The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033230	Sphingobium yanoikuyae strain SJTF8 chromosome, complete genome	5172777	287041	308095	5172777	tail	Klebsiella_phage(33.33%)	11	NA	NA
AYO76417.1|287041_288688_+	DEAD/DEAH box helicase	NA	A0A1X9HX80	Ruegeria_phage	60.8	1.4e-190
AYO76418.1|288888_289080_+	hypothetical protein	NA	NA	NA	NA	NA
AYO76419.1|289079_289307_+	hypothetical protein	NA	NA	NA	NA	NA
AYO76420.1|289495_290023_-	hypothetical protein	NA	NA	NA	NA	NA
AYO76421.1|290019_290616_-	hypothetical protein	NA	A0A2P0ZLK0	Pseudomonas_phage	39.7	6.9e-15
AYO76422.1|290605_290839_-	hypothetical protein	NA	A0A2D2W319	Escherichia_phage	32.4	2.1e-07
AYO76423.1|290835_291198_-	hypothetical protein	NA	NA	NA	NA	NA
AYO76424.1|291314_305249_-	PLxRFG domain-containing protein	NA	H2DE57	Erwinia_phage	31.0	0.0e+00
AYO76425.1|305322_306546_-	hypothetical protein	NA	NA	NA	NA	NA
AYO76426.1|306555_307653_-|tail	tail fiber domain-containing protein	tail	A0A248SL32	Klebsiella_phage	55.0	4.9e-99
AYO76427.1|307642_308095_-	N-acetyltransferase	NA	A0A248SLB3	Klebsiella_phage	45.1	1.1e-28
>prophage 2
CP033230	Sphingobium yanoikuyae strain SJTF8 chromosome, complete genome	5172777	313809	330212	5172777	capsid,terminase	Erwinia_phage(27.27%)	17	NA	NA
AYO76433.1|313809_316530_-	hypothetical protein	NA	A0A248SKY1	Klebsiella_phage	48.3	4.2e-27
AYO76434.1|316585_317539_-	choice-of-anchor D domain-containing protein	NA	NA	NA	NA	NA
AYO76435.1|317673_317877_+	hypothetical protein	NA	NA	NA	NA	NA
AYO76436.1|317914_318628_-	hypothetical protein	NA	H2DE43	Erwinia_phage	43.3	2.6e-45
AYO76437.1|318632_319382_-	hypothetical protein	NA	NA	NA	NA	NA
AYO76438.1|319446_319890_-	hypothetical protein	NA	A0A1Y0SZB0	Pseudomonas_phage	41.2	2.2e-13
AYO76439.1|319902_321003_-|capsid	N4-gp56 family major capsid protein	capsid	H2DE40	Erwinia_phage	72.8	1.9e-159
AYO76440.1|321095_321269_-	hypothetical protein	NA	I6NML3	Burkholderia_virus	59.1	2.9e-06
AYO76441.1|321300_322227_-	hypothetical protein	NA	NA	NA	NA	NA
AYO76442.1|322252_324574_-	hypothetical protein	NA	H2DE37	Erwinia_phage	64.7	4.2e-233
AYO76443.1|324560_324986_-	hypothetical protein	NA	A0A223W072	Agrobacterium_phage	37.2	1.5e-19
AYO76444.1|324988_326560_-|terminase	terminase	terminase	I6NML2	Burkholderia_virus	59.4	4.7e-180
AYO76445.1|326556_327255_-	hypothetical protein	NA	C5IHM0	Burkholderia_virus	26.4	2.8e-07
AYO76446.1|327605_328013_-	hypothetical protein	NA	NA	NA	NA	NA
AYO76447.1|328009_329080_-	hypothetical protein	NA	NA	NA	NA	NA
AYO80454.1|329079_329397_-	DUF1064 domain-containing protein	NA	A0A248SL54	Klebsiella_phage	55.9	3.5e-26
AYO76448.1|329513_330212_-	DUF2312 domain-containing protein	NA	B0VK10	Azospirillum_phage	61.8	1.7e-17
>prophage 3
CP033230	Sphingobium yanoikuyae strain SJTF8 chromosome, complete genome	5172777	998419	1068709	5172777	protease,transposase	Acidithiobacillus_phage(18.18%)	59	NA	NA
AYO77017.1|998419_999721_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	29.8	2.3e-39
AYO77018.1|999738_1000305_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
AYO77019.1|1000488_1000674_+	hypothetical protein	NA	NA	NA	NA	NA
AYO77020.1|1000723_1000852_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
AYO77021.1|1001555_1001984_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
AYO77022.1|1001980_1002418_+	RES domain-containing protein	NA	NA	NA	NA	NA
AYO77023.1|1003045_1003963_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYO77024.1|1004233_1006810_+	hypothetical protein	NA	NA	NA	NA	NA
AYO77025.1|1006896_1008177_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.4	4.9e-26
AYO80499.1|1008209_1009661_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYO77026.1|1009708_1011100_+	amino acid permease	NA	NA	NA	NA	NA
AYO77027.1|1011096_1012797_+	amidohydrolase	NA	NA	NA	NA	NA
AYO77028.1|1012793_1013057_+	hypothetical protein	NA	NA	NA	NA	NA
AYO77029.1|1013049_1013508_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYO77030.1|1013566_1015285_+	amidohydrolase	NA	NA	NA	NA	NA
AYO80500.1|1015632_1016082_+	restriction endonuclease	NA	NA	NA	NA	NA
AYO80501.1|1016091_1016358_-	hypothetical protein	NA	NA	NA	NA	NA
AYO77031.1|1016481_1016742_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AYO77032.1|1016738_1017044_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AYO77033.1|1017433_1017862_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
AYO77034.1|1017858_1018146_+	RES domain-containing protein	NA	NA	NA	NA	NA
AYO77035.1|1018085_1018571_+	CRTAC1 family protein	NA	NA	NA	NA	NA
AYO77036.1|1019234_1020440_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
AYO80502.1|1020456_1021449_-	dipeptide epimerase	NA	NA	NA	NA	NA
AYO77037.1|1021454_1022492_-	DUF1611 domain-containing protein	NA	NA	NA	NA	NA
AYO80503.1|1022586_1023471_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYO80504.1|1023676_1025269_+	D-aminoacylase	NA	NA	NA	NA	NA
AYO80505.1|1025518_1028341_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.2	5.8e-11
AYO77038.1|1028800_1031182_+	penicillin acylase family protein	NA	NA	NA	NA	NA
AYO77039.1|1031185_1032640_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
AYO80506.1|1032821_1033946_+	class A beta-lactamase-related serine hydrolase	NA	NA	NA	NA	NA
AYO77040.1|1033942_1034959_-	class A beta-lactamase-related serine hydrolase	NA	NA	NA	NA	NA
AYO77041.1|1034968_1036462_-	permease	NA	NA	NA	NA	NA
AYO77042.1|1036462_1037194_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYO77043.1|1037200_1038091_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
AYO77044.1|1038263_1039322_+	SIS domain-containing protein	NA	NA	NA	NA	NA
AYO77045.1|1039318_1040470_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AYO77046.1|1040466_1042164_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
AYO77047.1|1042160_1043015_+	ATPase	NA	NA	NA	NA	NA
AYO77048.1|1043288_1043747_-	transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	50.4	4.3e-25
AYO77049.1|1043910_1044186_-	hypothetical protein	NA	NA	NA	NA	NA
AYO77050.1|1044435_1045683_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AYO77051.1|1047511_1048426_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYO77052.1|1049036_1049396_+	hypothetical protein	NA	NA	NA	NA	NA
AYO77053.1|1049605_1050370_+	serine/threonine protein phosphatase	NA	K4K4W7	Caulobacter_virus	35.1	1.3e-26
AYO77054.1|1052985_1054515_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.8	1.5e-125
AYO80507.1|1054526_1055267_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.8	9.7e-59
AYO77055.1|1056508_1056955_-	hypothetical protein	NA	NA	NA	NA	NA
AYO77056.1|1057328_1057667_+	hypothetical protein	NA	NA	NA	NA	NA
AYO77057.1|1057682_1057988_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AYO77058.1|1058016_1059240_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.5	2.3e-41
AYO77059.1|1059540_1062441_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AYO77060.1|1062746_1063208_-	pesticin immunity protein	NA	NA	NA	NA	NA
AYO77061.1|1063434_1063626_+	hypothetical protein	NA	NA	NA	NA	NA
AYO77062.1|1064667_1065261_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	52.2	7.3e-25
AYO77063.1|1065265_1066282_+	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	35.7	1.3e-32
AYO77064.1|1066366_1067935_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	36.7	1.3e-84
AYO77065.1|1068002_1068356_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AYO77066.1|1068352_1068709_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
CP033230	Sphingobium yanoikuyae strain SJTF8 chromosome, complete genome	5172777	1126206	1149350	5172777	integrase,transposase	Thermus_phage(25.0%)	15	1130224:1130258	1134015:1134049
AYO77113.1|1126206_1127247_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.6	2.2e-08
AYO77114.1|1128053_1129004_-	EAL domain-containing protein	NA	NA	NA	NA	NA
1130224:1130258	attL	ACTAATCATCAGGTGACCATAATGCGAAGGAACGC	NA	NA	NA	NA
AYO77115.1|1130365_1131598_+|integrase	integrase	integrase	NA	NA	NA	NA
AYO80518.1|1131597_1132962_+|integrase	integrase	integrase	NA	NA	NA	NA
AYO77116.1|1132958_1133963_+|integrase	integrase	integrase	NA	NA	NA	NA
AYO77117.1|1134713_1135172_-	MaoC family dehydratase	NA	NA	NA	NA	NA
1134015:1134049	attR	GCGTTCCTTCGCATTATGGTCACCTGATGATTAGT	NA	NA	NA	NA
AYO77118.1|1135179_1136829_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.1	4.5e-24
AYO77119.1|1136856_1138617_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AYO77120.1|1138638_1140936_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AYO77121.1|1140937_1142059_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
AYO80519.1|1142087_1143740_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
AYO80520.1|1143982_1144585_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYO77122.1|1144861_1145563_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	33.2	6.2e-23
AYO77123.1|1147035_1147845_-	hypothetical protein	NA	U5N3V8	Enterobacteria_phage	32.9	1.2e-30
AYO77124.1|1147844_1149350_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 5
CP033230	Sphingobium yanoikuyae strain SJTF8 chromosome, complete genome	5172777	1232619	1304444	5172777	transposase	Synechococcus_phage(14.29%)	58	NA	NA
AYO77173.1|1232619_1232967_+|transposase	transposase	transposase	NA	NA	NA	NA
AYO77174.1|1232915_1233764_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.8	8.6e-35
AYO77175.1|1234031_1234910_+	universal stress protein	NA	NA	NA	NA	NA
AYO77176.1|1235118_1238046_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
AYO77177.1|1238045_1238387_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
AYO77178.1|1238383_1240006_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
AYO80532.1|1240005_1240485_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
AYO80533.1|1240502_1240763_+	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
AYO80534.1|1240762_1241164_+	cation:proton antiporter	NA	NA	NA	NA	NA
AYO77179.1|1243479_1243860_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AYO77180.1|1243899_1244433_-	DUF937 domain-containing protein	NA	NA	NA	NA	NA
AYO77181.1|1244605_1245196_-	hypothetical protein	NA	NA	NA	NA	NA
AYO77182.1|1245282_1246431_+	transcriptional regulator	NA	NA	NA	NA	NA
AYO80535.1|1246535_1246967_+	PaaI family thioesterase	NA	NA	NA	NA	NA
AYO77183.1|1247182_1247560_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
AYO77184.1|1247746_1248640_+	J domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	31.8	2.1e-28
AYO77185.1|1248636_1248975_+	hypothetical protein	NA	NA	NA	NA	NA
AYO77186.1|1250663_1251224_-	PRC-barrel domain containing protein	NA	NA	NA	NA	NA
AYO77187.1|1251382_1251946_+	SRPBCC family protein	NA	NA	NA	NA	NA
AYO77188.1|1251951_1253151_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.2	7.4e-08
AYO77189.1|1253169_1253526_-	response regulator	NA	NA	NA	NA	NA
AYO77190.1|1253671_1254094_-	DUF3597 family protein	NA	NA	NA	NA	NA
AYO77191.1|1254231_1254786_+	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
AYO77192.1|1254877_1255294_-	low affinity iron permease family protein	NA	Q19XG2	Mycobacterium_phage	41.6	3.1e-06
AYO80536.1|1255500_1255686_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
AYO77193.1|1256300_1258193_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	34.4	1.9e-95
AYO77194.1|1263373_1263577_-	hypothetical protein	NA	NA	NA	NA	NA
AYO77195.1|1263667_1263931_+	hypothetical protein	NA	NA	NA	NA	NA
AYO77196.1|1263964_1264915_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2I2L5E1	Orpheovirus	26.3	2.9e-15
AYO77197.1|1266067_1267369_+	glycosyltransferase	NA	NA	NA	NA	NA
AYO77198.1|1267534_1270933_+	DEAD/DEAH box helicase	NA	S5N3Q5	Choristoneura_occidentalis_alphabaculovirus	29.3	1.2e-42
AYO77199.1|1271270_1272782_-	hypothetical protein	NA	NA	NA	NA	NA
AYO77200.1|1273224_1274247_+	glycosyltransferase	NA	NA	NA	NA	NA
AYO77201.1|1274243_1275449_+	glycosyltransferase	NA	NA	NA	NA	NA
AYO77202.1|1275508_1275802_+	acyl carrier protein	NA	NA	NA	NA	NA
AYO77203.1|1275847_1277386_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	34.9	2.6e-58
AYO77204.1|1277372_1278590_+	hypothetical protein	NA	NA	NA	NA	NA
AYO77205.1|1278858_1280376_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
AYO77206.1|1280379_1281702_+	hypothetical protein	NA	NA	NA	NA	NA
AYO80537.1|1281990_1282680_+	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
AYO77207.1|1282717_1285135_+	hypothetical protein	NA	NA	NA	NA	NA
AYO77208.1|1285113_1287300_+	acyltransferase	NA	A0A166XZF2	Gordonia_phage	27.0	2.1e-48
AYO77209.1|1287613_1288657_+	mannose-1-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AYO77210.1|1288667_1289501_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYO77211.1|1289572_1291063_+	phosphomannomutase	NA	NA	NA	NA	NA
AYO77212.1|1291254_1292421_+	nucleotide sugar dehydrogenase	NA	M1HZB2	Paramecium_bursaria_Chlorella_virus	54.6	2.7e-108
AYO77213.1|1292458_1293586_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	66.0	5.3e-133
AYO77214.1|1293599_1294544_+	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	51.4	4.4e-88
AYO77215.1|1294700_1295405_+	glycosyltransferase	NA	NA	NA	NA	NA
AYO77216.1|1295421_1295961_+	antibiotic acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.9	1.8e-06
AYO77217.1|1295957_1297082_+	glycosyltransferase	NA	NA	NA	NA	NA
AYO77218.1|1297665_1298172_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AYO77219.1|1298415_1299525_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYO77220.1|1299792_1300149_+|transposase	transposase	transposase	NA	NA	NA	NA
AYO77221.1|1300145_1300499_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AYO80538.1|1301945_1303472_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	38.2	1.2e-82
AYO77222.1|1303626_1303980_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AYO77223.1|1303976_1304444_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
CP033230	Sphingobium yanoikuyae strain SJTF8 chromosome, complete genome	5172777	1388795	1445854	5172777	integrase,transposase	Aureococcus_anophage(20.0%)	47	1413189:1413206	1449844:1449861
AYO77289.1|1388795_1390154_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	48.2	6.4e-117
AYO77290.1|1392103_1392298_-	hypothetical protein	NA	NA	NA	NA	NA
AYO77291.1|1392294_1392945_-	DUF159 family protein	NA	NA	NA	NA	NA
AYO77292.1|1392989_1393166_-	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
AYO77293.1|1393315_1395157_+	DNA ligase D	NA	A0A291AUP8	Sinorhizobium_phage	40.7	4.1e-58
AYO77294.1|1395153_1395954_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
AYO77295.1|1396057_1396273_+	hypothetical protein	NA	NA	NA	NA	NA
AYO77296.1|1396528_1396714_+	hypothetical protein	NA	NA	NA	NA	NA
AYO77297.1|1396877_1397222_-	hypothetical protein	NA	NA	NA	NA	NA
AYO80548.1|1398841_1399027_+	hypothetical protein	NA	NA	NA	NA	NA
AYO77298.1|1399013_1399352_+	hypothetical protein	NA	NA	NA	NA	NA
AYO80549.1|1400372_1401044_+	protein ImuA	NA	NA	NA	NA	NA
AYO77299.1|1401174_1402770_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
AYO77300.1|1402766_1405982_+	DNA polymerase III subunit alpha	NA	A0A2H4P750	Pseudomonas_phage	31.4	2.6e-60
AYO77301.1|1406096_1406495_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYO80550.1|1406584_1406911_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AYO77302.1|1407153_1407582_-	hypothetical protein	NA	NA	NA	NA	NA
AYO80551.1|1407647_1407998_-	hypothetical protein	NA	NA	NA	NA	NA
AYO77303.1|1408061_1408664_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AYO77304.1|1409553_1409934_+	hypothetical protein	NA	A0A0H4IPK0	Shigella_phage	34.3	8.0e-09
AYO77305.1|1409966_1411973_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
AYO77306.1|1412239_1414369_+	methylase	NA	A0A076FMQ0	Aureococcus_anophage	26.9	1.9e-14
1413189:1413206	attL	GCCCGCGCGCTGCCGCTG	NA	NA	NA	NA
AYO77307.1|1414413_1415418_-|integrase	integrase	integrase	NA	NA	NA	NA
AYO77308.1|1415414_1416770_-|integrase	integrase	integrase	NA	NA	NA	NA
AYO77309.1|1416766_1417999_-|integrase	integrase	integrase	A0A1P8DJ76	Virus_Rctr85	27.3	2.1e-05
AYO80552.1|1418186_1420259_+	methylase	NA	A0A076FMQ0	Aureococcus_anophage	32.3	4.1e-14
AYO77310.1|1420372_1421563_+	DUF932 domain-containing protein	NA	A0A1V0DX75	Synechococcus_virus	40.7	3.8e-73
AYO80553.1|1421613_1422234_+	hypothetical protein	NA	NA	NA	NA	NA
AYO77311.1|1422575_1423394_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AYO80554.1|1423426_1426498_-	PAS domain S-box protein	NA	NA	NA	NA	NA
AYO77312.1|1426583_1428569_-	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	22.3	1.2e-10
AYO80555.1|1428565_1428742_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AYO77313.1|1429094_1429622_-	hypothetical protein	NA	NA	NA	NA	NA
AYO77314.1|1429821_1431021_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	48.0	8.0e-95
AYO77315.1|1431435_1431945_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
AYO77316.1|1432280_1432739_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
AYO77317.1|1432813_1433857_+	DUF2493 domain-containing protein	NA	NA	NA	NA	NA
AYO77318.1|1433843_1434059_+	hypothetical protein	NA	NA	NA	NA	NA
AYO80556.1|1434466_1435450_+	DUF2493 domain-containing protein	NA	NA	NA	NA	NA
AYO77319.1|1435637_1435898_-	hypothetical protein	NA	NA	NA	NA	NA
AYO77320.1|1436381_1436684_+	hypothetical protein	NA	NA	NA	NA	NA
AYO77321.1|1436680_1438684_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
AYO77322.1|1438680_1441614_+	conjugative relaxase	NA	NA	NA	NA	NA
AYO80557.1|1441669_1442128_+	murein transglycosylase	NA	NA	NA	NA	NA
AYO80558.1|1442493_1442727_+	DNA-binding protein	NA	NA	NA	NA	NA
AYO77323.1|1443005_1443224_+	hypothetical protein	NA	NA	NA	NA	NA
AYO80559.1|1444687_1445854_-|integrase	integrase	integrase	NA	NA	NA	NA
1449844:1449861	attR	GCCCGCGCGCTGCCGCTG	NA	NA	NA	NA
>prophage 7
CP033230	Sphingobium yanoikuyae strain SJTF8 chromosome, complete genome	5172777	1509130	1518054	5172777	tRNA,protease	Synechococcus_phage(16.67%)	9	NA	NA
AYO77364.1|1509130_1510102_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	46.4	4.7e-13
AYO77365.1|1510149_1511313_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	33.8	1.9e-45
AYO77366.1|1511309_1511936_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	32.5	5.0e-16
AYO77367.1|1511932_1512904_+	AAA family ATPase	NA	A0A1U9WR94	Streptococcus_virus	30.5	6.6e-07
AYO77368.1|1512947_1514516_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.8	8.3e-92
AYO77369.1|1514520_1515309_+	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
AYO77370.1|1515305_1516094_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYO77371.1|1516093_1516753_+|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
AYO77372.1|1516749_1518054_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.0	1.9e-49
>prophage 8
CP033230	Sphingobium yanoikuyae strain SJTF8 chromosome, complete genome	5172777	2352348	2357972	5172777		uncultured_Mediterranean_phage(66.67%)	8	NA	NA
AYO78043.1|2352348_2353341_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	41.6	6.9e-52
AYO80615.1|2353538_2354516_+	cell wall hydrolase	NA	A0A0S1WEP8	Vibrio_phage	31.0	4.6e-08
AYO78044.1|2354888_2355017_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
AYO78045.1|2355052_2355844_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	42.9	2.0e-46
AYO78046.1|2355840_2356305_-	translocase	NA	NA	NA	NA	NA
AYO78047.1|2356331_2356571_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	75.0	4.0e-06
AYO78048.1|2356599_2357193_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	43.9	8.9e-39
AYO78049.1|2357189_2357972_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	31.5	3.7e-32
>prophage 9
CP033230	Sphingobium yanoikuyae strain SJTF8 chromosome, complete genome	5172777	2665013	2676842	5172777	capsid,tail,head,portal,terminase,protease	Burkholderia_phage(33.33%)	11	NA	NA
AYO78321.1|2665013_2665358_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AYO78322.1|2665357_2665927_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
AYO80632.1|2665945_2666137_-	hypothetical protein	NA	NA	NA	NA	NA
AYO78323.1|2666341_2667571_-|capsid	phage major capsid protein	capsid	C7BGH0	Burkholderia_phage	47.2	4.6e-90
AYO78324.1|2667639_2668443_-|protease	Clp protease ClpP	protease	C7BGG9	Burkholderia_phage	43.4	3.9e-37
AYO78325.1|2668381_2669665_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	35.9	1.6e-45
AYO78326.1|2669661_2671398_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	35.1	6.0e-75
AYO78327.1|2671399_2672047_-|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
AYO78328.1|2672195_2672597_-	hypothetical protein	NA	Q38456	Bacillus_phage	37.1	4.8e-12
AYO78329.1|2672928_2673357_-	hypothetical protein	NA	NA	NA	NA	NA
AYO78330.1|2673608_2676842_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	40.8	1.4e-72
>prophage 10
CP033230	Sphingobium yanoikuyae strain SJTF8 chromosome, complete genome	5172777	3135891	3194763	5172777	integrase,transposase	uncultured_virus(16.67%)	56	3158080:3158096	3188169:3188185
AYO78692.1|3135891_3137069_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AYO78693.1|3137487_3137742_+	hypothetical protein	NA	NA	NA	NA	NA
AYO78694.1|3138768_3139131_+	hypothetical protein	NA	NA	NA	NA	NA
AYO78695.1|3139193_3139703_-	hypothetical protein	NA	NA	NA	NA	NA
AYO78696.1|3140006_3141230_+|transposase	IS256-like element ISSpwi2 family transposase	transposase	A0A218MNI5	uncultured_virus	43.0	2.6e-40
AYO80665.1|3142036_3142909_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
AYO78697.1|3143109_3143799_-	type VI secretion protein	NA	NA	NA	NA	NA
AYO78698.1|3143795_3144584_-	hypothetical protein	NA	NA	NA	NA	NA
AYO78699.1|3144580_3145828_-	type IV secretion system protein	NA	NA	NA	NA	NA
AYO80666.1|3145827_3148152_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
AYO78700.1|3148187_3148472_-	type VI secretion protein	NA	NA	NA	NA	NA
AYO78701.1|3148475_3148766_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
AYO78702.1|3149241_3150513_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AYO78703.1|3150817_3152998_-	hypothetical protein	NA	NA	NA	NA	NA
AYO80667.1|3153474_3153807_+	hypothetical protein	NA	NA	NA	NA	NA
AYO78704.1|3154083_3154518_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYO78705.1|3154514_3155255_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.5	1.3e-74
AYO78706.1|3155325_3155991_-	cytochrome B	NA	NA	NA	NA	NA
AYO78707.1|3156056_3157322_-	TolC family protein	NA	NA	NA	NA	NA
AYO78708.1|3157318_3157618_-	DUF3240 domain-containing protein	NA	NA	NA	NA	NA
AYO78709.1|3157610_3160700_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.8	1.6e-75
3158080:3158096	attL	AGCAGGACGAAGAAGAT	NA	NA	NA	NA
AYO78710.1|3160709_3161819_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYO78711.1|3161867_3162881_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AYO78712.1|3162874_3163555_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYO78713.1|3163760_3164453_+	VIT family protein	NA	NA	NA	NA	NA
AYO78714.1|3164573_3164966_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AYO78715.1|3164962_3165586_-	peroxiredoxin	NA	NA	NA	NA	NA
AYO78716.1|3165673_3166591_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYO78717.1|3166587_3167037_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
AYO78718.1|3167053_3167260_+	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
AYO78719.1|3167256_3167667_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
AYO78720.1|3167704_3169288_+	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
AYO78721.1|3169291_3170077_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AYO78722.1|3170089_3171484_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AYO78723.1|3171480_3172479_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AYO78724.1|3172478_3172583_+	DUF2474 family protein	NA	NA	NA	NA	NA
AYO78725.1|3172964_3173597_-|integrase	integrase	integrase	A0A0A8WF93	Clostridium_phage	29.9	7.8e-09
AYO78726.1|3173786_3174590_+	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AYO78727.1|3174645_3175239_-	hypothetical protein	NA	NA	NA	NA	NA
AYO78728.1|3175241_3177428_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AYO78729.1|3177556_3178885_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
AYO78730.1|3178884_3179559_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.4	2.0e-31
AYO80668.1|3179567_3180944_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
AYO78731.1|3180970_3184090_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AYO80669.1|3184089_3185079_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYO80670.1|3185191_3185737_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AYO78732.1|3186119_3187292_-	glycosyltransferase	NA	NA	NA	NA	NA
AYO78733.1|3187295_3187799_-	DUF2141 domain-containing protein	NA	NA	NA	NA	NA
AYO78734.1|3187795_3188674_-	hypothetical protein	NA	NA	NA	NA	NA
3188169:3188185	attR	AGCAGGACGAAGAAGAT	NA	NA	NA	NA
AYO78735.1|3188793_3189987_-	glycosyltransferase	NA	NA	NA	NA	NA
AYO78736.1|3189964_3190708_-	DUF2334 domain-containing protein	NA	NA	NA	NA	NA
AYO78737.1|3190704_3191478_-	hypothetical protein	NA	NA	NA	NA	NA
AYO78738.1|3191659_3192235_+	hypothetical protein	NA	NA	NA	NA	NA
AYO80671.1|3192279_3193806_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	38.7	1.4e-83
AYO78739.1|3193960_3194314_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AYO78740.1|3194310_3194763_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
CP033230	Sphingobium yanoikuyae strain SJTF8 chromosome, complete genome	5172777	4813084	4819715	5172777	capsid,tail,head,portal,terminase,protease	Burkholderia_phage(25.0%)	8	NA	NA
AYO80115.1|4813084_4813414_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AYO80116.1|4813410_4813935_-	hypothetical protein	NA	NA	NA	NA	NA
AYO80117.1|4813980_4814223_-	hypothetical protein	NA	NA	NA	NA	NA
AYO80809.1|4814278_4815529_-|capsid	phage major capsid protein	capsid	Q3HQT0	Burkholderia_phage	56.3	3.1e-126
AYO80118.1|4815546_4816422_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	44.2	2.8e-41
AYO80119.1|4816411_4817722_-|portal	phage portal protein	portal	A0A141GEV9	Brucella_phage	42.9	6.9e-76
AYO80120.1|4817730_4819248_-|terminase	terminase large subunit	terminase	F1C585	Cronobacter_phage	60.3	1.3e-163
AYO80121.1|4819244_4819715_-|terminase	terminase small subunit	terminase	NA	NA	NA	NA
>prophage 12
CP033230	Sphingobium yanoikuyae strain SJTF8 chromosome, complete genome	5172777	4910658	4961270	5172777	transposase	Sinorhizobium_phage(18.18%)	46	NA	NA
AYO80204.1|4910658_4912017_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	48.2	8.4e-117
AYO80205.1|4913692_4914358_+	ATPase	NA	A0A059NT77	Lactococcus_phage	32.7	5.0e-22
AYO80206.1|4914551_4915364_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AYO80207.1|4915588_4916320_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYO80208.1|4916416_4917088_+	hypothetical protein	NA	NA	NA	NA	NA
AYO80209.1|4917152_4917461_+|transposase	IS5/IS1182 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	38.8	2.9e-09
AYO80210.1|4917428_4918148_-	hypothetical protein	NA	Q9ZXK4	Pseudomonas_virus	35.5	1.5e-43
AYO80211.1|4918162_4918513_-	oxidoreductase	NA	V9IQW0	Stenotrophomonas_phage	46.5	1.7e-21
AYO80212.1|4919007_4920408_+	hypothetical protein	NA	NA	NA	NA	NA
AYO80213.1|4921557_4921737_-	hypothetical protein	NA	NA	NA	NA	NA
AYO80214.1|4922534_4923590_-	hypothetical protein	NA	NA	NA	NA	NA
AYO80215.1|4924046_4925054_+	nucleoid-associated protein	NA	A0A291AUQ0	Sinorhizobium_phage	42.3	1.1e-70
AYO80216.1|4925046_4926228_+	hypothetical protein	NA	A0A291AUQ1	Sinorhizobium_phage	40.3	2.2e-73
AYO80217.1|4926681_4927017_+	hypothetical protein	NA	NA	NA	NA	NA
AYO80218.1|4927091_4928354_+	TolC family protein	NA	NA	NA	NA	NA
AYO80219.1|4928357_4929515_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYO80220.1|4929519_4932747_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
AYO80221.1|4932809_4933304_+	hypothetical protein	NA	NA	NA	NA	NA
AYO80222.1|4933296_4933920_+	cation transporter	NA	NA	NA	NA	NA
AYO80223.1|4933921_4934224_+	hypothetical protein	NA	NA	NA	NA	NA
AYO80224.1|4934388_4934736_+	hypothetical protein	NA	NA	NA	NA	NA
AYO80225.1|4934776_4937272_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	39.9	3.1e-117
AYO80226.1|4937302_4937767_+	hypothetical protein	NA	NA	NA	NA	NA
AYO80227.1|4937819_4938695_+	hypothetical protein	NA	NA	NA	NA	NA
AYO80818.1|4938840_4939464_+	carbonic anhydrase	NA	NA	NA	NA	NA
AYO80228.1|4939657_4941007_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
AYO80229.1|4940996_4942454_+	hypothetical protein	NA	NA	NA	NA	NA
AYO80819.1|4942556_4943459_-	cation transporter	NA	NA	NA	NA	NA
AYO80230.1|4943509_4943785_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
AYO80231.1|4943889_4944087_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
AYO80232.1|4944137_4944473_-	hypothetical protein	NA	NA	NA	NA	NA
AYO80233.1|4944652_4945881_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	68.4	7.4e-104
AYO80234.1|4946118_4947696_+	hypothetical protein	NA	E5E3S8	Burkholderia_phage	27.8	3.2e-11
AYO80820.1|4948008_4948200_-	hypothetical protein	NA	NA	NA	NA	NA
AYO80235.1|4948347_4948638_-	hypothetical protein	NA	NA	NA	NA	NA
AYO80236.1|4948745_4949711_-	hypothetical protein	NA	NA	NA	NA	NA
AYO80237.1|4950221_4950440_-	hypothetical protein	NA	NA	NA	NA	NA
AYO80238.1|4950692_4950872_+	hypothetical protein	NA	NA	NA	NA	NA
AYO80239.1|4950868_4952728_-	hypothetical protein	NA	NA	NA	NA	NA
AYO80240.1|4952724_4953675_-	hypothetical protein	NA	NA	NA	NA	NA
AYO80241.1|4953696_4955961_-|transposase	transposase	transposase	NA	NA	NA	NA
AYO80242.1|4956135_4956936_-	hypothetical protein	NA	NA	NA	NA	NA
AYO80243.1|4957249_4958431_+	hypothetical protein	NA	NA	NA	NA	NA
AYO80244.1|4958461_4959214_-	hypothetical protein	NA	NA	NA	NA	NA
AYO80245.1|4959261_4959966_-	hypothetical protein	NA	NA	NA	NA	NA
AYO80246.1|4960076_4961270_-|transposase	transposase	transposase	A0A2I7RKG5	Vibrio_phage	22.2	4.2e-11
>prophage 13
CP033230	Sphingobium yanoikuyae strain SJTF8 chromosome, complete genome	5172777	4968945	4981396	5172777	capsid,tail,head,portal,integrase,terminase,tRNA,protease	Synechococcus_phage(25.0%)	14	4966706:4966721	4977636:4977651
4966706:4966721	attL	TGGCGACCCCGGCAGG	NA	NA	NA	NA
AYO80822.1|4968945_4970532_+|terminase	terminase large subunit	terminase	Q9MCV7	Escherichia_phage	36.4	2.0e-85
AYO80254.1|4971058_4971241_-	hypothetical protein	NA	NA	NA	NA	NA
AYO80255.1|4971386_4971809_+	hypothetical protein	NA	NA	NA	NA	NA
AYO80256.1|4971805_4972111_+	hypothetical protein	NA	NA	NA	NA	NA
AYO80257.1|4972142_4972820_+	hypothetical protein	NA	NA	NA	NA	NA
AYO80258.1|4973153_4974365_+|capsid	phage major capsid protein	capsid	A0A2I5ARA4	Synechococcus_phage	35.2	1.8e-38
AYO80259.1|4974364_4974901_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2K9VGN9	Pontimonas_phage	48.1	8.3e-28
AYO80260.1|4974897_4976088_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	34.5	1.1e-43
AYO80261.1|4975948_4976350_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
AYO80262.1|4976546_4977626_+|integrase	site-specific integrase	integrase	A0A291AUF0	Sinorhizobium_phage	32.6	5.0e-40
AYO80263.1|4977799_4978519_+	VUT family protein	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	33.8	2.6e-16
4977636:4977651	attR	TGGCGACCCCGGCAGG	NA	NA	NA	NA
AYO80264.1|4978807_4979752_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	27.7	1.1e-14
AYO80265.1|4979724_4980483_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AYO80266.1|4980487_4981396_-|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	34.7	5.8e-05
>prophage 1
CP033227	Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence	505328	2266	50576	505328	transposase,integrase	Gordonia_phage(16.67%)	41	27472:27517	31239:31284
AYO75445.1|2266_3394_-|integrase	integrase	integrase	NA	NA	NA	NA
AYO75446.1|3390_4671_-	hypothetical protein	NA	NA	NA	NA	NA
AYO75447.1|4733_5498_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	67.8	3.8e-90
AYO75448.1|5771_8573_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AYO75449.1|8550_9285_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AYO75450.1|9308_9920_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
AYO75451.1|12648_13617_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	47.6	3.3e-30
AYO75452.1|13990_15175_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75453.1|15395_16415_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
AYO75873.1|17094_18321_-	chromosome partitioning protein	NA	Q7Y3Y6	Yersinia_phage	32.3	3.0e-33
AYO75454.1|18961_20272_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75455.1|20625_21468_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYO75874.1|21754_21949_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75456.1|21915_22545_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	47.9	9.5e-23
AYO75457.1|23419_24082_+	ParA family protein	NA	A0A0A8IL09	Aurantimonas_phage	45.4	1.5e-39
AYO75458.1|24078_24372_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
AYO75459.1|24424_25264_+	virulence-associated protein E	NA	A0A0H5AWB1	Pseudomonas_phage	29.2	4.5e-12
AYO75460.1|25321_27517_+	methylase	NA	A0A076FMQ0	Aureococcus_anophage	23.8	1.2e-16
27472:27517	attL	GATTGCTTATCGCGAGGAAGCGATAATGCGCAGGAACGCGGCGTAG	NA	NA	NA	NA
AYO75461.1|27607_28840_+|integrase	integrase	integrase	A0A0K2CP59	Brevibacillus_phage	26.1	1.9e-06
AYO75462.1|28836_30192_+|integrase	integrase	integrase	NA	NA	NA	NA
AYO75463.1|30188_31193_+|integrase	integrase	integrase	A0A142K8S6	Gordonia_phage	23.9	3.8e-05
AYO75875.1|31638_33363_+	methylase	NA	NA	NA	NA	NA
31239:31284	attR	CTACGCCGCGTTCCTGCGCATTATCGCTTCCTCGCGATAAGCAATC	NA	NA	NA	NA
AYO75464.1|33518_35615_+	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	28.1	4.2e-06
AYO75465.1|35727_36666_+	DUF1738 domain-containing protein	NA	A0A1V0EBY3	Caulobacter_phage	47.9	2.6e-61
AYO75466.1|36681_37170_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75467.1|37238_37883_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75468.1|37917_38532_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75469.1|38564_38771_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75470.1|38767_39283_+	thermonuclease family protein	NA	NA	NA	NA	NA
AYO75471.1|39347_39872_-	hypothetical protein	NA	NA	NA	NA	NA
AYO75472.1|39947_41255_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75473.1|41359_42031_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75474.1|42041_42611_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75475.1|42607_43813_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
AYO75476.1|43809_45042_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75477.1|45038_45287_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75478.1|45317_47006_+	ATP-binding protein	NA	NA	NA	NA	NA
AYO75479.1|47007_47202_+	hypothetical protein	NA	A0A1W6DXD5	Sphingobium_phage	63.2	3.2e-14
AYO75480.1|48298_49348_-	hypothetical protein	NA	NA	NA	NA	NA
AYO75481.1|49379_49685_-	hypothetical protein	NA	NA	NA	NA	NA
AYO75482.1|49742_50576_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP033227	Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence	505328	236311	330965	505328	transposase,integrase	Escherichia_phage(20.0%)	94	318161:318175	337572:337586
AYO75636.1|236311_237076_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AYO75637.1|237289_239800_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AYO75638.1|239863_240610_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.8	7.1e-09
AYO75639.1|240606_241815_-	FAD-binding monooxygenase	NA	NA	NA	NA	NA
AYO75640.1|241811_242717_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AYO75641.1|242713_243283_-	hypothetical protein	NA	NA	NA	NA	NA
AYO75642.1|243279_243705_-	hypothetical protein	NA	NA	NA	NA	NA
AYO75890.1|243701_245270_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AYO75643.1|245494_246109_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYO75644.1|246199_246964_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	67.8	3.8e-90
AYO75891.1|247152_248721_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AYO75645.1|248717_249143_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75646.1|249139_249709_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75647.1|249705_250611_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AYO75648.1|250607_251816_+	FAD-binding monooxygenase	NA	NA	NA	NA	NA
AYO75649.1|251812_252559_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.3	3.2e-09
AYO75650.1|252837_253602_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.2	3.6e-85
AYO75651.1|253708_254146_+	pseudoazurin	NA	NA	NA	NA	NA
AYO75652.1|254264_255389_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
AYO75653.1|255487_256945_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
AYO75654.1|257069_257555_-	hypothetical protein	NA	NA	NA	NA	NA
AYO75655.1|257605_257848_-	hypothetical protein	NA	NA	NA	NA	NA
AYO75656.1|257924_258623_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYO75657.1|259175_259433_+	antitoxin	NA	NA	NA	NA	NA
AYO75658.1|259429_259756_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
AYO75659.1|259858_260152_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AYO75660.1|260139_260418_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AYO75661.1|260967_261732_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.2	3.6e-85
AYO75662.1|261815_262145_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
AYO75892.1|262224_263601_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.4	2.0e-41
AYO75663.1|263692_266662_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	4.1e-209
AYO75664.1|266822_267593_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AYO75665.1|267661_268864_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AYO75893.1|268863_269538_-	3-oxoacid CoA-transferase subunit B	NA	NA	NA	NA	NA
AYO75666.1|269537_270248_-	CoA transferase subunit A	NA	NA	NA	NA	NA
AYO75667.1|270400_271300_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYO75668.1|271558_272071_+	hydroxyquinol 1,2-dioxygenase	NA	NA	NA	NA	NA
AYO75669.1|272116_273142_+	hydroxyquinol 1,2-dioxygenase	NA	NA	NA	NA	NA
AYO75670.1|273525_274596_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75671.1|274609_276106_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
AYO75672.1|276111_277170_+	maleylacetate reductase	NA	NA	NA	NA	NA
AYO75673.1|277166_277994_+	6-chlorohydroxyquinol-1,2-dioxygenase	NA	NA	NA	NA	NA
AYO75674.1|278000_278396_+	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AYO75675.1|278988_279570_-	YceI family protein	NA	NA	NA	NA	NA
AYO75676.1|279574_280165_-	cytochrome b	NA	NA	NA	NA	NA
AYO75677.1|280268_280880_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AYO75678.1|280937_281537_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
AYO75679.1|281760_282984_+|transposase	IS256-like element ISSpwi2 family transposase	transposase	A0A218MNI5	uncultured_virus	43.0	2.6e-40
AYO75680.1|283170_284070_+	pirin family protein	NA	NA	NA	NA	NA
AYO75894.1|284134_284437_-	YciI family protein	NA	NA	NA	NA	NA
AYO75681.1|285627_286851_-|transposase	IS256-like element ISSpwi2 family transposase	transposase	A0A218MNI5	uncultured_virus	43.0	2.6e-40
AYO75682.1|287253_287394_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75683.1|288088_288463_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AYO75684.1|288459_288786_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYO75685.1|288785_289028_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75686.1|289826_290045_-	hypothetical protein	NA	NA	NA	NA	NA
AYO75687.1|290154_291021_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	41.2	2.3e-27
AYO75688.1|290911_292462_+	catalase	NA	A0A2K9L0T1	Tupanvirus	38.2	5.0e-49
AYO75689.1|292536_294033_-	alkaline phosphatase	NA	NA	NA	NA	NA
AYO75895.1|293989_294733_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AYO75690.1|294702_295629_+	DUF4974 domain-containing protein	NA	NA	NA	NA	NA
AYO75691.1|295711_298195_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AYO75692.1|298922_299480_-	hypothetical protein	NA	NA	NA	NA	NA
AYO75896.1|300602_301619_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYO75693.1|302405_302660_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75694.1|303059_303320_+	hypothetical protein	NA	A0A2I7S8R6	Vibrio_phage	53.1	6.7e-07
AYO75897.1|303337_304774_+	DUF4942 domain-containing protein	NA	A0A1P8VVC9	Erythrobacter_phage	40.4	4.4e-23
AYO75695.1|305090_305339_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75696.1|305926_307198_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	40.4	6.4e-10
AYO75697.1|307954_308437_+	hypothetical protein	NA	A0A1X9SGN6	Bradyrhizobium_phage	46.2	2.7e-25
AYO75698.1|308693_308951_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75699.1|309172_309490_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75700.1|309787_310009_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75701.1|310071_310311_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75702.1|310936_311224_-	hypothetical protein	NA	NA	NA	NA	NA
AYO75703.1|311337_312228_-	DUF1259 domain-containing protein	NA	NA	NA	NA	NA
AYO75704.1|312423_313347_+	ChrB protein	NA	A0A219VHC0	Ochrobactrum_phage	52.4	1.6e-26
AYO75705.1|313349_314747_+	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	90.9	2.2e-40
AYO75706.1|314758_315490_+	superoxide dismutase	NA	NA	NA	NA	NA
AYO75707.1|315827_316613_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYO75708.1|316609_317161_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	56.6	3.5e-45
AYO75709.1|317300_320258_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	43.9	2.2e-234
318161:318175	attL	AAGCCTGACCGACGC	NA	NA	NA	NA
AYO75710.1|320528_321020_-	hypothetical protein	NA	NA	NA	NA	NA
AYO75711.1|321047_321641_-	hypothetical protein	NA	NA	NA	NA	NA
AYO75712.1|321637_322573_-	MCE family protein	NA	NA	NA	NA	NA
AYO75713.1|322573_323341_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.5	1.2e-16
AYO75898.1|323340_324252_-	ABC transporter permease	NA	NA	NA	NA	NA
AYO75714.1|324610_325558_+	MCE family protein	NA	NA	NA	NA	NA
AYO75899.1|325723_326362_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYO75715.1|326361_327960_+	ubiquinone biosynthesis protein	NA	G8DDN0	Micromonas_pusilla_virus	26.8	8.9e-25
AYO75716.1|328207_328819_+	sigma-70 family RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	32.6	7.8e-14
AYO75717.1|329066_329651_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	55.2	5.7e-46
AYO75718.1|329743_330013_-|transposase	transposase	transposase	NA	NA	NA	NA
AYO75719.1|329951_330965_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
337572:337586	attR	AAGCCTGACCGACGC	NA	NA	NA	NA
>prophage 1
CP033228	Sphingobium yanoikuyae strain SJTF8 plasmid pF2, complete sequence	191911	9978	51791	191911	transposase,integrase	Caulobacter_phage(25.0%)	41	35461:35477	53105:53121
AYO75926.1|9978_11370_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AYO75927.1|11539_11782_-	hypothetical protein	NA	NA	NA	NA	NA
AYO75928.1|12116_12452_-	single-stranded DNA-binding protein	NA	A0A291LA01	Bordetella_phage	33.3	7.1e-09
AYO75929.1|12913_13258_-	thermonuclease family protein	NA	NA	NA	NA	NA
AYO75930.1|13581_13770_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75931.1|13786_14476_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
AYO76087.1|14577_14769_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75932.1|14785_15142_-	hypothetical protein	NA	A0A1J0MCA7	Streptomyces_phage	41.5	1.2e-06
AYO75933.1|15299_15821_-	DUF736 domain-containing protein	NA	NA	NA	NA	NA
AYO75934.1|16285_16693_-	DUF3768 domain-containing protein	NA	NA	NA	NA	NA
AYO75935.1|16802_17291_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75936.1|17284_17518_-	hypothetical protein	NA	NA	NA	NA	NA
AYO76088.1|17541_17868_-	hypothetical protein	NA	NA	NA	NA	NA
AYO75937.1|18157_18814_-	hypothetical protein	NA	NA	NA	NA	NA
AYO76089.1|18903_19119_-	hypothetical protein	NA	A0A1V0EEV1	Caulobacter_phage	40.8	2.5e-07
AYO75938.1|19346_20480_+	recombinase XerD	NA	NA	NA	NA	NA
AYO75939.1|20479_22252_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AYO75940.1|22248_24084_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75941.1|24070_24514_+	hypothetical protein	NA	NA	NA	NA	NA
AYO75942.1|24497_25397_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	38.2	7.9e-47
AYO75943.1|25399_26110_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.9	3.4e-29
AYO75944.1|26191_28264_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.3	3.3e-32
AYO75945.1|28363_28738_-	hypothetical protein	NA	NA	NA	NA	NA
AYO76090.1|28734_29073_-	DUF433 domain-containing protein	NA	NA	NA	NA	NA
AYO75946.1|30915_32127_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	48.0	3.0e-97
AYO75947.1|32282_32636_-	hypothetical protein	NA	NA	NA	NA	NA
AYO75948.1|32692_34240_+|integrase	integrase	integrase	A0A0K2CP59	Brevibacillus_phage	30.1	7.8e-10
AYO75949.1|34233_35148_+|integrase	integrase	integrase	NA	NA	NA	NA
AYO75950.1|35144_36161_+|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	33.9	9.3e-12
35461:35477	attL	TTCGCGTCAGATCGATC	NA	NA	NA	NA
AYO75951.1|36150_37704_-	hypothetical protein	NA	NA	NA	NA	NA
AYO75952.1|38114_39119_-|integrase	integrase	integrase	S6C485	Thermus_phage	26.5	8.9e-07
AYO75953.1|39115_40471_-|integrase	integrase	integrase	NA	NA	NA	NA
AYO75954.1|40467_41700_-|integrase	integrase	integrase	NA	NA	NA	NA
AYO75955.1|41790_43989_-	methylase	NA	A0A076FMQ0	Aureococcus_anophage	25.4	2.0e-19
AYO75956.1|44057_44900_-	topoisomerase	NA	NA	NA	NA	NA
AYO75957.1|44974_46279_-	hypothetical protein	NA	NA	NA	NA	NA
AYO75958.1|46830_48036_+	chromosome partitioning protein	NA	A0A2I6B2X3	Macacine_betaherpesvirus	35.8	3.0e-41
AYO75959.1|48267_49251_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
AYO75960.1|49378_49657_+	WGR domain-containing protein	NA	NA	NA	NA	NA
AYO75961.1|49663_50602_-	hypothetical protein	NA	NA	NA	NA	NA
AYO75962.1|50765_51791_+|integrase	integrase	integrase	NA	NA	NA	NA
53105:53121	attR	TTCGCGTCAGATCGATC	NA	NA	NA	NA
