The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028478	Klebsiella pneumoniae strain 2e chromosome, complete genome	5231806	462329	507301	5231806	tail,tRNA,protease,integrase	Pseudomonas_phage(33.33%)	49	460655:460670	478976:478991
460655:460670	attL	GCGTTTCACCGTCAAA	NA	NA	NA	NA
AYO70213.1|462329_463559_+|integrase	integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	60.6	1.2e-146
AYO65924.1|463897_464077_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AYO65925.1|464085_464367_+	hypothetical protein	NA	NA	NA	NA	NA
AYO70214.1|464749_466042_+	P-loop ATPase	NA	A0A1B0Z1F4	Shewanella_phage	40.8	4.7e-77
AYO65926.1|466051_466273_+	hypothetical protein	NA	NA	NA	NA	NA
AYO65927.1|467005_467917_+	hypothetical protein	NA	NA	NA	NA	NA
AYO65928.1|467919_468234_+	hypothetical protein	NA	NA	NA	NA	NA
AYO65929.1|468623_468944_+	hypothetical protein	NA	NA	NA	NA	NA
AYO70215.1|468952_469150_+	hypothetical protein	NA	NA	NA	NA	NA
AYO65930.1|469164_471444_+|tail	phage tail tape measure protein	tail	V5YUN9	Pseudomonas_phage	40.8	1.1e-142
AYO65931.1|471527_471824_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AYO65932.1|471848_472814_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AYO65933.1|472971_473166_-	hypothetical protein	NA	NA	NA	NA	NA
AYO65934.1|473171_474053_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AYO65935.1|474064_475516_-	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AYO65936.1|475505_475748_-	hypothetical protein	NA	NA	NA	NA	NA
AYO65937.1|475858_477208_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AYO65938.1|477218_477686_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AYO65939.1|477708_478161_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AYO65940.1|478384_478993_-	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
478976:478991	attR	TTTGACGGTGAAACGC	NA	NA	NA	NA
AYO65941.1|478992_479994_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AYO65942.1|480223_480415_+	hypothetical protein	NA	NA	NA	NA	NA
AYO65943.1|480494_482435_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AYO65944.1|482556_482763_-	hypothetical protein	NA	NA	NA	NA	NA
AYO65945.1|482740_483784_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AYO65946.1|483854_484847_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AYO65947.1|484846_485335_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AYO65948.1|485342_485924_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AYO65949.1|485926_487396_+	ribonuclease G	NA	NA	NA	NA	NA
AYO65950.1|487433_491231_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
AYO65951.1|491319_492765_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AYO65952.1|492800_493730_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
AYO65953.1|493861_494065_+	protein AaeX	NA	NA	NA	NA	NA
AYO65954.1|494072_495005_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AYO65955.1|495010_496978_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AYO65956.1|497057_497333_+	hypothetical protein	NA	NA	NA	NA	NA
AYO65957.1|497383_497650_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AYO65958.1|497748_498012_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AYO65959.1|498387_498858_-	arginine repressor	NA	NA	NA	NA	NA
AYO65960.1|499272_500211_+	malate dehydrogenase	NA	NA	NA	NA	NA
AYO65961.1|500347_501406_-|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
AYO65962.1|501493_502861_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
AYO70216.1|503034_503433_-	DUF1043 domain-containing protein	NA	NA	NA	NA	NA
AYO65963.1|503623_504751_+	cell division protein ZapE	NA	NA	NA	NA	NA
AYO65964.1|505016_505445_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AYO65965.1|505460_505853_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AYO65966.1|505962_506166_-	hypothetical protein	NA	NA	NA	NA	NA
AYO65967.1|506164_506803_+	stringent starvation protein A	NA	NA	NA	NA	NA
AYO65968.1|506806_507301_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 2
CP028478	Klebsiella pneumoniae strain 2e chromosome, complete genome	5231806	1310678	1326749	5231806	terminase,integrase	Enterobacter_phage(31.82%)	24	1302218:1302232	1316631:1316645
1302218:1302232	attL	GCAGGCGCTGCTCGA	NA	NA	NA	NA
AYO66725.1|1310678_1312145_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
AYO66726.1|1312212_1313790_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AYO66727.1|1313981_1315232_+|integrase	integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.1	4.0e-206
AYO66728.1|1315248_1315440_-	hypothetical protein	NA	NA	NA	NA	NA
AYO66729.1|1315436_1316030_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.9	1.9e-110
AYO66730.1|1316026_1316683_-	morphogenetic protein	NA	H2BDG4	Pseudomonas_virus	46.6	4.6e-44
1316631:1316645	attR	TCGAGCAGCGCCTGC	NA	NA	NA	NA
AYO66731.1|1316679_1316838_-	DUF1317 domain-containing protein	NA	T1SAR0	Salmonella_phage	80.8	8.7e-18
AYO66732.1|1316830_1317124_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
AYO66733.1|1317233_1317482_-	transcriptional regulator	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
AYO66734.1|1317530_1318466_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	76.7	2.0e-141
AYO66735.1|1318462_1319284_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.6	3.6e-131
AYO66736.1|1319280_1319580_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	55.6	9.4e-21
AYO66737.1|1319946_1320528_-	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
AYO66738.1|1320682_1320916_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
AYO66739.1|1321062_1321272_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	79.7	1.0e-26
AYO66740.1|1321271_1322039_+	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.0	2.0e-139
AYO66741.1|1322035_1322821_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
AYO66742.1|1322940_1323285_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	85.1	6.9e-52
AYO66743.1|1323477_1323891_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	37.7	4.9e-12
AYO66744.1|1323887_1324088_+	hypothetical protein	NA	A0A1U8QWK2	Salmonella_phage	60.0	1.4e-09
AYO66745.1|1324696_1325161_+	hypothetical protein	NA	A0A248SKW5	Klebsiella_phage	75.0	5.7e-09
AYO66746.1|1325326_1325665_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	85.5	3.2e-49
AYO66747.1|1325741_1326071_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	57.0	7.9e-29
AYO66748.1|1326128_1326749_+|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	72.2	7.3e-76
>prophage 3
CP028478	Klebsiella pneumoniae strain 2e chromosome, complete genome	5231806	1330050	1355062	5231806	tail,holin	Salmonella_phage(40.91%)	26	NA	NA
AYO66752.1|1330050_1330257_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
AYO66753.1|1330271_1331954_+|tail	phage tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.8	2.3e-265
AYO66754.1|1331950_1332247_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	9.6e-34
AYO66755.1|1332249_1332933_+	peptidase	NA	T1SAP9	Salmonella_phage	75.5	7.8e-63
AYO66756.1|1332947_1333934_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	93.9	1.9e-179
AYO66757.1|1333987_1334425_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
AYO66758.1|1334435_1334777_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	4.0e-36
AYO66759.1|1334827_1335151_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	3.1e-46
AYO66760.1|1335150_1335756_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	79.0	2.5e-89
AYO66761.1|1335755_1338233_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.5	0.0e+00
AYO66762.1|1338232_1338697_+	hypothetical protein	NA	Q858G2	Salmonella_phage	80.5	3.8e-69
AYO66763.1|1338696_1339236_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	79.5	5.6e-72
AYO66764.1|1339246_1341868_+	Lytic transglycosylase, catalytic	NA	T1SBJ1	Salmonella_phage	53.1	1.6e-55
AYO66765.1|1341869_1343576_+	hypothetical protein	NA	NA	NA	NA	NA
AYO66766.1|1343575_1346122_+	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	45.8	1.4e-210
AYO66767.1|1346123_1346495_+	hypothetical protein	NA	NA	NA	NA	NA
AYO66768.1|1346541_1346919_-	hypothetical protein	NA	NA	NA	NA	NA
AYO70244.1|1346915_1347128_-	hypothetical protein	NA	NA	NA	NA	NA
AYO66769.1|1347370_1348069_-	anti-repressor protein	NA	G9L6E2	Escherichia_phage	61.6	4.8e-76
AYO70245.1|1348385_1348682_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	65.1	6.2e-25
AYO66770.1|1348838_1351169_+	hypothetical protein	NA	A0A249Y258	Klebsiella_phage	60.1	1.9e-201
AYO66771.1|1351176_1351584_+	hypothetical protein	NA	T1SA79	Salmonella_phage	82.7	1.4e-54
AYO66772.1|1351570_1351876_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	78.4	9.5e-37
AYO66773.1|1351865_1352495_+	endolysin	NA	Q858F0	Salmonella_phage	76.9	1.4e-90
AYO66774.1|1352491_1352974_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.0	1.1e-60
AYO66775.1|1353193_1355062_-	phosphatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
CP028478	Klebsiella pneumoniae strain 2e chromosome, complete genome	5231806	1439255	1502995	5231806	tail,holin,integrase,portal,head,tRNA,protease	Klebsiella_phage(28.89%)	69	1462261:1462284	1501955:1501978
AYO66852.1|1439255_1440674_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AYO66853.1|1440725_1441118_-	hypothetical protein	NA	NA	NA	NA	NA
AYO66854.1|1441121_1441475_-	hypothetical protein	NA	NA	NA	NA	NA
AYO66855.1|1442096_1444268_+	hypothetical protein	NA	NA	NA	NA	NA
AYO66856.1|1444316_1445519_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
AYO70248.1|1445865_1447107_+	divalent metal cation transporter	NA	NA	NA	NA	NA
AYO66857.1|1447164_1447524_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
AYO66858.1|1447654_1448620_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
AYO70249.1|1448826_1450488_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
AYO66859.1|1450484_1451720_-	ion channel protein	NA	NA	NA	NA	NA
AYO66860.1|1451983_1452949_+	glucokinase	NA	NA	NA	NA	NA
AYO70250.1|1453002_1453740_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
AYO66861.1|1453751_1455449_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
AYO66862.1|1455557_1455743_-	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
AYO66863.1|1455831_1457046_+	alanine transaminase	NA	NA	NA	NA	NA
AYO70251.1|1457116_1457188_-	membrane protein YpdK	NA	NA	NA	NA	NA
AYO66864.1|1457526_1458723_-	cyanate transporter	NA	NA	NA	NA	NA
AYO66865.1|1458719_1459178_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	33.1	5.5e-12
AYO66866.1|1459310_1460219_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	23.8	3.9e-09
AYO66867.1|1460228_1461110_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
AYO66868.1|1461477_1461960_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
1462261:1462284	attL	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
AYO66869.1|1462478_1463645_+|integrase	integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	86.6	7.8e-204
AYO66870.1|1463757_1464129_+	hypothetical protein	NA	NA	NA	NA	NA
AYO66871.1|1464134_1464467_+	hypothetical protein	NA	A0A0P0IE45	Acinetobacter_phage	33.3	2.8e-05
AYO66872.1|1464553_1464808_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	61.8	1.6e-13
AYO66873.1|1464743_1465265_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	77.6	3.2e-40
AYO66874.1|1465257_1465458_-	hypothetical protein	NA	A0A1U8QWK2	Salmonella_phage	52.5	7.9e-08
AYO66875.1|1465454_1465694_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	86.1	3.2e-32
AYO66876.1|1465686_1465890_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	1.5e-30
AYO66877.1|1465886_1466672_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.7	1.8e-63
AYO66878.1|1466671_1466971_-	hypothetical protein	NA	NA	NA	NA	NA
AYO66879.1|1467359_1468004_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.7	8.2e-38
AYO66880.1|1468098_1468308_+	cell division protein	NA	NA	NA	NA	NA
AYO66881.1|1468333_1468795_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
AYO66882.1|1469032_1469212_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
AYO66883.1|1469201_1470155_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	69.3	2.8e-90
AYO66884.1|1470151_1470961_+	DNA methylase	NA	A0A1C9II58	Salmonella_phage	68.5	3.2e-108
AYO66885.1|1470970_1471348_+	hypothetical protein	NA	A0A1C9IIA0	Salmonella_phage	72.8	3.3e-47
AYO66886.1|1471360_1472341_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	1.1e-134
AYO66887.1|1472354_1472933_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
AYO66888.1|1473152_1473578_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	83.0	2.5e-59
AYO66889.1|1473574_1473730_+	DUF3927 domain-containing protein	NA	A0A0A0YRI9	Escherichia_phage	68.8	2.5e-09
AYO66890.1|1473894_1474119_+	hypothetical protein	NA	NA	NA	NA	NA
AYO66891.1|1474163_1474622_+	hypothetical protein	NA	G8C7V8	Escherichia_phage	72.3	4.9e-45
AYO66892.1|1474608_1474890_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	73.1	1.3e-32
AYO66893.1|1474889_1475519_+	endolysin	NA	F1C591	Cronobacter_phage	75.8	2.2e-88
AYO66894.1|1475521_1475797_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	37.1	6.0e-06
AYO66895.1|1475747_1475939_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	94.6	2.9e-23
AYO66896.1|1476026_1476272_+	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	92.6	1.6e-31
AYO66897.1|1476343_1476547_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
AYO66898.1|1476629_1476863_+	hypothetical protein	NA	NA	NA	NA	NA
AYO66899.1|1479777_1480971_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.6	7.9e-204
AYO66900.1|1480963_1481560_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	3.2e-89
AYO66901.1|1483264_1483462_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	96.9	2.4e-25
AYO66902.1|1485282_1485666_+|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	86.3	1.4e-53
AYO66903.1|1485668_1485932_+|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	91.9	3.0e-39
AYO66904.1|1486416_1488951_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	74.9	0.0e+00
AYO66905.1|1488950_1489430_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
AYO66906.1|1489416_1489899_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	96.9	5.7e-84
AYO66907.1|1489908_1490289_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
AYO66908.1|1490285_1493354_+	kinase	NA	A0A286S259	Klebsiella_phage	97.7	0.0e+00
AYO66909.1|1493430_1496385_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	65.5	2.7e-43
AYO66910.1|1496388_1497120_+	hypothetical protein	NA	NA	NA	NA	NA
AYO66911.1|1497116_1497311_+	hypothetical protein	NA	NA	NA	NA	NA
AYO70252.1|1497391_1500526_-	SGNH/GDSL hydrolase family protein	NA	A0A1I9SEN3	Klebsiella_phage	32.0	9.3e-103
AYO66912.1|1500635_1501187_+	DNA-invertase	NA	A0A286S1P7	Klebsiella_phage	91.2	1.6e-87
AYO66913.1|1501292_1501532_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.7	1.5e-21
AYO66914.1|1501488_1501860_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.9	1.2e-25
AYO66915.1|1502065_1502995_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	81.1	4.4e-133
1501955:1501978	attR	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
>prophage 5
CP028478	Klebsiella pneumoniae strain 2e chromosome, complete genome	5231806	2650350	2661237	5231806		Escherichia_phage(87.5%)	9	NA	NA
AYO67941.1|2650350_2653458_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AYO67942.1|2653512_2654778_+	MFS transporter	NA	NA	NA	NA	NA
AYO67943.1|2654808_2655897_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	99.7	5.2e-210
AYO67944.1|2655983_2656244_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AYO67945.1|2656541_2657402_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
AYO67946.1|2657422_2658184_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AYO67947.1|2658444_2659347_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AYO67948.1|2659358_2660624_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	3.9e-233
AYO67949.1|2660616_2661237_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 6
CP028478	Klebsiella pneumoniae strain 2e chromosome, complete genome	5231806	3053350	3094152	5231806	tail,integrase,portal,plate,terminase,capsid	Enterobacteria_phage(54.55%)	47	3053238:3053255	3090418:3090435
3053238:3053255	attL	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AYO68306.1|3053350_3053602_-	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
AYO68307.1|3053645_3054785_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	72.3	9.4e-146
AYO68308.1|3054939_3056112_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	5.0e-158
AYO68309.1|3056111_3056627_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
AYO68310.1|3056672_3056990_+|tail	phage tail protein	tail	B9A7B2	Serratia_phage	54.8	1.0e-17
AYO70328.1|3056989_3057148_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
AYO68311.1|3057134_3060110_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.5	4.0e-220
AYO68312.1|3060125_3060599_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	66.9	6.6e-53
AYO68313.1|3061062_3061725_-	hypothetical protein	NA	NA	NA	NA	NA
AYO68314.1|3061742_3062966_-	DUF262 domain-containing protein	NA	A0A1V0S9I8	Catovirus	27.5	7.8e-05
AYO68315.1|3063565_3064663_-|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
AYO68316.1|3064662_3064875_-	hypothetical protein	NA	NA	NA	NA	NA
AYO68317.1|3064871_3067898_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
AYO68318.1|3067887_3068811_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.6	7.6e-53
AYO68319.1|3068812_3069163_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	58.2	1.8e-23
AYO68320.1|3069159_3069747_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
AYO68321.1|3069743_3070379_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
AYO68322.1|3070375_3070843_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
AYO70329.1|3071024_3071354_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AYO68323.1|3071365_3071911_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	6.3e-31
AYO68324.1|3071907_3072192_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYO68325.1|3072182_3072383_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
AYO68326.1|3072382_3072898_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	48.8	2.7e-39
AYO68327.1|3073010_3073868_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	61.3	2.8e-70
AYO68328.1|3073917_3074952_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	3.6e-96
AYO68329.1|3074961_3075801_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	4.3e-95
AYO68330.1|3075957_3077685_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	67.1	1.0e-228
AYO68331.1|3077678_3078740_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.1	9.1e-143
AYO68332.1|3079588_3080380_+	hypothetical protein	NA	NA	NA	NA	NA
AYO68333.1|3080379_3082650_+	DNA helicase UvrD	NA	NA	NA	NA	NA
AYO68334.1|3085539_3086496_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	54.4	1.5e-83
AYO68335.1|3086492_3086720_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.0	2.5e-05
AYO68336.1|3086728_3087295_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	2.8e-13
AYO68337.1|3087291_3087516_-	hypothetical protein	NA	NA	NA	NA	NA
AYO68338.1|3087584_3087857_-	hypothetical protein	NA	NA	NA	NA	NA
AYO68339.1|3087872_3088250_-	hypothetical protein	NA	NA	NA	NA	NA
AYO68340.1|3088265_3088484_-	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
AYO68341.1|3088504_3088783_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
AYO68342.1|3088903_3089203_+	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
AYO68343.1|3089318_3090302_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	79.8	1.4e-150
AYO68344.1|3090566_3091580_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	33.8	1.1e-12
3090418:3090435	attR	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AYO68345.1|3091637_3091739_+	hypothetical protein	NA	NA	NA	NA	NA
AYO70330.1|3091738_3091813_+	hypothetical protein	NA	NA	NA	NA	NA
AYO68346.1|3091930_3092056_+	hypothetical protein	NA	NA	NA	NA	NA
AYO68347.1|3092115_3092379_-	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AYO68348.1|3092509_3093148_-	leucine efflux protein	NA	NA	NA	NA	NA
AYO68349.1|3093237_3094152_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
>prophage 7
CP028478	Klebsiella pneumoniae strain 2e chromosome, complete genome	5231806	3373311	3382775	5231806	tRNA,protease	Brazilian_cedratvirus(16.67%)	9	NA	NA
AYO68592.1|3373311_3375033_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AYO68593.1|3375077_3375779_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AYO68594.1|3376132_3376351_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AYO68595.1|3376471_3378751_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	7.4e-166
AYO68596.1|3378781_3379099_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AYO68597.1|3379424_3379646_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AYO68598.1|3379579_3379783_-	hypothetical protein	NA	NA	NA	NA	NA
AYO68599.1|3379722_3381663_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	5.0e-38
AYO68600.1|3381659_3382775_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 8
CP028478	Klebsiella pneumoniae strain 2e chromosome, complete genome	5231806	4569038	4576700	5231806	transposase	Stx2-converting_phage(28.57%)	10	NA	NA
AYO69631.1|4569038_4569260_+	hypothetical protein	NA	A0A1V0E8E5	Vibrio_phage	39.3	9.1e-05
AYO69632.1|4569299_4569419_-	hypothetical protein	NA	NA	NA	NA	NA
AYO69633.1|4569432_4569597_-	hypothetical protein	NA	A0A1B0Z042	Pseudomonas_phage	66.7	6.5e-08
AYO69634.1|4569597_4569969_-	hypothetical protein	NA	NA	NA	NA	NA
AYO69635.1|4570043_4570484_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
AYO69636.1|4570480_4570831_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
AYO69637.1|4570861_4572454_+|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	1.4e-174
AYO69638.1|4572509_4573478_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYO69639.1|4574822_4575227_-	hypothetical protein	NA	Q76S41	Shigella_phage	48.3	1.0e-22
AYO69640.1|4575446_4576700_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	44.8	1.1e-62
>prophage 1
CP028479	Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence	129864	116213	124946	129864		Escherichia_phage(42.86%)	9	NA	NA
AYO70545.1|116213_116969_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	95.6	3.4e-136
AYO70546.1|117672_118878_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
AYO70547.1|118874_119852_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.5	1.4e-86
AYO70548.1|119933_121205_-	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	9.2e-150
AYO70549.1|121204_121636_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
AYO70550.1|121870_122842_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	47.1	8.2e-74
AYO70551.1|122844_123516_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
AYO70552.1|123578_123809_+	hypothetical protein	NA	NA	NA	NA	NA
AYO70553.1|124244_124946_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	1.2e-26
>prophage 1
CP028480	Klebsiella pneumoniae strain 2e plasmid unnamed2	77910	39137	64311	77910	transposase,integrase	Escherichia_phage(37.5%)	23	39074:39133	52528:53348
39074:39133	attL	AGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
AYO70604.1|39137_39842_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYO70605.1|39787_39991_-	hypothetical protein	NA	NA	NA	NA	NA
AYO70606.1|40002_40572_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
AYO70607.1|40711_41026_-|transposase	transposase	transposase	NA	NA	NA	NA
AYO70608.1|40964_41978_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYO70609.1|42133_42607_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
AYO70610.1|42853_43558_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYO70611.1|45454_46459_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AYO70612.1|46640_46817_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AYO70613.1|48046_48349_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AYO70614.1|48242_48494_-	hypothetical protein	NA	NA	NA	NA	NA
AYO70615.1|48524_50018_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYO70616.1|50228_50453_-	hypothetical protein	NA	NA	NA	NA	NA
AYO70617.1|50449_51187_-	resolvase	NA	NA	NA	NA	NA
AYO70618.1|51293_51785_+	hypothetical protein	NA	NA	NA	NA	NA
AYO70619.1|51818_52523_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYO70620.1|52513_52669_+	replication initiator protein	NA	NA	NA	NA	NA
AYO70621.1|52700_53378_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
52528:53348	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCTGAAAAAGCCCGTAGCGGGCTGCTACGGGCGTCTGACGCGGTGGAAAGGGGGAGGGGATGTTGTCTACATGGCTCTGCTGTAGTGAGTGGGTTGCGCTCCGGCAGCGGTCCTGATCAATCGTCACCCTTTCTCGGTCCTTCAACGTTCCTGACAACGAGCCTCCTTTTCGCCAATCCATCGACAATCACCGCGAGTCCCTGCTCGAACGCTGCGTCCGGACCGGCTTCGTCGAAGGCGTCTATCGCGGCCCGCAACAGCGGCGAGAGCGGAGCCTGTTCAACGGTGCCGCCGCGCTCGCCGGCATCGCTGTCGCCGGCCTGCTCCTCAAGCACGGCCCCAACAGTGAAGTAGCTGATTGTCATCAGCGCATTGACGGCGTCCCCGGCCGAAAAACCCGCCTCGCAGAGGAAGCGAAGCTGCGCGTCGGCCGTTTCCATCTGCGGTGCGCCCGGTCGCGTGCCGGCATGGATGCGCGCGCCATCGCGGTAGGCGAGCAGCGCCTGCCTGAAGCTGCGGGCATTCCCGATCAGAAATGAGCGCCAGTCGTCGTCGGCTCTCGGCACCGAATGCGTATGATTCTCCGCCAGCATGGCTTCGGCCAGTGCGTCGAGCAGCGCCCGCTTGTTCCTGAAGTGCCAGTAAAGCGCCGGCTGCTGAACCCCCAACCGTTCCGCCAGTTTGCGTGTCGTCAGACCGTCTACGCCGACCTCGTTCAACAGGTCCAGGGCGGCACGGATCACTGTATTCGGCTGCAACTTTGT	NA	NA	NA	NA
AYO70622.1|54686_55571_-	EamA family transporter	NA	NA	NA	NA	NA
AYO70648.1|55708_56101_-	cysteine hydrolase	NA	NA	NA	NA	NA
AYO70623.1|59029_59887_+	class A beta-lactamase LAP-2	NA	Q1MVP3	Enterobacteria_phage	61.1	2.0e-92
AYO70624.1|61483_62140_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
AYO70625.1|62919_64311_-|transposase	ISKra4 family transposase ISKpn19	transposase	NA	NA	NA	NA
