The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033340	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN076214 chromosome, complete genome	4668874	1414589	1420649	4668874		Salmonella_virus(50.0%)	6	NA	NA
AYP76176.1|1414589_1414841_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	68.6	7.6e-08
AYP76177.1|1414779_1414923_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
AYP76178.1|1415912_1417835_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
AYP76179.1|1417852_1418107_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
AYP79202.1|1418075_1418465_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
AYP76180.1|1419707_1420649_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
>prophage 2
CP033340	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN076214 chromosome, complete genome	4668874	1657080	1666251	4668874	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYP76400.1|1657080_1658028_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
AYP76401.1|1658011_1658743_+	ABC transporter permease	NA	NA	NA	NA	NA
AYP76402.1|1658723_1658831_-	protein YohO	NA	NA	NA	NA	NA
AYP76403.1|1658890_1659622_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
AYP76404.1|1659844_1661530_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
AYP76405.1|1661526_1662246_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYP76406.1|1662292_1662760_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
AYP76407.1|1662816_1663347_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AYP76408.1|1663518_1663977_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
AYP76409.1|1664217_1666251_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 3
CP033340	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN076214 chromosome, complete genome	4668874	1733448	1743955	4668874		Enterobacteria_phage(37.5%)	10	NA	NA
AYP76464.1|1733448_1734852_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
AYP76465.1|1735029_1735923_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYP76466.1|1736299_1737385_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYP76467.1|1737384_1738284_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
AYP79211.1|1738331_1739210_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
AYP76468.1|1739210_1739762_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
AYP76469.1|1739767_1740742_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AYP76470.1|1740757_1741531_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYP76471.1|1741535_1742615_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
AYP76472.1|1742641_1743955_+	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
CP033340	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN076214 chromosome, complete genome	4668874	1858685	1869655	4668874	lysis,integrase,terminase	Salmonella_phage(54.55%)	13	1856579:1856592	1865590:1865603
1856579:1856592	attL	TTAATACTTCTTTC	NA	NA	NA	NA
AYP76582.1|1858685_1860587_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	43.1	3.0e-136
AYP76583.1|1860738_1862037_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	38.2	6.2e-69
AYP76584.1|1862701_1862992_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	1.2e-07
AYP76585.1|1863363_1864161_-	protein MtfA	NA	NA	NA	NA	NA
AYP76586.1|1864452_1865442_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
AYP76587.1|1865443_1865686_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
1865590:1865603	attR	TTAATACTTCTTTC	NA	NA	NA	NA
AYP76588.1|1865710_1866280_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
AYP76589.1|1866283_1867117_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	99.6	4.0e-162
AYP76590.1|1867127_1867385_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	98.8	4.9e-42
AYP76591.1|1867435_1867810_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	91.7	8.9e-53
AYP76592.1|1868294_1868618_-	hypothetical protein	NA	NA	NA	NA	NA
AYP76593.1|1868668_1869058_+	HNH endonuclease	NA	K7P6U5	Enterobacteria_phage	72.1	1.4e-45
AYP76594.1|1869190_1869655_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.3e-48
>prophage 5
CP033340	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN076214 chromosome, complete genome	4668874	1979822	1989808	4668874	capsid,integrase	Salmonella_phage(50.0%)	12	1981139:1981152	1994045:1994058
AYP76706.1|1979822_1981073_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.1e-19
1981139:1981152	attL	TCTTCCCCAAAACT	NA	NA	NA	NA
AYP76707.1|1981186_1982329_-|integrase	integrase	integrase	O21929	Phage_21	79.7	4.5e-172
AYP76708.1|1982318_1982555_-	excisionase	NA	NA	NA	NA	NA
AYP79224.1|1982604_1983102_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	67.6	5.6e-18
AYP76709.1|1983433_1983973_-	HD family hydrolase	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
AYP76710.1|1984067_1984985_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	59.1	4.2e-96
AYP76711.1|1985272_1985503_+	hypothetical protein	NA	NA	NA	NA	NA
AYP76712.1|1985676_1985991_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	96.9	4.8e-52
AYP76713.1|1986040_1987114_+	hypothetical protein	NA	NA	NA	NA	NA
AYP76714.1|1987126_1987699_+	hypothetical protein	NA	NA	NA	NA	NA
AYP76715.1|1987787_1988177_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	71.8	8.1e-41
AYP76716.1|1988284_1989808_+|capsid	phage major capsid protein	capsid	A0A192Y5U9	Salmonella_phage	97.7	2.5e-234
1994045:1994058	attR	TCTTCCCCAAAACT	NA	NA	NA	NA
>prophage 6
CP033340	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN076214 chromosome, complete genome	4668874	2429403	2440190	4668874	tRNA	Escherichia_phage(72.73%)	15	NA	NA
AYP77140.1|2429403_2429940_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
AYP77141.1|2429936_2430227_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
AYP77142.1|2430226_2430826_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
AYP77143.1|2431349_2431562_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
AYP77144.1|2431931_2432864_+	hypothetical protein	NA	NA	NA	NA	NA
AYP77145.1|2432860_2433415_+	hypothetical protein	NA	NA	NA	NA	NA
AYP77146.1|2433576_2433906_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
AYP77147.1|2434178_2434646_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
AYP79239.1|2435030_2435186_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
AYP77148.1|2435293_2435815_-	hypothetical protein	NA	NA	NA	NA	NA
AYP77149.1|2436252_2436474_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
AYP77150.1|2436558_2436876_+	hypothetical protein	NA	NA	NA	NA	NA
AYP77151.1|2436903_2437521_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
AYP77152.1|2437837_2438773_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
AYP77153.1|2438816_2440190_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 7
CP033340	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN076214 chromosome, complete genome	4668874	2609193	2679311	4668874	tRNA,tail,integrase,protease,holin,lysis	Enterobacteria_phage(25.0%)	73	2659826:2659855	2679447:2679476
AYP77318.1|2609193_2609889_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AYP77319.1|2609946_2611857_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
AYP77320.1|2611987_2612332_+	RidA family protein	NA	NA	NA	NA	NA
AYP77321.1|2612337_2612517_-	YoaH family protein	NA	NA	NA	NA	NA
AYP77322.1|2612597_2613962_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	34.5	3.6e-43
AYP77323.1|2613965_2614544_+	coenzyme A pyrophosphatase	NA	NA	NA	NA	NA
AYP77324.1|2614807_2616172_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AYP77325.1|2616309_2617911_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AYP77326.1|2617932_2619492_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
AYP77327.1|2619479_2619815_-	hypothetical protein	NA	NA	NA	NA	NA
AYP77328.1|2619964_2620933_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AYP77329.1|2620985_2621786_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AYP77330.1|2621798_2622650_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AYP77331.1|2622708_2623167_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
AYP79249.1|2623522_2624143_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
AYP77332.1|2624139_2624949_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AYP77333.1|2625014_2626760_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
AYP77334.1|2626979_2627189_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AYP77335.1|2627201_2627345_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
AYP77336.1|2627993_2628281_-	hypothetical protein	NA	NA	NA	NA	NA
AYP77337.1|2628351_2628495_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
AYP77338.1|2628652_2628892_+	hypothetical protein	NA	NA	NA	NA	NA
AYP77339.1|2629103_2629895_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AYP77340.1|2630070_2631444_+	MFS transporter	NA	NA	NA	NA	NA
AYP77341.1|2631491_2632373_-|protease	protease HtpX	protease	NA	NA	NA	NA
AYP77342.1|2632567_2634616_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
AYP77343.1|2634635_2635322_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AYP77344.1|2635419_2636004_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AYP77345.1|2636045_2637329_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AYP77346.1|2637291_2639931_+	PqiB family protein	NA	NA	NA	NA	NA
AYP79250.1|2640008_2641448_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AYP77347.1|2641562_2641802_+	DUF1480 family protein	NA	NA	NA	NA	NA
AYP77348.1|2641912_2642104_+	DUF1482 family protein	NA	NA	NA	NA	NA
AYP77349.1|2642122_2642773_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
AYP77350.1|2642996_2643161_-	hypothetical protein	NA	NA	NA	NA	NA
AYP77351.1|2643445_2644168_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
AYP77352.1|2644851_2645247_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
AYP77353.1|2645576_2646053_+	hypothetical protein	NA	NA	NA	NA	NA
AYP77354.1|2646425_2646845_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYP77355.1|2646976_2647171_-	hypothetical protein	NA	NA	NA	NA	NA
AYP77356.1|2647217_2647487_+	hypothetical protein	NA	B6SCX2	Bacteriophage	47.9	3.1e-07
AYP77357.1|2647652_2647793_+	hypothetical protein	NA	NA	NA	NA	NA
AYP79251.1|2650113_2650314_-	hypothetical protein	NA	NA	NA	NA	NA
AYP77358.1|2650931_2651846_+	protein PagO	NA	NA	NA	NA	NA
AYP77359.1|2651978_2652137_+	hypothetical protein	NA	NA	NA	NA	NA
AYP77360.1|2652146_2652761_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
AYP77361.1|2653895_2654021_-	arsenic transporter	NA	NA	NA	NA	NA
AYP77362.1|2654283_2654400_+|tail	phage tail protein	tail	NA	NA	NA	NA
AYP77363.1|2654590_2654791_+	phage virulence factor	NA	NA	NA	NA	NA
AYP77364.1|2657492_2657984_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
AYP77365.1|2658038_2658227_+	hypothetical protein	NA	NA	NA	NA	NA
AYP77366.1|2658291_2658459_+	lytic enzyme	NA	NA	NA	NA	NA
AYP77367.1|2658715_2659249_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
AYP79252.1|2659315_2659699_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	37.4	2.7e-12
2659826:2659855	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
AYP77368.1|2660643_2661444_+	hypothetical protein	NA	NA	NA	NA	NA
AYP77369.1|2661923_2662646_+	guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
AYP77370.1|2663196_2664060_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
AYP77371.1|2666700_2667396_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
AYP77372.1|2667485_2668019_+	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AYP79254.1|2668913_2669393_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
AYP77373.1|2669410_2669863_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
AYP79253.1|2669846_2670176_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AYP77374.1|2670451_2671138_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
AYP77375.1|2671498_2671948_+	hypothetical protein	NA	NA	NA	NA	NA
AYP79255.1|2672321_2672846_-	hypothetical protein	NA	NA	NA	NA	NA
AYP77376.1|2672942_2673632_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
AYP77377.1|2673761_2673989_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
AYP77378.1|2673985_2674585_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
AYP77379.1|2674648_2674954_-	hypothetical protein	NA	NA	NA	NA	NA
AYP77380.1|2675376_2675568_+	hypothetical protein	NA	NA	NA	NA	NA
AYP77381.1|2675585_2677565_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
AYP77382.1|2677978_2678257_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
AYP77383.1|2678231_2679311_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
2679447:2679476	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 8
CP033340	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN076214 chromosome, complete genome	4668874	2851702	2892400	4668874	protease,tail	Salmonella_phage(28.57%)	40	NA	NA
AYP77565.1|2851702_2852383_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
AYP77566.1|2853001_2853661_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYP77567.1|2853747_2854077_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
AYP77568.1|2854073_2854355_-	acylphosphatase	NA	NA	NA	NA	NA
AYP77569.1|2854403_2855183_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYP77570.1|2855208_2855757_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AYP77571.1|2855971_2857183_+	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AYP77572.1|2857240_2857558_+	heat-shock protein HspQ	NA	NA	NA	NA	NA
AYP77573.1|2857602_2858019_-	CoA-binding protein	NA	NA	NA	NA	NA
AYP77574.1|2858189_2858852_+	DUF2057 family protein	NA	NA	NA	NA	NA
AYP77575.1|2858946_2859405_+	methylglyoxal synthase	NA	NA	NA	NA	NA
AYP77576.1|2859440_2861495_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
AYP77577.1|2861618_2862065_+	YccF domain-containing protein	NA	NA	NA	NA	NA
AYP77578.1|2862083_2864237_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AYP77579.1|2864223_2864829_-	DNA transformation protein	NA	NA	NA	NA	NA
AYP77580.1|2865045_2865555_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
AYP79265.1|2865911_2866964_+	outer membrane protein A	NA	NA	NA	NA	NA
AYP77581.1|2867035_2867488_-	macrodomain Ter protein	NA	NA	NA	NA	NA
AYP77582.1|2867673_2869434_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
AYP77583.1|2869502_2870021_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AYP77584.1|2870120_2870288_-	ribosome modulation factor	NA	NA	NA	NA	NA
AYP77585.1|2870543_2871107_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
AYP77586.1|2871103_2872744_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AYP77587.1|2872748_2874002_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
AYP77588.1|2874016_2875924_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
AYP77589.1|2875936_2878045_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
AYP77590.1|2878143_2879253_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYP77591.1|2879249_2879792_-	cell division protein ZapC	NA	NA	NA	NA	NA
AYP77592.1|2879957_2880968_-	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AYP77593.1|2881175_2883788_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
AYP77594.1|2884214_2884406_+	DinI family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
AYP77595.1|2884676_2885363_+	virulence protein	NA	NA	NA	NA	NA
AYP77596.1|2885722_2886349_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
AYP77597.1|2886996_2887965_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
AYP77598.1|2888190_2888439_+|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.8e-18
AYP77599.1|2888442_2889024_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
AYP77600.1|2889023_2890733_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
AYP77601.1|2890729_2891356_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
AYP77602.1|2891339_2891969_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
AYP77603.1|2891989_2892400_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
>prophage 9
CP033340	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN076214 chromosome, complete genome	4668874	2963718	2971031	4668874	protease,integrase	Ralstonia_phage(16.67%)	8	2958515:2958529	2969767:2969781
2958515:2958529	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYP77656.1|2963718_2964096_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
AYP77657.1|2964257_2964455_+	hypothetical protein	NA	NA	NA	NA	NA
AYP77658.1|2964667_2966944_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AYP77659.1|2966974_2967295_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYP77660.1|2967618_2967840_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYP77661.1|2967794_2967989_-	hypothetical protein	NA	NA	NA	NA	NA
AYP77662.1|2967969_2969916_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2969767:2969781	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
AYP77663.1|2969912_2971031_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 1
CP033342	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN076214 plasmid pCFSAN076214_2, complete sequence	56636	0	727	56636		Morganella_phage(100.0%)	1	NA	NA
AYP79415.1|304_727_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
>prophage 2
CP033342	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN076214 plasmid pCFSAN076214_2, complete sequence	56636	17911	18469	56636		Enterobacteria_phage(100.0%)	1	NA	NA
AYP79436.1|17911_18469_-	hypothetical protein	NA	Q9EV15	Enterobacteria_phage	37.4	5.8e-24
>prophage 3
CP033342	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN076214 plasmid pCFSAN076214_2, complete sequence	56636	25301	27206	56636		Stx_converting_phage(50.0%)	3	NA	NA
AYP79443.1|25301_25688_+	NirD/YgiW/YdeI family stress tolerance protein	NA	A0A1I9LJU6	Stx_converting_phage	46.9	3.0e-27
AYP79444.1|25740_25902_+	recombinase	NA	NA	NA	NA	NA
AYP79480.1|26228_27206_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	60.1	1.2e-101
>prophage 4
CP033342	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN076214 plasmid pCFSAN076214_2, complete sequence	56636	31057	55585	56636	transposase,integrase	Escherichia_phage(33.33%)	27	24480:24492	39072:39084
24480:24492	attL	AGTAACCAGAAAT	NA	NA	NA	NA
AYP79451.1|31057_31840_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
AYP79452.1|31848_32562_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYP79453.1|32565_33075_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
AYP79454.1|33068_33554_+	hypothetical protein	NA	NA	NA	NA	NA
AYP79455.1|33830_34118_-	hypothetical protein	NA	NA	NA	NA	NA
AYP79456.1|34273_34834_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AYP79457.1|34900_35251_-|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
AYP79458.1|35307_35733_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.4	3.4e-24
AYP79459.1|35859_36510_-	SPI-2 type III secretion system effector cysteine hydrolase SpvD	NA	NA	NA	NA	NA
AYP79460.1|36771_37497_-	type III secretion system effector phosphothreonine lyase SpvC	NA	NA	NA	NA	NA
AYP79461.1|37777_39553_-	SPI-2 type III secretion system effector NAD(+)--protein-arginine ADP-ribosyltransferase SpvB	NA	NA	NA	NA	NA
39072:39084	attR	AGTAACCAGAAAT	NA	NA	NA	NA
AYP79462.1|39734_40502_-	virulence protein SpvA	NA	NA	NA	NA	NA
AYP79463.1|40675_40840_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
AYP79464.1|41013_41907_-	virulence genes transcriptional activator SpvR	NA	NA	NA	NA	NA
AYP79465.1|42514_43552_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AYP79466.1|43740_44766_-	AAA family ATPase	NA	NA	NA	NA	NA
AYP79467.1|44698_46363_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AYP79468.1|46346_46907_-	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	43.2	1.5e-32
AYP79469.1|47113_47854_-	carbonic anhydrase	NA	NA	NA	NA	NA
AYP79470.1|48508_48997_-	cytoplasmic protein	NA	NA	NA	NA	NA
AYP79471.1|49254_50370_+	DNA-binding protein	NA	NA	NA	NA	NA
AYP79481.1|50455_50872_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
AYP79472.1|51055_51391_+	hypothetical protein	NA	NA	NA	NA	NA
AYP79473.1|51447_52053_+	DUF2913 family protein	NA	NA	NA	NA	NA
AYP79474.1|52049_52991_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
AYP79475.1|53405_54611_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
AYP79476.1|54607_55585_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	6.7e-84
