.1|64723_65092_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AYP99495.1|65093_65708_+	cadmium transporter	NA	NA	NA	NA	NA
AYP99496.1|65732_66287_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYP99497.1|66720_67941_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	38.9	3.8e-76
AYP99498.1|68061_68313_+	DNA-binding protein	NA	A0A1X9IGE0	Lactococcus_phage	51.5	1.8e-12
AYP99499.1|69796_70669_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
AYP99500.1|70661_71432_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	33.5	6.0e-19
AYP99501.1|71484_72360_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	34.5	1.1e-21
AYP99502.1|74648_75545_+|integrase	integrase	integrase	NA	NA	NA	NA
77145:77162	attR	CCTATCATAGCACCTTTT	NA	NA	NA	NA
>prophage 2
CP033373	Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence	251760	130553	181014	251760	integrase,transposase	Lactobacillus_phage(38.46%)	39	123402:123417	169002:169017
123402:123417	attL	AGGTCGGTCGTGACCG	NA	NA	NA	NA
AYP99543.1|130553_131174_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	35.3	2.3e-21
AYP99544.1|135050_135542_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	34.7	2.3e-16
AYP99545.1|135538_136759_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	2.1e-95
AYP99546.1|137493_138462_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AYP99547.1|138768_139152_-	PaaI family thioesterase	NA	NA	NA	NA	NA
AYP99548.1|140018_141443_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.9	1.4e-69
AYP99549.1|141491_142490_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.3e-50
AYP99550.1|142612_143806_+	MFS transporter	NA	NA	NA	NA	NA
AYP99551.1|144032_145103_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
AYP99552.1|146482_147394_-	PLP-dependent cysteine synthase family protein	NA	A0A1X9I5K7	Streptococcus_phage	40.8	5.4e-59
AYP99553.1|147734_148001_+	ACT domain-containing protein	NA	NA	NA	NA	NA
AYP99554.1|148010_149354_+	PFL family protein	NA	NA	NA	NA	NA
AYP99555.1|149544_150501_-	WYL domain-containing protein	NA	NA	NA	NA	NA
AYP99556.1|150557_150950_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
AYP99634.1|151171_151372_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99557.1|152566_152929_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99558.1|153002_153920_-	EamA family transporter	NA	NA	NA	NA	NA
AYP99559.1|154162_154747_+	DUF4352 domain-containing protein	NA	A0A0P0IXE0	Lactobacillus_phage	69.2	3.9e-47
AYP99560.1|154852_156706_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	60.4	9.8e-209
AYP99561.1|156822_157758_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	43.2	2.5e-64
AYP99562.1|157855_158713_+	patatin family protein	NA	NA	NA	NA	NA
AYP99563.1|158807_159980_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
AYP99564.1|159989_161090_+	AI-2E family transporter	NA	NA	NA	NA	NA
AYP99565.1|161169_161910_+	sulfite exporter TauE/SafE family protein	NA	Q6EVM7	Oenoccocus_phage	40.6	1.3e-47
AYP99566.1|162103_162601_-	phosphatidylglycerophosphatase A	NA	A0A291I9Q0	Lactobacillus_phage	54.3	1.8e-45
AYP99567.1|162613_163666_-	class A beta-lactamase-related serine hydrolase	NA	NA	NA	NA	NA
AYP99568.1|163662_164862_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99569.1|165061_165919_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYP99570.1|166057_168406_-	ATP-binding protein	NA	NA	NA	NA	NA
AYP99571.1|168793_169681_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
169002:169017	attR	CGGTCACGACCGACCT	NA	NA	NA	NA
AYP99572.1|169771_170659_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
AYP99573.1|170733_172104_-	C69 family dipeptidase	NA	NA	NA	NA	NA
AYP99574.1|172103_172835_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99575.1|173020_173965_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.2	1.2e-40
AYP99576.1|174041_175427_-	amino acid permease	NA	NA	NA	NA	NA
AYP99577.1|175701_176658_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AYP99578.1|176974_178753_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AYP99579.1|178912_180148_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
AYP99580.1|180555_181014_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	53.0	8.7e-34
>prophage 1
CP033375	Lactobacillus fermentum strain DR9 plasmid unnamed4, complete sequence	27672	0	8384	27672	transposase	Leptospira_phage(75.0%)	8	NA	NA
AYP99659.1|199_370_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYP99638.1|481_1276_-	acetoin reductase	NA	NA	NA	NA	NA
AYP99639.1|3007_4228_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	8.1e-95
AYP99640.1|4262_4754_-	hypothetical protein	NA	NA	NA	NA	NA
AYP99641.1|4801_4996_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99642.1|4985_5342_+	IS66 family insertion sequence hypothetical protein	NA	S5WJH4	Leptospira_phage	43.8	4.4e-09
AYP99643.1|5409_6936_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	29.3	2.5e-37
AYP99644.1|8027_8384_+	IS66 family insertion sequence hypothetical protein	NA	S5WJH4	Leptospira_phage	43.8	4.4e-09
>prophage 2
CP033375	Lactobacillus fermentum strain DR9 plasmid unnamed4, complete sequence	27672	11398	16968	27672	transposase	Leptospira_phage(40.0%)	7	NA	NA
AYP99660.1|11398_12097_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	31.7	5.2e-22
AYP99646.1|12033_12942_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	26.9	8.9e-14
AYP99647.1|13173_13419_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99648.1|13420_13834_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	37.6	2.0e-05
AYP99649.1|14836_15031_+	hypothetical protein	NA	NA	NA	NA	NA
AYP99650.1|15020_15377_+	IS66 family insertion sequence hypothetical protein	NA	S5WJH4	Leptospira_phage	43.8	4.4e-09
AYP99651.1|15444_16968_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	3.9e-38
>prophage 3
CP033375	Lactobacillus fermentum strain DR9 plasmid unnamed4, complete sequence	27672	21647	23404	27672	integrase	Bacillus_phage(50.0%)	2	15990:16001	22796:22807
15990:16001	attL	GATTATCTCTAA	NA	NA	NA	NA
AYP99661.1|21647_22559_+|integrase	integrase	integrase	A0A142F1N9	Bacillus_phage	25.8	7.3e-16
AYP99655.1|22618_23404_+	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	32.5	8.0e-19
22796:22807	attR	TTAGAGATAATC	NA	NA	NA	NA
