The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029694	Streptococcus pyogenes strain ABC020055975 chromosome, complete genome	1866513	36871	49260	1866513		Synechococcus_phage(28.57%)	8	NA	NA
AYO91874.1|36871_40597_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.7	3.9e-39
AYO91875.1|40830_42285_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	3.7e-54
AYO91876.1|42312_43335_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	41.7	2.4e-63
AYO91877.1|43502_44057_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	2.4e-25
AYO91878.1|44240_45788_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	3.4e-45
AYO91879.1|45846_46971_-	CHAP domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	1.3e-06
AYO91880.1|47225_48491_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AYO91881.1|48768_49260_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	2.5e-18
>prophage 2
CP029694	Streptococcus pyogenes strain ABC020055975 chromosome, complete genome	1866513	319710	371165	1866513	terminase,capsid,tail,portal,protease,integrase,holin,head	Streptococcus_phage(40.68%)	77	322618:322635	366596:366613
AYO92121.1|319710_320202_+	Single-stranded DNA-binding protein 2	NA	A0A286QNX2	Streptococcus_phage	74.2	1.7e-59
AYO92122.1|320366_320606_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
AYO92123.1|320738_321395_-	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
AYO92124.1|321526_322471_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
322618:322635	attL	TTTTTGTTATAATATAAG	NA	NA	NA	NA
AYO92125.1|322714_323869_-|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	94.5	1.6e-196
AYO92126.1|323983_324406_-	hypothetical protein	NA	NA	NA	NA	NA
AYO92127.1|324477_325218_-	XRE family transcriptional regulator	NA	J7KJ52	Streptococcus_phage	92.7	4.4e-128
AYO92128.1|325712_325928_-	hypothetical protein	NA	J7KBX0	Streptococcus_phage	97.1	8.8e-29
AYO92129.1|325986_326145_+	hypothetical protein	NA	J7KH24	Streptococcus_phage	92.3	5.8e-22
AYO92130.1|326243_326885_-	hypothetical protein	NA	J7KJ31	Streptococcus_phage	100.0	1.5e-116
AYO92131.1|326977_327193_+	XRE family transcriptional regulator	NA	J7KK54	Streptococcus_phage	98.6	5.0e-32
AYO92132.1|327340_327547_+	hypothetical protein	NA	NA	NA	NA	NA
AYO92133.1|327565_327907_+	hypothetical protein	NA	NA	NA	NA	NA
AYO92134.1|327864_328086_-	hypothetical protein	NA	NA	NA	NA	NA
AYO92135.1|328229_328415_+	XRE family transcriptional regulator	NA	J7KH19	Streptococcus_phage	83.6	1.4e-22
AYO92136.1|328492_328750_+	hypothetical protein	NA	NA	NA	NA	NA
AYO92137.1|329047_329227_+	hypothetical protein	NA	A0A1X9I5M8	Streptococcus_phage	65.5	1.2e-12
AYO92138.1|329399_329672_+	hypothetical protein	NA	NA	NA	NA	NA
AYO92139.1|329661_330042_-	hypothetical protein	NA	NA	NA	NA	NA
AYO92140.1|330097_330541_+	hypothetical protein	NA	NA	NA	NA	NA
AYO92141.1|330656_331460_+	DnaD domain protein	NA	A0A2P0VI76	Streptococcus_phage	53.8	2.4e-63
AYO92142.1|331446_332229_+	DNA replication protein	NA	A0A097PAQ0	Streptococcus_pyogenes_phage	96.9	3.0e-143
AYO92143.1|332369_332723_+	hypothetical protein	NA	A0A097PAU3	Streptococcus_pyogenes_phage	54.0	2.8e-16
AYO92144.1|332703_332958_+	hypothetical protein	NA	Q938N0	Temperate_phage	98.8	3.7e-42
AYO92145.1|332979_333462_+	hypothetical protein	NA	Q938M9	Temperate_phage	100.0	8.2e-51
AYO92146.1|333462_334137_+	single-stranded DNA-binding protein	NA	Q938M8	Temperate_phage	97.8	4.0e-104
AYO92147.1|334129_334549_+	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	96.4	1.5e-69
AYO92148.1|334554_334758_+	hypothetical protein	NA	Q938M6	Temperate_phage	100.0	4.7e-32
AYO92149.1|334757_335198_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A097PAS0	Streptococcus_pyogenes_phage	97.9	4.5e-80
AYO92150.1|335194_335551_+	hypothetical protein	NA	A0A1P8VVP9	Streptococcus_phage	99.2	3.2e-60
AYO92151.1|335547_335799_+	hypothetical protein	NA	A0A1P8VVV4	Streptococcus_phage	94.0	6.8e-41
AYO92152.1|335792_336077_+	DUF3310 domain-containing protein	NA	A0A1P8VVP5	Streptococcus_phage	98.9	2.0e-49
AYO92153.1|336073_336343_+	hypothetical protein	NA	Q938M2	Temperate_phage	100.0	4.0e-47
AYO92154.1|336352_336766_+	hypothetical protein	NA	Q938M1	Temperate_phage	66.7	1.7e-36
AYO92155.1|336929_337094_+	hypothetical protein	NA	NA	NA	NA	NA
AYO92156.1|337090_337375_+	hypothetical protein	NA	A3F628	Streptococcus_phage	79.8	7.8e-33
AYO92157.1|337378_337861_+	class I SAM-dependent methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	98.8	9.6e-92
AYO92158.1|337826_338615_+	site-specific DNA-methyltransferase	NA	A0A1S5SE41	Streptococcus_phage	91.9	3.7e-133
AYO92159.1|339320_339758_+	DUF1492 domain-containing protein	NA	A0A097PBF1	Streptococcus_pyogenes_phage	99.3	1.4e-76
AYO92160.1|339808_340003_+	hypothetical protein	NA	NA	NA	NA	NA
AYO92161.1|340077_340341_+	hypothetical protein	NA	NA	NA	NA	NA
AYO92162.1|340616_341099_+|terminase	terminase small subunit	terminase	E0Y3R8	Staphylococcus_virus	40.3	3.3e-15
AYO92163.1|341076_342366_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4IYR5	uncultured_Caudovirales_phage	74.7	4.9e-183
AYO92164.1|342377_343880_+|portal	phage portal protein	portal	C9W9H5	Streptococcus_virus	54.5	7.1e-141
AYO92165.1|343860_344874_+|head	phage head morphogenesis protein	head	U6E9F1	Streptococcus_phage	44.2	6.2e-48
AYO92166.1|344818_345424_+	hypothetical protein	NA	NA	NA	NA	NA
AYO92167.1|345427_345613_+	hypothetical protein	NA	NA	NA	NA	NA
AYO92168.1|345683_345911_+	hypothetical protein	NA	Q938K9	Temperate_phage	68.2	5.4e-21
AYO92169.1|345907_346189_+	hypothetical protein	NA	A0A1J1JCG1	Escherichia_phage	58.6	1.2e-22
AYO93614.1|346505_346973_+|capsid	phage capsid protein	capsid	L0P2S3	Streptococcus_phage	49.0	5.2e-18
AYO92170.1|346982_347351_+	structural protein	NA	A0A0K2CNR0	Brevibacillus_phage	41.1	1.6e-06
AYO92171.1|347353_348436_+|capsid	major capsid protein E	capsid	A0A2H4J022	uncultured_Caudovirales_phage	56.9	1.7e-104
AYO92172.1|348445_348688_+	hypothetical protein	NA	NA	NA	NA	NA
AYO92173.1|348701_349055_+	hypothetical protein	NA	A0A2H4J002	uncultured_Caudovirales_phage	49.6	9.7e-25
AYO92174.1|349051_349360_+	hypothetical protein	NA	A0A2P1JTW8	Anoxybacillus_phage	41.2	3.3e-13
AYO92175.1|349340_349706_+	hypothetical protein	NA	A0A097BY98	Enterococcus_phage	45.5	6.5e-16
AYO92176.1|349702_350092_+|capsid	phage capsid protein	capsid	Q38611	Lactococcus_phage	65.9	1.6e-41
AYO93615.1|350161_350725_+|tail	phage major tail protein, TP901-1 family	tail	D7RWD5	Brochothrix_phage	57.1	2.5e-43
AYO92177.1|350776_351136_+	hypothetical protein	NA	Q77RZ7	Lactococcus_phage	47.7	1.5e-20
AYO92178.1|351177_351507_+	hypothetical protein	NA	A0A1P8BLR3	Lactococcus_phage	40.6	5.7e-11
AYO92179.1|351521_355157_+|tail	phage tail protein	tail	U6E979	Streptococcus_phage	44.4	3.0e-04
AYO92180.1|355188_355968_+|tail	phage tail protein	tail	A3F655	Streptococcus_phage	54.8	1.7e-66
AYO92181.1|355964_358016_+	hypothetical protein	NA	A3F656	Streptococcus_phage	85.5	0.0e+00
AYO92182.1|358012_359038_+	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	92.0	2.9e-170
AYO92183.1|359050_361066_+	hyaluronidase	NA	Q938J9	Temperate_phage	73.5	8.7e-187
AYO92184.1|361077_361515_+	DUF1617 domain-containing protein	NA	Q938J8	Temperate_phage	98.6	9.1e-73
AYO92185.1|361511_362129_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	89.3	5.0e-77
AYO92186.1|362138_362411_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	91.0	7.2e-36
AYO92187.1|362407_362635_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	98.7	5.8e-31
AYO92188.1|362756_363509_+	CHAP domain-containing protein	NA	A3F665	Streptococcus_phage	99.6	6.9e-145
AYO92189.1|363799_364771_+|protease	CAAX protease	protease	A0A059NT88	Lactococcus_phage	42.3	3.3e-75
AYO92190.1|364955_365156_+	CsbD family protein	NA	J7KJ36	Streptococcus_phage	83.3	1.8e-20
AYO92191.1|365217_366024_-	DNAse	NA	NA	NA	NA	NA
AYO92192.1|366255_366438_+	Paratox	NA	A3F673	Streptococcus_phage	83.3	4.4e-21
AYO92193.1|366651_369480_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	1.0e-305
366596:366613	attR	TTTTTGTTATAATATAAG	NA	NA	NA	NA
AYO92194.1|369595_370669_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	32.2	1.7e-16
AYO92195.1|370703_371165_+	competence protein ComE	NA	F8WPT6	Bacillus_phage	55.1	1.1e-33
>prophage 3
CP029694	Streptococcus pyogenes strain ABC020055975 chromosome, complete genome	1866513	478737	538349	1866513	terminase,capsid,tail,portal,integrase,holin,tRNA,bacteriocin,head	Streptococcus_phage(78.0%)	64	477722:477738	537244:537260
477722:477738	attL	ATTCGCTAAATCTTTTT	NA	NA	NA	NA
AYO92296.1|478737_479664_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AYO92297.1|480030_482070_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AYO92298.1|482223_482481_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
AYO92299.1|482547_483000_+	hypothetical protein	NA	NA	NA	NA	NA
AYO92300.1|483144_483345_+	hypothetical protein	NA	NA	NA	NA	NA
AYO92301.1|483358_484885_+	glycerol kinase	NA	NA	NA	NA	NA
AYO92302.1|484900_486739_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
AYO92303.1|486740_487442_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	36.8	1.3e-28
AYO92304.1|487550_488897_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AYO92305.1|488886_490386_+	DNA-binding protein	NA	NA	NA	NA	NA
AYO92306.1|490511_491156_+	transaldolase	NA	A0A0C5AMY8	Cyanophage	44.2	2.2e-43
AYO93621.1|491373_493359_+	transketolase	NA	NA	NA	NA	NA
AYO92307.1|493551_493776_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYO92308.1|493851_494586_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	2.2e-26
AYO92309.1|494590_496219_+	ABC transporter permease	NA	NA	NA	NA	NA
AYO92310.1|496361_497450_-|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	72.6	6.4e-152
AYO92311.1|497625_498177_-	hypothetical protein	NA	A7J267	Streptococcus_phage	94.0	1.5e-88
AYO92312.1|498187_498571_-	ImmA/IrrE family metallo-endopeptidase	NA	A7J268	Streptococcus_phage	99.2	1.5e-68
AYO92313.1|498584_498935_-	XRE family transcriptional regulator	NA	M1I9X0	Streptococcus_phage	85.3	1.2e-48
AYO92314.1|499573_499765_+	hypothetical protein	NA	A7J270	Streptococcus_phage	100.0	7.3e-27
AYO92315.1|499785_500016_+	hypothetical protein	NA	A7J271	Streptococcus_phage	92.0	3.4e-31
AYO92316.1|500103_500361_+	hypothetical protein	NA	NA	NA	NA	NA
AYO92317.1|500389_500560_+	hypothetical protein	NA	A7J273	Streptococcus_phage	92.9	9.0e-21
AYO92318.1|500756_501086_+	hypothetical protein	NA	A7J274	Streptococcus_phage	92.7	2.6e-48
AYO92319.1|501285_501489_+	hypothetical protein	NA	A7J276	Streptococcus_phage	94.0	1.2e-30
AYO92320.1|501576_501876_+	hypothetical protein	NA	A7J277	Streptococcus_phage	99.0	2.3e-43
AYO92321.1|501875_503033_+	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	99.2	8.5e-219
AYO92322.1|503046_503610_+	DUF2815 domain-containing protein	NA	D2J040	Enterococcus_phage	57.9	5.6e-51
AYO92323.1|503652_505575_+	DNA polymerase	NA	A7J280	Streptococcus_phage	98.3	0.0e+00
AYO92324.1|505579_507964_+	DNA primase	NA	A7J282	Streptococcus_phage	98.0	5.7e-286
AYO92325.1|508329_508605_+	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	96.7	2.9e-45
AYO92326.1|508601_509924_+	ATP-dependent helicase	NA	A7J284	Streptococcus_phage	97.3	7.3e-251
AYO92327.1|510087_510360_+	hypothetical protein	NA	A7J287	Streptococcus_phage	73.3	5.7e-25
AYO92328.1|510492_510909_+	transcriptional regulator	NA	A7J289	Streptococcus_phage	99.3	3.3e-72
AYO93622.1|510998_511451_+|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	100.0	6.9e-76
AYO92329.1|511440_512718_+|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	100.0	1.1e-246
AYO92330.1|512733_514266_+|portal	phage portal protein	portal	A7J292	Streptococcus_phage	99.6	9.9e-292
AYO92331.1|514225_515674_+|head	phage head morphogenesis protein	head	A7J293	Streptococcus_phage	99.6	1.3e-277
AYO92332.1|515701_515890_+	hypothetical protein	NA	A7J294	Streptococcus_phage	100.0	7.4e-24
AYO92333.1|515894_516161_+	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	1.1e-36
AYO92334.1|516328_516898_+	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	99.5	7.4e-83
AYO92335.1|516910_517798_+|capsid	phage capsid protein	capsid	A7J297	Streptococcus_phage	100.0	2.1e-161
AYO92336.1|517809_518166_+	hypothetical protein	NA	A7J298	Streptococcus_phage	100.0	4.6e-59
AYO92337.1|518176_518455_+	hypothetical protein	NA	A7J299	Streptococcus_phage	100.0	1.9e-47
AYO92338.1|518451_518796_+	hypothetical protein	NA	A7J2A0	Streptococcus_phage	98.2	5.1e-55
AYO92339.1|518799_519159_+	hypothetical protein	NA	A7J2A1	Streptococcus_phage	98.3	1.2e-57
AYO92340.1|519170_519770_+|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	97.1	1.7e-90
AYO92341.1|519823_520279_+	hypothetical protein	NA	A7J2A3	Streptococcus_phage	98.0	3.5e-75
AYO92342.1|520353_520587_+	hypothetical protein	NA	A7J2A4	Streptococcus_phage	97.4	6.4e-33
AYO92343.1|520601_524984_+|tail	phage tail protein	tail	A7J2A5	Streptococcus_phage	75.9	3.3e-223
AYO92344.1|524995_525838_+|tail	phage tail protein	tail	A7J2A6	Streptococcus_phage	97.9	8.8e-157
AYO92345.1|525847_527827_+	peptidase	NA	A7J2A7	Streptococcus_phage	92.5	0.0e+00
AYO92346.1|527823_528831_+	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	61.4	4.6e-104
AYO92347.1|528840_530856_+	hyaluronidase	NA	Q938J9	Temperate_phage	73.4	3.3e-186
AYO92348.1|530867_531305_+	DUF1617 domain-containing protein	NA	Q938J8	Temperate_phage	98.6	9.1e-73
AYO92349.1|531301_531919_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	89.3	5.0e-77
AYO92350.1|531928_532201_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	91.0	7.2e-36
AYO92351.1|532197_532425_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	100.0	2.0e-31
AYO92352.1|532540_533743_+	CHAP domain-containing protein	NA	Q938J4	Temperate_phage	99.8	2.8e-241
AYO92353.1|533956_534580_+	hypothetical protein	NA	NA	NA	NA	NA
AYO92354.1|534693_535680_-	deoxyribonuclease	NA	A7J2B8	Streptococcus_phage	100.0	1.4e-169
AYO92355.1|535912_536095_+	Paratox	NA	A3F673	Streptococcus_phage	83.3	1.5e-21
AYO92356.1|536284_537106_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	36.8	4.7e-38
AYO92357.1|537098_538349_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	55.6	2.2e-116
537244:537260	attR	AAAAAGATTTAGCGAAT	NA	NA	NA	NA
>prophage 4
CP029694	Streptococcus pyogenes strain ABC020055975 chromosome, complete genome	1866513	572711	635086	1866513	capsid,tail,portal,integrase,tRNA,holin,head	Streptococcus_pyogenes_phage(55.17%)	69	593095:593110	607722:607737
AYO92385.1|572711_573647_+|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	38.5	6.0e-05
AYO92386.1|573636_574959_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
AYO92387.1|574996_575737_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
AYO92388.1|575733_577632_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	B5LWE2	Feldmannia_species_virus	30.7	1.4e-21
AYO92389.1|577703_578447_+	transporter	NA	NA	NA	NA	NA
AYO92390.1|578443_579448_+	sensor histidine kinase	NA	NA	NA	NA	NA
AYO92391.1|579440_580082_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYO92392.1|580118_581519_+	Cof-type HAD-IIB family hydrolase	NA	A0A1V0S9I2	Catovirus	43.5	4.1e-26
AYO92393.1|581518_581896_+	hypothetical protein	NA	NA	NA	NA	NA
AYO92394.1|581913_582855_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	77.2	1.3e-129
AYO92395.1|582982_583615_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	54.3	5.5e-63
AYO92396.1|584965_585631_+	ComF family protein	NA	NA	NA	NA	NA
AYO92397.1|585710_586259_+	ribosome-associated factor Y	NA	NA	NA	NA	NA
AYO92398.1|586854_587079_-	hypothetical protein	NA	NA	NA	NA	NA
593095:593110	attL	AAATCCCATTATAAAA	NA	NA	NA	NA
AYO92399.1|594032_594566_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
AYO92400.1|594645_595422_-	regulatory protein RecX	NA	NA	NA	NA	NA
AYO92401.1|595569_596736_-|integrase	integrase	integrase	C5J953	Streptococcus_phage	42.2	7.0e-80
AYO93624.1|596909_597500_-	hypothetical protein	NA	A0A1P8VVT3	Streptococcus_phage	99.0	2.7e-104
AYO92402.1|597931_598309_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1P8VVK5	Streptococcus_phage	100.0	4.0e-69
AYO92403.1|598292_598652_-	XRE family transcriptional regulator	NA	A0A1P8VVN3	Streptococcus_phage	97.5	4.0e-58
AYO92404.1|598840_599059_+	XRE family transcriptional regulator	NA	A0A1P8VVR5	Streptococcus_phage	100.0	4.1e-34
AYO92405.1|599153_599405_+	hypothetical protein	NA	A0A1P8VVV6	Streptococcus_phage	98.8	1.4e-41
AYO92406.1|599588_599903_+	XRE family transcriptional regulator	NA	A0A1P8VVN6	Streptococcus_phage	94.2	2.3e-49
AYO92407.1|600131_600614_+	hypothetical protein	NA	A0A1P8VVS5	Streptococcus_phage	99.4	4.6e-78
AYO92408.1|600614_601295_+	DNA-binding protein	NA	A0A1P8VVS4	Streptococcus_phage	100.0	1.6e-129
AYO92409.1|601396_602626_+	ATP-dependent helicase	NA	A0A1P8VVM2	Streptococcus_phage	99.5	2.8e-236
AYO92410.1|602641_603100_+	DUF669 domain-containing protein	NA	A0A1P8VVN0	Streptococcus_phage	99.3	5.0e-82
AYO92411.1|603102_603915_+	hypothetical protein	NA	A0A1P8VVM6	Streptococcus_phage	98.9	4.6e-155
AYO92412.1|603904_605386_+	DNA primase	NA	A0A1P8VVM0	Streptococcus_phage	97.6	2.0e-289
AYO92413.1|605630_605951_+	VRR-NUC domain-containing protein	NA	A0A1P8VVL5	Streptococcus_phage	99.1	5.8e-53
AYO92414.1|605934_606291_+	hypothetical protein	NA	A0A1P8VVP9	Streptococcus_phage	96.6	1.6e-59
AYO92415.1|606287_606539_+	hypothetical protein	NA	A0A1P8VVV4	Streptococcus_phage	94.0	6.8e-41
AYO92416.1|606532_606817_+	DUF3310 domain-containing protein	NA	A0A1P8VVP5	Streptococcus_phage	97.9	2.7e-49
AYO92417.1|606813_607227_+	hypothetical protein	NA	Q938M1	Temperate_phage	63.1	1.2e-34
AYO92418.1|607390_607675_+	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	91.5	5.0e-40
AYO92419.1|607677_608013_+	hypothetical protein	NA	A0A097PAS4	Streptococcus_pyogenes_phage	100.0	4.7e-45
607722:607737	attR	TTTTATAATGGGATTT	NA	NA	NA	NA
AYO92420.1|608178_608364_+	hypothetical protein	NA	A0A097PBF0	Streptococcus_pyogenes_phage	100.0	7.0e-27
AYO92421.1|608650_609154_+	DUF1642 domain-containing protein	NA	A0A097PAV5	Streptococcus_pyogenes_phage	97.6	8.5e-91
AYO92422.1|609348_609564_+	hypothetical protein	NA	A0A097PAV3	Streptococcus_pyogenes_phage	94.3	2.7e-09
AYO92423.1|609605_610040_+	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	94.4	2.2e-71
AYO92424.1|610649_611030_+	hypothetical protein	NA	A0A097PAR5	Streptococcus_pyogenes_phage	100.0	1.0e-64
AYO92425.1|612293_613619_+|portal	phage portal protein	portal	A0A097PAT2	Streptococcus_pyogenes_phage	99.5	1.8e-241
AYO92426.1|613587_614496_+|head	phage head morphogenesis protein	head	A0A097PBF2	Streptococcus_pyogenes_phage	100.0	4.2e-88
AYO92427.1|614502_614769_+	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	100.0	2.6e-38
AYO92428.1|614918_615491_+	DUF4355 domain-containing protein	NA	A0A097PAW3	Streptococcus_pyogenes_phage	100.0	1.2e-72
AYO92429.1|615508_616399_+|capsid	phage capsid protein	capsid	A0A097PAW2	Streptococcus_pyogenes_phage	99.4	8.6e-86
AYO92430.1|616411_616705_+	hypothetical protein	NA	A0A097PBF3	Streptococcus_pyogenes_phage	100.0	2.0e-47
AYO92431.1|616718_617063_+	hypothetical protein	NA	A0A097PAS2	Streptococcus_pyogenes_phage	100.0	1.1e-54
AYO92432.1|617059_617371_+	hypothetical protein	NA	A0A097PAW7	Streptococcus_pyogenes_phage	99.0	2.6e-50
AYO92433.1|617367_617763_+	hypothetical protein	NA	A0A097PAT9	Streptococcus_pyogenes_phage	100.0	1.8e-59
AYO92434.1|617764_618175_+	DUF5072 domain-containing protein	NA	A0A097PAW5	Streptococcus_pyogenes_phage	100.0	1.4e-70
AYO92435.1|618186_618693_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	100.0	2.6e-79
AYO92436.1|618705_619023_+	hypothetical protein	NA	A0A097PAS6	Streptococcus_pyogenes_phage	100.0	4.9e-52
AYO92437.1|618995_619454_+	hypothetical protein	NA	A0A097PAX1	Streptococcus_pyogenes_phage	100.0	2.3e-82
AYO92438.1|619446_621252_+|tail	phage tail protein	tail	A0A097PAU2	Streptococcus_pyogenes_phage	99.7	8.8e-263
AYO92439.1|621252_622737_+|tail	phage tail protein	tail	A0A097PAW9	Streptococcus_pyogenes_phage	99.8	4.3e-292
AYO92440.1|622737_626178_+	CHAP domain-containing protein	NA	A0A097PBF5	Streptococcus_pyogenes_phage	99.9	0.0e+00
AYO92441.1|626182_628045_+	hypothetical protein	NA	A0A097PAT0	Streptococcus_pyogenes_phage	99.7	0.0e+00
AYO92442.1|628055_628403_+	DUF1366 domain-containing protein	NA	A0A097PAX5	Streptococcus_pyogenes_phage	100.0	3.5e-59
AYO92443.1|628552_628972_+	hypothetical protein	NA	A0A097PAX2	Streptococcus_pyogenes_phage	99.1	5.0e-52
AYO92444.1|628874_629207_+|holin	phage holin	holin	A0A097PBF6	Streptococcus_pyogenes_phage	100.0	5.7e-51
AYO92445.1|629208_629973_+	CHAP domain-containing protein	NA	A0A097PAT3	Streptococcus_pyogenes_phage	100.0	1.5e-150
AYO92446.1|629984_630587_+	hypothetical protein	NA	A0A097PAX9	Streptococcus_pyogenes_phage	98.8	7.8e-91
AYO92447.1|630597_631371_+	hypothetical protein	NA	A0A097PAV0	Streptococcus_pyogenes_phage	100.0	3.9e-135
AYO92448.1|631380_631602_+	hypothetical protein	NA	A0A097PAX7	Streptococcus_pyogenes_phage	84.5	2.5e-18
AYO92449.1|631601_632261_+	hypothetical protein	NA	A0A097PBF7	Streptococcus_pyogenes_phage	100.0	8.5e-123
AYO92450.1|632382_633138_-	exotoxin type A	NA	A0A097PAT7	Streptococcus_pyogenes_phage	99.6	2.2e-143
AYO92451.1|633357_633540_+	Paratox	NA	J7KBZ4	Streptococcus_phage	81.4	1.1e-19
AYO92452.1|633730_635086_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	33.0	1.1e-73
>prophage 5
CP029694	Streptococcus pyogenes strain ABC020055975 chromosome, complete genome	1866513	710759	770926	1866513	terminase,capsid,tail,portal,protease,integrase,tRNA,holin	Streptococcus_phage(64.91%)	73	733069:733088	767469:767488
AYO92520.1|710759_713561_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	26.5	1.6e-77
AYO92521.1|713825_714128_-	DUF1827 domain-containing protein	NA	NA	NA	NA	NA
AYO92522.1|714178_714634_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AYO92523.1|714761_717044_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CYX3	Yersinia_phage	39.6	1.1e-124
AYO92524.1|717341_717572_+	DUF1797 domain-containing protein	NA	NA	NA	NA	NA
AYO92525.1|717698_718385_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYO92526.1|718384_719119_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	2.8e-34
AYO92527.1|719267_720677_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	2.2e-59
AYO92528.1|720854_722549_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	42.4	1.6e-128
AYO92529.1|722756_723611_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.4	4.4e-39
AYO92530.1|723763_725104_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	30.9	8.2e-40
AYO92531.1|725081_725297_+	exodeoxyribonuclease 7 small subunit	NA	NA	NA	NA	NA
AYO92532.1|725296_726169_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
AYO92533.1|726161_726989_+	TlyA family rRNA (cytidine-2'-O)-methyltransferase	NA	NA	NA	NA	NA
AYO92534.1|726975_727446_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
AYO92535.1|727467_729129_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AYO92536.1|729300_730245_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AYO93625.1|730472_731312_+	EDD domain protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	1.2e-12
AYO92537.1|731286_732147_+	GDSL family lipase	NA	NA	NA	NA	NA
AYO92538.1|732124_732712_+	DUF2140 domain-containing protein	NA	NA	NA	NA	NA
AYO92539.1|732810_733086_+	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
733069:733088	attL	AAAGACGCTGTTAAATAATT	NA	NA	NA	NA
AYO92540.1|733174_734317_-|integrase	site-specific integrase	integrase	M1NRJ9	Streptococcus_phage	77.4	2.4e-173
AYO92541.1|734440_734959_-	restriction endonuclease	NA	E8ZDN5	Streptococcus_phage	45.9	9.2e-32
AYO92542.1|734970_735726_-	XRE family transcriptional regulator	NA	A0A1S5S8S8	Streptococcus_phage	60.8	2.8e-77
AYO92543.1|735927_736140_+	XRE family transcriptional regulator	NA	A0A1X9I583	Streptococcus_phage	56.7	1.1e-10
AYO92544.1|736409_736721_+	excisionase	NA	A0A1S5SA25	Streptococcus_phage	77.7	5.3e-43
AYO92545.1|736722_736908_+	hypothetical protein	NA	Q938N3	Temperate_phage	83.6	1.3e-20
AYO92546.1|737016_737271_+	transcriptional regulator	NA	A0A1S5S9Z1	Streptococcus_phage	41.3	7.7e-08
AYO92547.1|737411_737798_+	DnaD domain protein	NA	Q938N2	Temperate_phage	51.9	8.1e-25
AYO92548.1|737778_738012_+	hypothetical protein	NA	Q938N1	Temperate_phage	96.1	2.8e-36
AYO92549.1|738008_738149_+	hypothetical protein	NA	A0A1X9I6Y1	Streptococcus_phage	54.5	3.4e-05
AYO92550.1|738157_738364_+	hypothetical protein	NA	NA	NA	NA	NA
AYO92551.1|738752_739679_+	recombinase RecT	NA	M1NRN6	Streptococcus_phage	71.8	1.2e-90
AYO92552.1|739675_739876_+	hypothetical protein	NA	NA	NA	NA	NA
AYO92553.1|739868_740666_+	hypothetical protein	NA	J7KGZ1	Streptococcus_phage	83.8	1.3e-130
AYO92554.1|741030_741426_+	hypothetical protein	NA	A8ATL9	Listeria_phage	52.3	1.4e-19
AYO92555.1|741422_742769_+	hypothetical protein	NA	A8ATM0	Listeria_phage	49.4	1.0e-122
AYO92556.1|742779_743112_+	hypothetical protein	NA	M1NS23	Streptococcus_phage	66.1	5.7e-35
AYO92557.1|743108_743621_+	hypothetical protein	NA	M1PFM2	Streptococcus_phage	85.9	1.7e-78
AYO92558.1|743656_743974_+	DUF1372 domain-containing protein	NA	A1EAD7	Streptococcus_phage	71.4	9.0e-30
AYO92559.1|744122_744374_+	hypothetical protein	NA	M1PF60	Streptococcus_phage	59.0	1.6e-18
AYO92560.1|744449_744869_+	DUF1492 domain-containing protein	NA	A0A1X9I5B5	Streptococcus_phage	79.1	1.9e-56
AYO92561.1|744976_745321_+	HNH endonuclease	NA	M1Q0W7	Streptococcus_phage	69.4	3.2e-41
AYO92562.1|745468_745825_+	hypothetical protein	NA	M1PRL3	Streptococcus_phage	57.8	2.4e-07
AYO92563.1|745821_747090_+|portal	phage portal protein	portal	M1PFL4	Streptococcus_phage	75.6	2.2e-188
AYO92564.1|747082_748576_+	hypothetical protein	NA	M1Q184	Streptococcus_phage	55.0	2.0e-87
AYO92565.1|748581_748806_+	hypothetical protein	NA	NA	NA	NA	NA
AYO92566.1|749027_749294_+	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	6.4e-37
AYO92567.1|749295_749511_+	hypothetical protein	NA	M1IRA5	Streptococcus_phage	72.4	4.1e-26
AYO92568.1|749592_751008_+|terminase	terminase	terminase	A0A0B5A091	Streptococcus_phage	74.0	1.5e-212
AYO92569.1|751088_751550_+	DUF4355 domain-containing protein	NA	M1Q1L0	Streptococcus_phage	52.6	1.7e-37
AYO92570.1|751574_752486_+|capsid	phage major capsid protein	capsid	M1PFL0	Streptococcus_phage	67.0	2.9e-113
AYO92571.1|752485_752686_+	hypothetical protein	NA	NA	NA	NA	NA
AYO92572.1|752695_753118_+	hypothetical protein	NA	A0A0B5A2F6	Streptococcus_phage	67.2	8.2e-47
AYO92573.1|753077_753416_+	hypothetical protein	NA	A0A0B5A086	Streptococcus_phage	75.0	8.1e-45
AYO92574.1|753408_753645_+	hypothetical protein	NA	A0A1P8BMT2	Lactococcus_phage	66.7	2.5e-21
AYO92575.1|753645_753981_+	hypothetical protein	NA	A0A1P8BMR5	Lactococcus_phage	64.9	9.8e-35
AYO92576.1|753993_754587_+|tail	phage tail protein	tail	M1PKG8	Streptococcus_phage	62.5	1.1e-60
AYO92577.1|754597_754861_+	hypothetical protein	NA	A0A0B5A2F3	Streptococcus_phage	55.8	1.0e-18
AYO92578.1|754875_755247_+	hypothetical protein	NA	M1PL84	Streptococcus_phage	62.4	1.7e-35
AYO92579.1|755246_757610_+	hypothetical protein	NA	M1NRG5	Streptococcus_phage	50.1	3.6e-131
AYO92580.1|757606_758302_+	hypothetical protein	NA	A0A1B1P761	Bacillus_phage	32.2	4.7e-07
AYO92581.1|758298_760257_+	peptidase	NA	M1PKG3	Streptococcus_phage	48.7	3.4e-95
AYO92582.1|760256_761366_+	hyaluronoglucosaminidase	NA	A7J2A8	Streptococcus_phage	65.9	1.2e-113
AYO92583.1|761380_763162_+	hypothetical protein	NA	Q938J9	Temperate_phage	41.7	4.4e-73
AYO92584.1|763170_763602_+	DUF1617 domain-containing protein	NA	A3F661	Streptococcus_phage	91.4	3.1e-65
AYO92585.1|763604_764219_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	79.4	1.8e-66
AYO92586.1|764229_764685_+|holin	holin	holin	A0A0M4R3G6	Streptococcus_phage	81.5	3.0e-63
AYO92587.1|764796_766011_+|holin	holin	holin	A0A1P8VVM5	Streptococcus_phage	60.5	9.7e-165
AYO92588.1|766255_767050_+	mitogenic factor	NA	A7J2B8	Streptococcus_phage	35.6	8.9e-26
AYO92589.1|767116_767299_+	Paratox	NA	A3F673	Streptococcus_phage	81.7	4.4e-21
AYO92590.1|767828_769691_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.8	2.7e-89
767469:767488	attR	AAAGACGCTGTTAAATAATT	NA	NA	NA	NA
AYO92591.1|769990_770926_-	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	45.1	1.0e-65
>prophage 6
CP029694	Streptococcus pyogenes strain ABC020055975 chromosome, complete genome	1866513	1219707	1230311	1866513		Streptococcus_phage(57.14%)	9	NA	NA
AYO92998.1|1219707_1220850_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	1.4e-24
AYO92999.1|1221084_1221525_+	hypothetical protein	NA	NA	NA	NA	NA
AYO93000.1|1221554_1222832_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AYO93001.1|1222911_1224264_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.0	4.5e-30
AYO93002.1|1224484_1224826_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	39.3	1.3e-18
AYO93003.1|1224886_1226053_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
AYO93004.1|1226146_1226833_-	3-dehydroquinase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
AYO93005.1|1226829_1227993_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	5.8e-143
AYO93006.1|1228100_1230311_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	69.1	2.9e-268
>prophage 7
CP029694	Streptococcus pyogenes strain ABC020055975 chromosome, complete genome	1866513	1265721	1361995	1866513	terminase,capsid,tail,portal,protease,holin,tRNA,bacteriocin,head	Streptococcus_phage(55.07%)	107	NA	NA
AYO93037.1|1265721_1268127_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AYO93038.1|1268336_1269380_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.3	4.6e-30
AYO93039.1|1270562_1270751_-	DNA-directed RNA polymerase subunit beta	NA	NA	NA	NA	NA
AYO93040.1|1270754_1272026_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AYO93041.1|1272090_1272348_-	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
AYO93042.1|1272613_1273030_-	ATP synthase epsilon chain	NA	NA	NA	NA	NA
AYO93043.1|1273042_1274449_-	ATP synthase subunit beta	NA	NA	NA	NA	NA
AYO93044.1|1274610_1275486_-	ATP synthase subunit gamma	NA	NA	NA	NA	NA
AYO93045.1|1275501_1277010_-	ATP synthase subunit alpha	NA	NA	NA	NA	NA
AYO93046.1|1277025_1277562_-	ATP synthase subunit delta	NA	NA	NA	NA	NA
AYO93047.1|1277561_1278056_-	ATP synthase F0 subunit B	NA	NA	NA	NA	NA
AYO93048.1|1278073_1278790_-	ATP synthase subunit A	NA	NA	NA	NA	NA
AYO93049.1|1278824_1279022_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
AYO93050.1|1279413_1280436_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.9	3.6e-19
AYO93051.1|1280449_1282408_-	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	34.9	3.4e-103
AYO93052.1|1282602_1283103_-	queuosine transporter QueT	NA	E7DN70	Pneumococcus_phage	31.8	1.4e-05
AYO93053.1|1283380_1286113_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AYO93054.1|1286683_1287802_-	ABC transporter permease	NA	NA	NA	NA	NA
AYO93055.1|1287798_1288926_-	ABC transporter permease	NA	NA	NA	NA	NA
AYO93056.1|1288934_1289858_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	38.1	6.7e-33
AYO93057.1|1289880_1290564_-	streptolysin associated protein SagF	NA	NA	NA	NA	NA
AYO93058.1|1290560_1291232_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYO93059.1|1291206_1292565_-	streptolysin associated protein SagD	NA	NA	NA	NA	NA
AYO93060.1|1292584_1293643_-	streptolysin associated protein SagC	NA	NA	NA	NA	NA
AYO93061.1|1293639_1294590_-	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
AYO93062.1|1294811_1294973_-|bacteriocin	streptolysin S family bacteriocin	bacteriocin	NA	NA	NA	NA
AYO93063.1|1295534_1296842_-	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	96.6	1.2e-240
AYO93064.1|1297074_1297533_+	DUF1694 domain-containing protein	NA	W6LLD2	Streptococcus_phage	39.1	1.8e-18
AYO93065.1|1297664_1299389_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
AYO93066.1|1299756_1301709_-	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	46.3	6.8e-144
AYO93641.1|1301709_1302270_-	DNA gyrase subunit B	NA	NA	NA	NA	NA
AYO93067.1|1302638_1302932_+	hypothetical protein	NA	A0A141DZH6	Streptococcus_phage	44.6	1.1e-08
AYO93068.1|1303294_1303642_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AYO93069.1|1303756_1305019_-	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	51.0	5.4e-94
AYO93070.1|1305011_1305296_-	chorismate mutase	NA	NA	NA	NA	NA
AYO93071.1|1305470_1305920_-	flavodoxin	NA	NA	NA	NA	NA
AYO93072.1|1306313_1307255_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
AYO93073.1|1307369_1307630_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
AYO93074.1|1307726_1308926_-	SIS domain-containing protein	NA	NA	NA	NA	NA
AYO93075.1|1308945_1309668_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYO93076.1|1309815_1311363_-	zinc-binding protein AdcA	NA	NA	NA	NA	NA
AYO93077.1|1311514_1312933_-	dipeptidase	NA	NA	NA	NA	NA
AYO93078.1|1313244_1314003_+	DNAse	NA	NA	NA	NA	NA
AYO93079.1|1314113_1314821_+	exotoxin type C	NA	A0A097PAT7	Streptococcus_pyogenes_phage	27.1	3.9e-09
AYO93080.1|1314888_1316094_-	lysin	NA	Q938J4	Temperate_phage	83.5	5.6e-205
AYO93081.1|1316209_1316437_-|holin	phage holin	holin	A7J2B3	Streptococcus_phage	98.7	5.8e-31
AYO93082.1|1316433_1316709_-	hypothetical protein	NA	A7J2B2	Streptococcus_phage	100.0	2.6e-41
AYO93083.1|1316718_1317336_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	89.3	5.0e-77
AYO93084.1|1317332_1317770_-	hypothetical protein	NA	Q938J8	Temperate_phage	90.9	2.4e-65
AYO93085.1|1317781_1319668_-	hyaluronidase	NA	Q938J9	Temperate_phage	85.2	3.3e-220
AYO93086.1|1319680_1320691_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	75.8	7.8e-136
AYO93087.1|1320687_1322832_-	peptidase	NA	Q938K1	Temperate_phage	94.5	0.0e+00
AYO93088.1|1322828_1323536_-|tail	phage tail protein	tail	Q938K2	Temperate_phage	71.9	6.8e-94
AYO93089.1|1323535_1327459_-|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	48.5	1.9e-238
AYO93090.1|1327668_1327995_-	hypothetical protein	NA	J7KK85	Streptococcus_phage	75.0	8.3e-39
AYO93091.1|1328047_1328656_-|tail	phage tail protein	tail	J7KKC8	Streptococcus_phage	71.9	6.7e-74
AYO93092.1|1328671_1329097_-	hypothetical protein	NA	J7KBZ9	Streptococcus_phage	84.4	7.2e-67
AYO93093.1|1329093_1329471_-	hypothetical protein	NA	J7KDM3	Streptococcus_phage	72.8	1.8e-45
AYO93094.1|1329467_1329815_-|head,tail	head-tail adaptor protein	head,tail	J7KJ42	Streptococcus_phage	88.2	2.9e-50
AYO93095.1|1329811_1330114_-	DNA packaging protein, QLRG family	NA	J7KC36	Streptococcus_phage	88.8	1.3e-41
AYO93096.1|1330258_1331446_-|capsid	phage major capsid protein	capsid	J7KJ82	Streptococcus_phage	74.7	1.3e-158
AYO93097.1|1331470_1332136_-|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	78.1	3.5e-92
AYO93098.1|1332113_1333334_-|portal	phage portal protein	portal	J7KDU3	Streptococcus_phage	81.9	6.9e-187
AYO93099.1|1333367_1333592_-	hypothetical protein	NA	Q938K9	Temperate_phage	61.4	3.6e-17
AYO93642.1|1333751_1335506_-	amino acid transporter	NA	J7KKD1	Streptococcus_phage	96.1	0.0e+00
AYO93100.1|1335509_1335740_-	hypothetical protein	NA	NA	NA	NA	NA
AYO93101.1|1335742_1336210_-|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	98.7	3.9e-82
AYO93102.1|1336380_1336719_-	HNH endonuclease	NA	J7KH36	Streptococcus_phage	90.7	3.0e-55
AYO93103.1|1336954_1337140_+	addiction module toxin, HicA family	NA	D6PSW1	Lactobacillus_phage	54.0	1.7e-09
AYO93104.1|1337191_1337569_+	HicB family protein	NA	I3NLB2	Bifidobacterium_phage	44.0	3.3e-15
AYO93105.1|1337695_1338625_-	hypothetical protein	NA	A0A126HAU2	Lactococcus_phage	71.8	4.9e-100
AYO93106.1|1339209_1339647_-	DUF1492 domain-containing protein	NA	A0A097PBF1	Streptococcus_pyogenes_phage	99.3	1.4e-76
AYO93107.1|1339598_1339895_-	hypothetical protein	NA	A0A097PAV3	Streptococcus_pyogenes_phage	97.1	5.2e-32
AYO93108.1|1340089_1340815_-	DUF1642 domain-containing protein	NA	Q938L9	Temperate_phage	44.8	3.1e-25
AYO93109.1|1340862_1341651_-	site-specific DNA-methyltransferase	NA	A0A1S5SE41	Streptococcus_phage	91.9	3.7e-133
AYO93110.1|1341616_1342099_-	class I SAM-dependent methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	98.8	9.6e-92
AYO93111.1|1342102_1342387_-	hypothetical protein	NA	A3F628	Streptococcus_phage	79.8	7.8e-33
AYO93112.1|1342383_1342797_-	hypothetical protein	NA	Q938M1	Temperate_phage	66.7	5.8e-37
AYO93113.1|1342806_1343076_-	hypothetical protein	NA	A0A1P8VVR6	Streptococcus_phage	100.0	3.1e-47
AYO93114.1|1343072_1343258_-	hypothetical protein	NA	A3F626	Streptococcus_phage	94.7	1.7e-12
AYO93115.1|1343250_1343532_-	DUF1599 domain-containing protein	NA	J7KDH9	Streptococcus_phage	75.0	2.5e-31
AYO93116.1|1343656_1344013_-	hypothetical protein	NA	A0A1P8VVP9	Streptococcus_phage	87.3	7.7e-54
AYO93117.1|1343996_1344317_-	VRR-NUC domain-containing protein	NA	A0A1P8VVL5	Streptococcus_phage	95.3	1.9e-51
AYO93118.1|1344313_1344727_-	hypothetical protein	NA	A0A2H4JHE6	uncultured_Caudovirales_phage	51.1	1.6e-15
AYO93119.1|1344988_1346464_-	DNA primase	NA	A0A1P8VVM0	Streptococcus_phage	84.2	2.4e-242
AYO93120.1|1346453_1347266_-	hypothetical protein	NA	J7KH42	Streptococcus_phage	97.4	1.9e-153
AYO93121.1|1347268_1347727_-	DUF669 domain-containing protein	NA	A0A1P8VVN0	Streptococcus_phage	94.1	2.2e-77
AYO93122.1|1347742_1348978_-	ATP-dependent helicase	NA	J7KK96	Streptococcus_phage	95.1	2.8e-228
AYO93123.1|1349073_1349766_-	DNA-binding protein	NA	J7KC09	Streptococcus_phage	96.1	5.9e-127
AYO93124.1|1349752_1350064_-	hypothetical protein	NA	A0A1S5PRW6	Streptococcus_phage	48.5	8.0e-23
AYO93125.1|1350173_1350356_-	hypothetical protein	NA	A0A2P0ZLA4	Lactobacillus_phage	43.8	4.0e-06
AYO93126.1|1350343_1350556_-	hypothetical protein	NA	NA	NA	NA	NA
AYO93127.1|1350702_1350948_-	hypothetical protein	NA	NA	NA	NA	NA
AYO93128.1|1351020_1351206_-	XRE family transcriptional regulator	NA	J7KH19	Streptococcus_phage	68.9	3.5e-18
AYO93129.1|1351350_1351581_+	hypothetical protein	NA	NA	NA	NA	NA
AYO93130.1|1351743_1351953_+	hypothetical protein	NA	NA	NA	NA	NA
AYO93131.1|1351911_1352157_-	hypothetical protein	NA	A0A097PAP6	Streptococcus_pyogenes_phage	93.8	1.6e-34
AYO93132.1|1352198_1352405_-	hypothetical protein	NA	A0A1X9I5S3	Streptococcus_phage	64.7	1.1e-17
AYO93133.1|1352497_1353139_+	hypothetical protein	NA	J7KJ31	Streptococcus_phage	100.0	1.5e-116
AYO93134.1|1353237_1353396_-	hypothetical protein	NA	J7KH24	Streptococcus_phage	88.5	7.1e-20
AYO93135.1|1354402_1355152_+	helix-turn-helix domain-containing protein	NA	A0A097PBE5	Streptococcus_pyogenes_phage	63.8	4.5e-80
AYO93136.1|1355117_1355720_+	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	41.9	4.3e-33
AYO93137.1|1355870_1357286_+	recombinase family protein	NA	A5GZ62	Lactococcus_phage	47.2	1.4e-109
AYO93138.1|1357462_1358374_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	64.7	1.0e-105
AYO93139.1|1358370_1359348_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	74.2	1.2e-138
AYO93140.1|1359344_1360235_-	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	8.8e-06
AYO93141.1|1360648_1361995_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.8	1.1e-55
>prophage 8
CP029694	Streptococcus pyogenes strain ABC020055975 chromosome, complete genome	1866513	1536030	1542064	1866513		Streptococcus_phage(100.0%)	8	NA	NA
AYO93305.1|1536030_1536858_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.5	3.8e-128
AYO93306.1|1536931_1537288_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	66.7	2.8e-40
AYO93307.1|1537585_1538215_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AYO93308.1|1538261_1538654_-	hypothetical protein	NA	NA	NA	NA	NA
AYO93309.1|1538680_1539544_-	rRNA (cytidine-2'-O-)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.7	1.9e-114
AYO93310.1|1539548_1539872_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	62.3	1.0e-28
AYO93311.1|1540535_1541411_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	47.6	1.5e-71
AYO93312.1|1541428_1542064_-	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	63.4	2.7e-65
