The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024677	Citrobacter freundii strain UMH16 chromosome, complete genome	5195086	937033	980086	5195086	portal,capsid,integrase,head,transposase,tail,terminase	Cronobacter_phage(66.67%)	51	956608:956626	981544:981562
AYL55898.1|937033_938202_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	8.4e-166
AYL59780.1|938942_939233_+	hypothetical protein	NA	NA	NA	NA	NA
AYL55899.1|939362_939614_+	hypothetical protein	NA	NA	NA	NA	NA
AYL55900.1|939620_940073_-	hypothetical protein	NA	NA	NA	NA	NA
AYL55901.1|940377_941229_-	DUF2806 domain-containing protein	NA	A0A291AUV8	Sinorhizobium_phage	28.8	4.9e-22
AYL55902.1|941274_941991_+	methyltransferase	NA	Q7Y3M8	Enterobacteria_phage	54.2	7.9e-74
AYL55903.1|942321_942705_+	transcriptional regulator	NA	NA	NA	NA	NA
AYL55904.1|942807_943905_+	oxidoreductase	NA	NA	NA	NA	NA
AYL55905.1|943910_944537_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AYL59781.1|944865_946068_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	2.9e-97
AYL55906.1|946112_946871_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	28.8	3.9e-15
AYL59782.1|946935_947544_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
AYL55907.1|947842_949075_+	multidrug transporter MdfA	NA	NA	NA	NA	NA
AYL55908.1|949103_949385_-	hypothetical protein	NA	NA	NA	NA	NA
AYL55909.1|949492_950308_-	HAD family hydrolase	NA	NA	NA	NA	NA
AYL55910.1|950307_951516_-	MFS transporter	NA	NA	NA	NA	NA
AYL55911.1|951601_952150_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AYL55912.1|952155_953070_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYL55913.1|953172_954099_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AYL55914.1|954100_954898_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AYL55915.1|955062_956274_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	90.5	7.3e-189
956608:956626	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
AYL55916.1|956700_957753_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	56.4	3.6e-107
AYL55917.1|957857_959639_-	hypothetical protein	NA	NA	NA	NA	NA
AYL55918.1|959650_960220_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	39.8	5.4e-33
AYL55919.1|960348_960570_+	regulator	NA	NA	NA	NA	NA
AYL55920.1|960599_961103_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	4.5e-60
AYL55921.1|961151_961613_-	hypothetical protein	NA	NA	NA	NA	NA
AYL55922.1|961852_962026_+	hypothetical protein	NA	NA	NA	NA	NA
AYL55923.1|962035_962467_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	55.4	3.3e-27
AYL55924.1|962463_962865_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	68.4	8.9e-51
AYL55925.1|962932_963166_+	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
AYL55926.1|963156_963486_+	DUF3850 domain-containing protein	NA	Q7Y4B7	Escherichia_virus	46.4	6.7e-12
AYL55927.1|963475_964345_+	adenine methylase	NA	F1BUN1	Cronobacter_phage	81.0	5.0e-131
AYL55928.1|964341_964554_+	hypothetical protein	NA	NA	NA	NA	NA
AYL55929.1|964555_966571_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.9	1.1e-298
AYL55930.1|966686_966905_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	47.2	3.6e-06
AYL55931.1|966878_967202_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	93.3	4.7e-50
AYL55932.1|967198_968260_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	78.1	2.7e-163
AYL55933.1|968256_970032_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.6	6.8e-292
AYL55934.1|970192_970996_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	56.8	5.7e-81
AYL55935.1|971057_972080_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.8	1.0e-159
AYL55936.1|972083_972785_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	69.4	3.5e-90
AYL55937.1|972830_973334_+|head	head completion protein	head	F1BUL8	Cronobacter_phage	82.7	1.5e-63
AYL55938.1|973330_973837_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	68.1	1.1e-64
AYL55939.1|973833_974541_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	2.2e-100
AYL55940.1|974537_975665_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	81.9	8.1e-174
AYL55941.1|975661_976117_+	DUF2597 domain-containing protein	NA	F1BUL4	Cronobacter_phage	72.8	5.9e-59
AYL55942.1|976617_977151_+|tail	phage tail protein	tail	F1BUK2	Cronobacter_phage	38.3	3.1e-22
AYL55943.1|977140_977866_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	55.2	1.6e-66
AYL55944.1|977837_978383_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	73.1	3.9e-65
AYL55945.1|978382_980086_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	77.6	1.7e-223
981544:981562	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 2
CP024677	Citrobacter freundii strain UMH16 chromosome, complete genome	5195086	1273788	1369208	5195086	portal,capsid,integrase,holin,head,transposase,tail,terminase,tRNA	Vibrio_phage(16.28%)	121	1278265:1278324	1367543:1368792
AYL56200.1|1273788_1275075_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	50.6	5.5e-110
AYL56201.1|1275074_1275290_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	57.7	1.5e-20
AYL56202.1|1275354_1275597_-	DUF4060 domain-containing protein	NA	K7PHF4	Enterobacteria_phage	87.3	3.3e-32
AYL56203.1|1275636_1276722_-	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	63.6	6.7e-125
1278265:1278324	attL	GTGTAGTGGTTTACTGAATTTGGCCACCTGAACAGAGGTGATATGCTCACCTCAGAACAT	NA	NA	NA	NA
AYL56204.1|1278337_1279505_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	8.4e-166
AYL56205.1|1279427_1279679_-	hypothetical protein	NA	NA	NA	NA	NA
AYL56206.1|1279733_1279922_+	hypothetical protein	NA	NA	NA	NA	NA
AYL56207.1|1280078_1280339_-	hypothetical protein	NA	NA	NA	NA	NA
AYL56208.1|1280638_1280917_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	100.0	3.9e-45
AYL56209.1|1280888_1281437_+	lysozyme	NA	K7PM52	Enterobacteria_phage	93.4	4.6e-98
AYL59794.1|1281466_1281949_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AYL56210.1|1281945_1282176_+	hypothetical protein	NA	NA	NA	NA	NA
AYL59795.1|1282566_1282764_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	90.8	3.7e-26
AYL56211.1|1282801_1282957_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AYL56212.1|1283335_1283548_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	4.6e-22
AYL59796.1|1283558_1283747_+	cold-shock protein	NA	NA	NA	NA	NA
AYL56213.1|1283820_1284051_+	hypothetical protein	NA	NA	NA	NA	NA
AYL56214.1|1284255_1284429_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
AYL56215.1|1284801_1285341_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	79.0	6.4e-44
AYL56216.1|1285616_1285979_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	86.7	3.7e-56
AYL56217.1|1286203_1286710_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	93.9	1.0e-83
AYL56218.1|1286706_1288434_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	92.8	0.0e+00
AYL56219.1|1288427_1288607_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	71.2	3.3e-13
AYL56220.1|1288606_1289866_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	2.2e-220
AYL56221.1|1289902_1290823_+	serine peptidase	NA	Q6UAX7	Klebsiella_phage	80.1	2.7e-135
AYL56222.1|1290895_1292182_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	88.8	1.1e-211
AYL56223.1|1292279_1292657_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	59.5	4.2e-18
AYL59797.1|1292637_1292955_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	79.6	2.8e-39
AYL56224.1|1293447_1293780_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	67.9	5.3e-41
AYL56225.1|1293788_1294484_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	71.9	1.6e-95
AYL56226.1|1294495_1295230_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	76.5	1.2e-114
AYL56227.1|1295127_1295805_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	69.3	1.3e-78
AYL56228.1|1297491_1297872_+	hypothetical protein	NA	Q9EYE7	Enterobacteria_phage	48.4	1.6e-25
AYL56229.1|1297913_1300571_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	48.9	6.1e-71
AYL56230.1|1300570_1301152_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	57.1	4.6e-56
AYL56231.1|1301459_1301648_+	hypothetical protein	NA	Q1MVE7	Enterobacteria_phage	61.4	2.2e-15
AYL56232.1|1302429_1303800_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	4.7e-107
AYL59798.1|1303803_1304445_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AYL56233.1|1304479_1305586_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AYL56234.1|1305639_1306101_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AYL56235.1|1306110_1307043_-	hypothetical protein	NA	NA	NA	NA	NA
AYL56236.1|1307077_1307695_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AYL56237.1|1307897_1309148_+	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	94.4	9.4e-22
AYL56238.1|1309306_1310389_+	hypothetical protein	NA	NA	NA	NA	NA
AYL56239.1|1310385_1311036_+	hypothetical protein	NA	NA	NA	NA	NA
AYL56240.1|1311107_1312235_-|integrase	integrase	integrase	O21925	Phage_21	57.8	8.2e-118
AYL56241.1|1312215_1312461_-	excisionase	NA	NA	NA	NA	NA
AYL56242.1|1312872_1313346_+	hypothetical protein	NA	NA	NA	NA	NA
AYL56243.1|1313755_1314382_-	LexA family transcriptional repressor	NA	K7PM82	Enterobacteria_phage	49.3	1.9e-47
AYL56244.1|1314484_1314712_+	cell division protein	NA	NA	NA	NA	NA
AYL56245.1|1314722_1315274_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	67.8	3.0e-65
AYL56246.1|1315446_1315626_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	75.0	2.7e-15
AYL56247.1|1315615_1316473_+	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	95.1	7.5e-63
AYL56248.1|1316469_1317348_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	75.6	3.0e-131
AYL56249.1|1317344_1317731_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	88.4	3.2e-61
AYL56250.1|1317744_1318431_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	52.9	2.4e-56
AYL56251.1|1318427_1319423_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	70.2	9.4e-142
AYL56252.1|1319440_1319836_+	antitermination protein Q	NA	U5P0A5	Shigella_phage	70.0	2.5e-45
AYL56253.1|1319977_1320832_+	hypothetical protein	NA	NA	NA	NA	NA
AYL56254.1|1321809_1322121_+|tail	phage tail assembly protein	tail	Q75QK8	Wolbachia_phage	31.6	7.5e-05
AYL56255.1|1322223_1322895_+	hypothetical protein	NA	A0A193GYM8	Enterobacter_phage	47.9	8.6e-14
AYL56256.1|1322884_1323448_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	40.9	8.2e-26
AYL56257.1|1323440_1325213_+|tail	phage tail protein	tail	Q6K1H2	Salmonella_virus	36.2	1.2e-67
AYL56258.1|1325212_1325797_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	55.2	6.0e-56
AYL56259.1|1325861_1326719_-	protein YibB	NA	A0A292GL11	Xanthomonas_phage	29.1	1.7e-06
AYL56260.1|1327204_1327447_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	1.7e-28
AYL56261.1|1327766_1328156_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	70.5	1.4e-48
AYL56262.1|1328550_1329894_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
AYL56263.1|1329887_1331018_+	hypothetical protein	NA	A0A2D1GR68	Pseudomonas_phage	42.1	1.0e-27
AYL56264.1|1331345_1332443_+	hypothetical protein	NA	NA	NA	NA	NA
AYL56265.1|1332671_1333343_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.0	2.2e-78
AYL56266.1|1333514_1333718_+	hypothetical protein	NA	NA	NA	NA	NA
AYL56267.1|1334068_1334221_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.0	3.1e-20
AYL56268.1|1334356_1334866_-	DedA family protein	NA	NA	NA	NA	NA
AYL56269.1|1335040_1335283_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
AYL56270.1|1335765_1336257_-	hypothetical protein	NA	A0A2D1GNK9	Pseudomonas_phage	38.5	9.7e-07
AYL56271.1|1336454_1336709_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	62.7	3.1e-17
AYL56272.1|1336708_1338688_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	51.7	3.7e-190
AYL56273.1|1338783_1339722_+	hypothetical protein	NA	A0A0C4UQR3	Shigella_phage	47.5	1.2e-74
AYL56274.1|1339726_1339966_+	hypothetical protein	NA	NA	NA	NA	NA
AYL56275.1|1339968_1340259_+	hypothetical protein	NA	C9DGL7	Escherichia_phage	44.9	7.0e-13
AYL56276.1|1340270_1340525_+	host nuclease inhibitor protein	NA	A0A0U5KSG7	unidentified_phage	52.1	2.0e-16
AYL56277.1|1340538_1341066_+	host-nuclease inhibitor protein Gam	NA	A0A125RNF6	Pseudomonas_phage	58.5	1.8e-46
AYL56278.1|1341155_1341812_+	hypothetical protein	NA	A0A291AUJ5	Sinorhizobium_phage	48.9	8.4e-14
AYL56279.1|1341789_1342317_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	50.0	7.6e-42
AYL56280.1|1342313_1342721_+	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	63.5	2.3e-38
AYL56281.1|1342733_1343252_+	hypothetical protein	NA	NA	NA	NA	NA
AYL56282.1|1343337_1343928_+	peptidoglycan-binding protein	NA	A0A2I7S9B9	Vibrio_phage	46.2	1.8e-36
AYL56283.1|1343929_1344148_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	69.4	1.0e-24
AYL56284.1|1344140_1344548_+	hypothetical protein	NA	NA	NA	NA	NA
AYL56285.1|1344535_1345144_+	hypothetical protein	NA	NA	NA	NA	NA
AYL56286.1|1345140_1345347_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AYL56287.1|1345347_1345653_+	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	38.3	5.6e-13
AYL59799.1|1345665_1345953_+	hypothetical protein	NA	M1PPT9	Vibrio_phage	64.5	4.6e-25
AYL56288.1|1345955_1346330_+	hypothetical protein	NA	NA	NA	NA	NA
AYL56289.1|1346322_1346601_+	hypothetical protein	NA	NA	NA	NA	NA
AYL56290.1|1346590_1347169_+	DUF3486 domain-containing protein	NA	M4MCR3	Vibrio_phage	55.0	9.6e-46
AYL56291.1|1347165_1348749_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	68.9	1.0e-198
AYL56292.1|1348748_1350317_+	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	56.2	5.1e-158
AYL56293.1|1350309_1351098_+	hypothetical protein	NA	M4M9M5	Vibrio_phage	57.6	2.1e-91
AYL56294.1|1351307_1352264_+	peptidase	NA	M1Q578	Vibrio_phage	50.6	9.8e-80
AYL56295.1|1352267_1353161_+|head	phage head protein	head	M4MB71	Vibrio_phage	56.4	1.3e-94
AYL56296.1|1353244_1353838_+	hypothetical protein	NA	NA	NA	NA	NA
AYL56297.1|1353837_1354278_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.9	1.4e-33
AYL56298.1|1354277_1354820_+	phage morphogenesis protein	NA	M4MB67	Vibrio_phage	59.2	1.4e-54
AYL56299.1|1354816_1355440_+	hypothetical protein	NA	M4MHF0	Vibrio_phage	44.5	1.7e-35
AYL56300.1|1355420_1355609_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AYL56301.1|1355608_1357087_+|tail	phage tail protein	tail	M1Q565	Vibrio_phage	53.8	2.2e-150
AYL59800.1|1357441_1357828_+|tail	phage tail protein	tail	A0A0M4S6V4	Salmonella_phage	75.0	3.1e-24
AYL56302.1|1358002_1358557_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	85.7	6.9e-86
AYL56303.1|1358815_1359514_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	2.9e-89
AYL59801.1|1359599_1359920_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	3.2e-19
AYL56304.1|1359964_1361254_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.4	3.2e-166
AYL56305.1|1361266_1361692_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	6.1e-50
AYL56306.1|1361756_1362917_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	4.6e-39
AYL56307.1|1363158_1363371_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	85.2	1.3e-19
AYL59802.1|1363889_1364375_+	hypothetical protein	NA	A0A1B0VBR9	Salmonella_phage	34.9	2.3e-08
AYL56308.1|1364385_1364640_+	hypothetical protein	NA	NA	NA	NA	NA
AYL56309.1|1364906_1365179_-	hypothetical protein	NA	NA	NA	NA	NA
AYL56310.1|1366360_1367529_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	8.4e-166
AYL56311.1|1368056_1369208_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	6.4e-41
1367543:1368792	attR	ATGTTCTGAGGTGAGCATATCACCTCTGTTCAGGTGGCCAAATTCAGTAAACCACTACACACTAACTCAAAGTCTGATGAGGCAGGTTGCGGCGAATATGAACGCCATTGCCAGCAAACTGCCATCTGGATTCCATGTCGGTATTAACTTCAGCGCATCCCATATCACTACCCCTACATTTGTTGAAGAGTGTTGAATCGCCACGGGTTTAACAGACACCTCAGAGTCATTTAAGATGACTTAAAGAGAGGTGCCCATGAGCGGTAAACGTTATCCCGAAGAGTTTAAAATTGAAGCAGTCAAACAGGTTATTGATCGCGGTCATTCTGTTTCCAGCGTTGCAACACGTCTCGATATCACCACCCACAGCCTTTACGCCTGGATAAAGAAGTACGGTCCGGACTCATCCACTAACAAAGAACAGTCAGATGCTCAGGCCGAGATCCGCCGACTCCAGAAGGAGTTGAAGCGGGTTACTGACGAACGGGACATATTAAAAAAAGCCGCTGTAGATTCAATCTGTCAATGCAACACCCCTTTCAATTATCTCTTTCGGTGTTTTGAACTTCAGTGTCTTTCTCGGTCTGTTGTTTAGCTGAGCAGCAACCAGATCTAGTTCATGTTGAGTATATTGGGCAAGACATGTCTTTTTAGGAAAGTACTGCCGAATTAGCCCATTTGTGTTCTCATTTGTTCCCCGCTGCCAAGGACTCTGAGGATCGCAGAAGTAAACTTTAACGCCGGTGCTGACAGTAAATTCTAGATGTCTGGCCAGTTCCATTCCTCTGTCCCATGTCAGTGATTTTCTGAGTTCTGACGGTAAACTCAGGAATTTGTCGGTAAGAGCCTGATTTACTGAGACAGAATCTTTGCCCCTGAGTCTAAGGATGATCGTATAACGTGATTTTCGGTCTACAAGTGTGACTATATGAGAGTTTTTTGTACCTGAGACTAAATCGCCCTCCCAATGCCCCAGAGAGCGTCTGTTATCGATATTTCGGGAACGTTCGTGAATTAGTGTTCCGTTCACTATGTTAATCGTACCTCTTTCGCCTTTGCGGGTATGACGCCTGCCATGGCGAAGGCTATGCGACCGTCGCAGATGCTGTATATTCAGGTGGTGTAGCGCTTCACGGCTACGAAAGTACAGCGTTTTATAAATTGTCTCAGGTGATATTCGCAGCGTTTTTTGACGTGGTTTTGTTCGCCTTAACCATCCTGATATTTGCTCTGGAGACCATTTCATCTCC	NA	NA	NA	NA
>prophage 3
CP024677	Citrobacter freundii strain UMH16 chromosome, complete genome	5195086	1458903	1483082	5195086	tail,tRNA	Cronobacter_phage(29.41%)	22	NA	NA
AYL56394.1|1458903_1460379_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	60.0	2.9e-155
AYL56395.1|1460483_1460981_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	87.9	1.1e-85
AYL56396.1|1460980_1461451_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	93.6	1.4e-79
AYL56397.1|1461413_1461830_+	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	84.6	1.4e-67
AYL56398.1|1461816_1464294_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	87.6	0.0e+00
AYL56399.1|1466571_1467822_-	glucosyl transferase	NA	O22006	Shigella_phage	38.6	1.4e-62
AYL56400.1|1467814_1468741_-	glycosyltransferase	NA	B9UDL7	Salmonella_phage	89.4	9.0e-155
AYL59812.1|1468737_1469100_-	GtrA family protein	NA	I1TED9	Salmonella_phage	78.3	3.4e-49
AYL56401.1|1469493_1471422_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	4.4e-127
AYL56402.1|1471425_1471968_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	8.2e-15
AYL56403.1|1472064_1472262_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AYL56404.1|1472317_1472674_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AYL56405.1|1473044_1474028_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	2.4e-33
AYL56406.1|1474043_1476431_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AYL56407.1|1476435_1476735_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AYL59813.1|1476888_1477869_+	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.7e-15
AYL56408.1|1477929_1478481_+	glutathione peroxidase	NA	NA	NA	NA	NA
AYL56409.1|1478480_1479230_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
AYL56410.1|1479307_1479772_+	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
AYL56411.1|1480088_1480802_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYL56412.1|1480863_1482306_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	7.7e-52
AYL56413.1|1482302_1483082_-	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.7	7.9e-11
>prophage 4
CP024677	Citrobacter freundii strain UMH16 chromosome, complete genome	5195086	1961021	2037671	5195086	holin,integrase,protease,transposase,coat,tail,terminase	Escherichia_phage(37.93%)	91	1991906:1991922	2038583:2038599
AYL56834.1|1961021_1962068_-|protease	protease SohB	protease	NA	NA	NA	NA
AYL56835.1|1962289_1963051_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.7	3.0e-07
AYL56836.1|1963047_1963638_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AYL56837.1|1963721_1964597_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
AYL56838.1|1965319_1966488_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	8.4e-166
AYL59835.1|1966771_1967503_-	HNH endonuclease	NA	NA	NA	NA	NA
AYL56839.1|1967855_1968476_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AYL56840.1|1968472_1969351_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
AYL56841.1|1969625_1971188_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
AYL56842.1|1971187_1972783_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.6	3.2e-51
AYL59836.1|1972786_1974145_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.5e-38
AYL56843.1|1974155_1975349_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AYL56844.1|1975348_1976155_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AYL56845.1|1977846_1978122_-	hypothetical protein	NA	NA	NA	NA	NA
AYL56846.1|1978361_1978820_+	hypothetical protein	NA	NA	NA	NA	NA
AYL56847.1|1978892_1979609_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AYL56848.1|1980177_1980831_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
AYL56849.1|1981229_1981973_+	UPF0259 family protein	NA	NA	NA	NA	NA
AYL56850.1|1982027_1982567_+	septation protein A	NA	NA	NA	NA	NA
AYL56851.1|1982732_1983134_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AYL59837.1|1983198_1983918_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
AYL56852.1|1984142_1984439_+	hypothetical protein	NA	NA	NA	NA	NA
AYL56853.1|1984590_1985262_+	DUF159 family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	1.1e-80
AYL56854.1|1985254_1986523_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	80.6	2.7e-202
AYL56855.1|1986524_1986944_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	55.9	2.7e-34
AYL56856.1|1987021_1987264_+	DNA-damage-inducible protein I	NA	Q6UAW0	Klebsiella_phage	75.3	9.9e-29
AYL56857.1|1987392_1988613_-	hypothetical protein	NA	K7P7B1	Enterobacteria_phage	68.4	1.9e-67
AYL56858.1|1988622_1989567_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	67.1	2.1e-119
AYL56859.1|1989568_1992802_-	host specificity protein	NA	G8C7R4	Escherichia_phage	83.1	0.0e+00
1991906:1991922	attL	TGGCGTAACCCTGCGAC	NA	NA	NA	NA
AYL56860.1|1992857_1993451_-|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	81.9	1.5e-81
AYL56861.1|1993438_1994170_-	peptidase P60	NA	G8C7R2	Escherichia_phage	90.1	4.2e-139
AYL56862.1|1994182_1994956_-|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	89.0	2.8e-133
AYL56863.1|1994964_1995315_-	hypothetical protein	NA	G8C7R0	Escherichia_phage	90.5	2.6e-54
AYL56864.1|1995378_1995753_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	43.2	1.7e-19
AYL56865.1|1995749_1996364_-	hypothetical protein	NA	NA	NA	NA	NA
AYL56866.1|1997012_1997237_-	hypothetical protein	NA	NA	NA	NA	NA
AYL56867.1|1997236_2000368_-|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	40.4	5.2e-162
AYL56868.1|2000367_2000655_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	61.5	2.5e-18
AYL56869.1|2000672_2001011_-	hypothetical protein	NA	G8C7Q5	Escherichia_phage	89.3	1.2e-51
AYL56870.1|2001052_2001985_-|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	91.3	2.0e-154
AYL56871.1|2002031_2002481_-	hypothetical protein	NA	G8C7Q2	Escherichia_phage	76.5	1.4e-60
AYL56872.1|2002470_2003070_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	92.5	4.4e-102
AYL56873.1|2003072_2003426_-	hypothetical protein	NA	G8C7Q0	Escherichia_phage	89.7	4.2e-52
AYL56874.1|2003427_2003910_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	87.5	9.3e-79
AYL56875.1|2003912_2004098_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	91.8	7.8e-26
AYL56876.1|2004137_2005277_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	84.0	2.8e-174
AYL56877.1|2005294_2006047_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	92.0	1.9e-123
AYL56878.1|2006154_2006364_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	50.0	5.0e-13
AYL56879.1|2006367_2007474_-	hypothetical protein	NA	G8C7P5	Escherichia_phage	90.2	2.8e-187
AYL56880.1|2007475_2008879_-	DNA-binding protein	NA	G8C7P4	Escherichia_phage	90.6	9.6e-241
AYL56881.1|2008883_2010455_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	92.7	1.3e-307
AYL56882.1|2010451_2011024_-|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	80.0	7.0e-65
AYL56883.1|2011044_2011476_+	hypothetical protein	NA	NA	NA	NA	NA
AYL56884.1|2011589_2011784_-	hypothetical protein	NA	NA	NA	NA	NA
AYL56885.1|2012079_2012295_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
AYL56886.1|2012298_2012832_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	51.9	1.6e-10
AYL56887.1|2012828_2013377_-	lysozyme	NA	K7PM52	Enterobacteria_phage	93.4	9.2e-99
AYL56888.1|2013348_2013627_-|holin	holin	holin	K7PGZ9	Enterobacteria_phage	97.8	5.1e-45
AYL56889.1|2014048_2014879_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	98.9	1.6e-155
AYL56890.1|2014875_2015016_-	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	95.7	1.2e-18
AYL56891.1|2015012_2015621_-	protein NinG	NA	A0A0M4RU10	Salmonella_phage	64.7	6.3e-48
AYL56892.1|2015623_2015830_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	72.1	6.2e-24
AYL56893.1|2015829_2016432_-	hypothetical protein	NA	A0A0M4QX23	Salmonella_phage	92.0	2.8e-104
AYL56894.1|2016532_2016733_-	hypothetical protein	NA	NA	NA	NA	NA
AYL56895.1|2016838_2018881_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.4	2.2e-198
AYL56896.1|2018877_2019135_-	hypothetical protein	NA	NA	NA	NA	NA
AYL56897.1|2019134_2019362_-	hypothetical protein	NA	NA	NA	NA	NA
AYL56898.1|2020414_2020993_-	hypothetical protein	NA	K7PLZ3	Enterobacterial_phage	71.2	6.2e-45
AYL56899.1|2020989_2021451_-	hypothetical protein	NA	NA	NA	NA	NA
AYL56900.1|2021809_2022121_-	hypothetical protein	NA	NA	NA	NA	NA
AYL56901.1|2022123_2022876_-	hypothetical protein	NA	NA	NA	NA	NA
AYL56902.1|2022887_2023580_-	phage replication protein	NA	G8C7U6	Escherichia_phage	60.9	1.9e-77
AYL59838.1|2023563_2024556_-	replication protein	NA	A5VW95	Enterobacteria_phage	75.0	2.7e-48
AYL56903.1|2024740_2025280_-	regulator	NA	K7PJT7	Enterobacteria_phage	82.1	7.5e-77
AYL56904.1|2025311_2025539_-	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	56.3	2.4e-16
AYL56905.1|2025574_2026330_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	54.3	1.1e-70
AYL56906.1|2026398_2027160_+	DNA-binding protein	NA	A0A1L2BWW1	Bacteriophage	46.3	8.5e-10
AYL56907.1|2027190_2027415_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	64.7	1.2e-15
AYL59839.1|2027742_2027949_+	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	98.5	1.6e-32
AYL56908.1|2027960_2028122_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	92.5	1.3e-21
AYL56909.1|2028261_2031111_+	exodeoxyribonuclease VIII	NA	K7P6V4	Enterobacteria_phage	59.2	2.0e-285
AYL56910.1|2031125_2032166_+	enterohemolysin	NA	K7P7N5	Enterobacteria_phage	74.6	4.3e-153
AYL56911.1|2032200_2032545_+	hypothetical protein	NA	NA	NA	NA	NA
AYL56912.1|2032537_2032741_+	hypothetical protein	NA	A0A1B0VN94	Pseudomonas_phage	66.7	1.7e-10
AYL56913.1|2032727_2032970_+	DUF4060 domain-containing protein	NA	K7PHF4	Enterobacteria_phage	87.3	2.5e-32
AYL56914.1|2033015_2033216_+	excisionase	NA	K7PM28	Enterobacteria_phage	82.5	1.9e-25
AYL56915.1|2033208_2034402_-|integrase	integrase	integrase	K7PGY1	Enterobacteria_phage	84.4	7.9e-204
AYL56916.1|2034656_2034830_-	hypothetical protein	NA	NA	NA	NA	NA
AYL56917.1|2034972_2036433_+	cardiolipin synthase	NA	NA	NA	NA	NA
AYL56918.1|2036467_2036797_+	dsDNA-mimic protein	NA	NA	NA	NA	NA
AYL56919.1|2036834_2037671_-	transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	1.4e-08
2038583:2038599	attR	GTCGCAGGGTTACGCCA	NA	NA	NA	NA
>prophage 5
CP024677	Citrobacter freundii strain UMH16 chromosome, complete genome	5195086	2187127	2240130	5195086	portal,integrase,holin,protease,tail	Enterobacteria_phage(31.82%)	61	2198492:2198517	2240263:2240288
AYL57056.1|2187127_2188009_-|protease	protease HtpX	protease	NA	NA	NA	NA
AYL57057.1|2188201_2190250_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	1.2e-87
AYL57058.1|2190269_2190956_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AYL57059.1|2191052_2191550_-	Free methionine-R-sulfoxide reductase	NA	NA	NA	NA	NA
AYL57060.1|2191678_2192962_+	hypothetical protein	NA	NA	NA	NA	NA
AYL57061.1|2192930_2195564_+	MCE family protein	NA	NA	NA	NA	NA
AYL57062.1|2195643_2197065_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AYL57063.1|2197162_2197402_+	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
AYL57064.1|2197504_2197696_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AYL57065.1|2197696_2198338_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.5	8.7e-56
2198492:2198517	attL	AAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
AYL59847.1|2198678_2198777_+	hypothetical protein	NA	S4TND2	Salmonella_phage	85.7	1.8e-05
AYL57066.1|2198889_2199558_+	DUF159 family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	2.4e-80
AYL57067.1|2199558_2199948_-	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.1	1.1e-50
AYL57068.1|2200267_2200510_+	DNA-damage-inducible protein I	NA	Q6UAW0	Klebsiella_phage	79.7	4.7e-31
AYL57069.1|2200610_2201351_+	hypothetical protein	NA	NA	NA	NA	NA
AYL57070.1|2201347_2202166_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
AYL57071.1|2202340_2203897_-	hypothetical protein	NA	O64338	Escherichia_phage	43.6	7.9e-87
AYL57072.1|2203958_2207528_-	host specificity protein	NA	O64335	Escherichia_phage	86.5	0.0e+00
AYL59848.1|2207580_2208183_-|tail	phage tail protein	tail	K7PHE5	Enterobacteria_phage	73.5	1.6e-72
AYL57073.1|2208603_2209314_-	peptidase P60	NA	K7PGR2	Enterobacteria_phage	94.1	3.7e-140
AYL57074.1|2209315_2210071_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	86.5	2.8e-130
AYL57075.1|2210067_2210415_-|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	69.6	9.5e-41
AYL57076.1|2210418_2213562_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	86.0	0.0e+00
AYL57077.1|2213545_2213860_-|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	91.3	2.4e-51
AYL57078.1|2213868_2214300_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	74.1	7.1e-54
AYL57079.1|2214310_2215054_-|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	85.8	8.1e-114
AYL57080.1|2215063_2215465_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	89.5	9.8e-66
AYL57081.1|2215461_2216040_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	96.4	1.2e-93
AYL57082.1|2216049_2216325_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	60.4	2.0e-25
AYL59849.1|2216317_2216644_-	DUF2190 domain-containing protein	NA	K7PJY3	Enterobacterial_phage	59.3	1.2e-29
AYL57083.1|2216735_2218769_-	peptidase S14	NA	K7PKX4	Enterobacterial_phage	84.6	0.0e+00
AYL57084.1|2218713_2220222_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	86.7	2.4e-258
AYL59850.1|2220218_2220434_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	82.9	1.5e-25
AYL57085.1|2220430_2222533_-	DNA packaging protein	NA	K7PH52	Enterobacterial_phage	87.3	0.0e+00
AYL57086.1|2222532_2223021_-	DUF1441 domain-containing protein	NA	K7PJY2	Enterobacterial_phage	94.4	8.9e-77
AYL57087.1|2223271_2223475_-	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	62.9	2.0e-06
AYL57088.1|2223927_2224494_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AYL57089.1|2224472_2225021_-	lysozyme	NA	K7PM52	Enterobacteria_phage	95.6	1.4e-99
AYL57090.1|2224992_2225271_-|holin	holin	holin	K7PGZ9	Enterobacteria_phage	95.7	4.3e-44
AYL57091.1|2225301_2225583_+	hypothetical protein	NA	NA	NA	NA	NA
AYL57092.1|2225652_2226258_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	71.0	3.3e-81
AYL57093.1|2226271_2227312_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	50.6	3.3e-97
AYL57094.1|2227308_2227668_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	65.3	1.0e-42
AYL57095.1|2227670_2227871_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	61.5	7.2e-17
AYL57096.1|2228000_2228246_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	63.5	4.5e-21
AYL57097.1|2228291_2228525_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	97.4	3.3e-37
AYL57098.1|2228831_2229110_-	hypothetical protein	NA	NA	NA	NA	NA
AYL57099.1|2230367_2230808_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	75.2	1.6e-37
AYL57100.1|2230804_2231320_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	91.8	4.9e-94
AYL57101.1|2231321_2231624_-	hypothetical protein	NA	I6RSM9	Salmonella_phage	87.5	1.6e-20
AYL59851.1|2231620_2231959_-	DNA breaking-rejoining protein	NA	H6WRX9	Salmonella_phage	46.7	1.3e-15
AYL57102.1|2231964_2232381_-	hypothetical protein	NA	NA	NA	NA	NA
AYL57103.1|2232396_2232987_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	77.8	4.8e-69
AYL57104.1|2234017_2234572_-	hypothetical protein	NA	NA	NA	NA	NA
AYL59852.1|2234574_2234805_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	59.2	3.6e-20
AYL57105.1|2234894_2235323_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	62.7	1.7e-39
AYL57106.1|2235536_2235752_+	hypothetical protein	NA	NA	NA	NA	NA
AYL59853.1|2235809_2236136_+	transcriptional regulator	NA	NA	NA	NA	NA
AYL57107.1|2236277_2238749_+	exodeoxyribonuclease VIII	NA	K7P6V4	Enterobacteria_phage	38.0	2.1e-110
AYL57108.1|2238794_2239073_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	40.3	1.9e-12
AYL57109.1|2239050_2240130_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	55.3	2.1e-110
2240263:2240288	attR	AAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 6
CP024677	Citrobacter freundii strain UMH16 chromosome, complete genome	5195086	2264568	2314575	5195086	portal,capsid,holin,integrase,head,protease,tail,terminase,tRNA	Enterobacteria_phage(32.0%)	69	2305101:2305116	2320681:2320696
AYL57135.1|2264568_2266341_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AYL57136.1|2266414_2266651_+	hypothetical protein	NA	NA	NA	NA	NA
AYL57137.1|2266607_2267174_+	hydrolase	NA	NA	NA	NA	NA
AYL59856.1|2267255_2267372_-	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
AYL57138.1|2267527_2267767_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	100.0	7.4e-37
AYL57139.1|2267852_2268263_-	hemerythrin	NA	NA	NA	NA	NA
AYL57140.1|2268454_2268787_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	54.2	2.3e-20
AYL57141.1|2268865_2269108_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	3.4e-29
AYL57142.1|2269236_2270457_-	hypothetical protein	NA	K7P7B1	Enterobacteria_phage	69.4	3.8e-68
AYL57143.1|2270466_2271411_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	66.5	1.2e-117
AYL57144.1|2271410_2274131_-|tail	phage tail protein	tail	S4TTF5	Salmonella_phage	92.4	0.0e+00
AYL57145.1|2274130_2274529_-	hypothetical protein	NA	S4TR39	Salmonella_phage	93.9	1.5e-69
AYL57146.1|2274535_2275120_-	hypothetical protein	NA	S4TND4	Salmonella_phage	96.4	7.8e-104
AYL57147.1|2275119_2275713_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	95.9	1.2e-107
AYL57148.1|2275878_2276103_+	hypothetical protein	NA	NA	NA	NA	NA
AYL57149.1|2276091_2276451_-	hypothetical protein	NA	NA	NA	NA	NA
AYL57150.1|2276493_2278968_-|tail	phage tail tape measure protein	tail	K7PM62	Enterobacteria_phage	63.7	5.4e-255
AYL57151.1|2279041_2279761_-	hypothetical protein	NA	NA	NA	NA	NA
AYL57152.1|2279823_2280126_-|tail	phage tail protein	tail	Q9MCU7	Escherichia_phage	61.2	6.1e-28
AYL57153.1|2280110_2280491_-|tail	phage tail protein	tail	K7PJU9	Enterobacteria_phage	76.6	1.0e-43
AYL57154.1|2280544_2281036_-|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	70.0	1.1e-61
AYL57155.1|2281095_2281461_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	69.4	1.9e-47
AYL57156.1|2281457_2281997_-	hypothetical protein	NA	K7PM60	Enterobacteria_phage	87.7	1.3e-81
AYL57157.1|2281989_2282322_-|head,tail	head-tail adaptor protein	head,tail	K7PH08	Enterobacteria_phage	90.0	7.9e-53
AYL57158.1|2282323_2282536_-	hypothetical protein	NA	NA	NA	NA	NA
AYL57159.1|2282599_2282926_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	93.5	7.0e-54
AYL57160.1|2283237_2284455_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	81.7	4.6e-183
AYL57161.1|2284465_2285320_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	80.3	4.5e-124
AYL57162.1|2285332_2286640_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	84.1	5.1e-212
AYL57163.1|2286639_2288382_-|terminase	phage terminase small subunit P27 family	terminase	M4QNU0	Tetraselmis_viridis_virus	42.9	2.3e-135
AYL57164.1|2288335_2288800_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	1.8e-47
AYL59857.1|2288919_2289261_-	HNH endonuclease	NA	A0A2I6PIG1	Escherichia_phage	74.8	3.0e-47
AYL57165.1|2289320_2289506_-	Eag protein	NA	K7PL40	Enterobacteria_phage	50.0	1.5e-05
AYL57166.1|2289636_2289870_-	hypothetical protein	NA	NA	NA	NA	NA
AYL59858.1|2290965_2291505_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	73.8	7.3e-56
AYL57167.1|2291525_2292014_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	71.3	1.4e-66
AYL59859.1|2291997_2292330_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	89.0	4.3e-51
AYL57168.1|2292781_2293315_-	hypothetical protein	NA	NA	NA	NA	NA
AYL57169.1|2293528_2294398_+	hypothetical protein	NA	NA	NA	NA	NA
AYL57170.1|2294660_2295083_+	hypothetical protein	NA	NA	NA	NA	NA
AYL57171.1|2295105_2295471_-	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	89.2	1.7e-56
AYL57172.1|2295488_2296484_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	69.6	6.5e-143
AYL57173.1|2296480_2297164_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	60.4	7.1e-64
AYL57174.1|2297177_2297564_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	89.1	2.4e-61
AYL57175.1|2297678_2298572_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	77.8	3.8e-134
AYL57176.1|2298568_2299435_-	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	87.8	1.9e-34
AYL57177.1|2299424_2299565_-	DUF4222 domain-containing protein	NA	A0A1C9IHY9	Salmonella_phage	80.0	2.2e-09
AYL57178.1|2299776_2300328_-	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	68.4	6.1e-66
AYL57179.1|2300356_2300554_-	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	73.8	1.2e-19
AYL59860.1|2300653_2301310_+	LexA family transcriptional repressor	NA	K7PLZ5	Enterobacterial_phage	66.5	1.8e-85
AYL57180.1|2301662_2301863_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	69.4	1.7e-05
AYL57181.1|2301941_2302184_+	hypothetical protein	NA	U5P4J6	Shigella_phage	66.7	3.7e-07
AYL57182.1|2302194_2303112_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	64.0	3.8e-105
AYL57183.1|2303497_2304037_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	80.4	9.5e-80
AYL57184.1|2304197_2304452_+	hypothetical protein	NA	NA	NA	NA	NA
AYL57185.1|2304448_2304943_+	hypothetical protein	NA	Q76H45	Enterobacteria_phage	44.1	2.6e-15
AYL57186.1|2304944_2305445_+	hypothetical protein	NA	S5VZS4	Pseudomonas_phage	58.6	4.6e-28
2305101:2305116	attL	CAGGTTGTGGTGGACG	NA	NA	NA	NA
AYL57187.1|2305434_2305875_+	hypothetical protein	NA	A0A088CE95	Shigella_phage	42.9	2.8e-13
AYL57188.1|2305876_2306449_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	81.1	8.7e-92
AYL57189.1|2306486_2306723_+	excisionase	NA	Q8W657	Enterobacteria_phage	92.3	2.1e-39
AYL57190.1|2306781_2308095_+|integrase	integrase	integrase	Q8W658	Enterobacteria_phage	89.2	2.8e-234
AYL57191.1|2308082_2308847_+	hypothetical protein	NA	Q859D1	Escherichia_coli_phage	79.5	1.2e-56
AYL57192.1|2308899_2309295_+	hypothetical protein	NA	NA	NA	NA	NA
AYL57193.1|2309335_2310079_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	31.3	3.2e-25
AYL57194.1|2310075_2311044_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AYL57195.1|2311064_2311253_-	hypothetical protein	NA	NA	NA	NA	NA
AYL57196.1|2311287_2312034_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AYL57197.1|2312036_2312603_-	VOC family protein	NA	NA	NA	NA	NA
AYL57198.1|2312841_2314575_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	1.7e-85
2320681:2320696	attR	CAGGTTGTGGTGGACG	NA	NA	NA	NA
>prophage 7
CP024677	Citrobacter freundii strain UMH16 chromosome, complete genome	5195086	2489557	2497063	5195086		Enterobacteria_phage(42.86%)	7	NA	NA
AYL57370.1|2489557_2490106_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	1.0e-49
AYL57371.1|2490108_2490987_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.4	8.7e-107
AYL57372.1|2491040_2491940_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	36.3	2.1e-31
AYL57373.1|2491939_2493025_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	2.2e-99
AYL57374.1|2493393_2494287_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.3	3.3e-45
AYL57375.1|2494524_2495520_-	UDP-N-acetylglucosamine 4-epimerase	NA	A0A0K1L6Z1	Scale_drop_disease_virus	28.1	1.9e-09
AYL57376.1|2495668_2497063_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	35.0	6.1e-22
>prophage 8
CP024677	Citrobacter freundii strain UMH16 chromosome, complete genome	5195086	2538913	2548491	5195086	protease	Bacillus_phage(28.57%)	8	NA	NA
AYL57406.1|2538913_2540317_+	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	29.6	3.9e-32
AYL57407.1|2540313_2541036_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
AYL57408.1|2541171_2541504_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AYL57409.1|2541663_2543025_+	U32 family peptidase	NA	Q6DW11	Phage_TP	92.9	5.3e-204
AYL57410.1|2543294_2545571_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
AYL57411.1|2545601_2545922_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
AYL57412.1|2546245_2546470_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
AYL57413.1|2546544_2548491_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.8	2.4e-40
>prophage 9
CP024677	Citrobacter freundii strain UMH16 chromosome, complete genome	5195086	2586639	2595058	5195086	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
AYL57450.1|2586639_2588673_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	4.0e-54
AYL57451.1|2588879_2589338_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	68.6	6.6e-50
AYL59869.1|2589380_2589851_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
AYL57452.1|2589897_2590617_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AYL57453.1|2590613_2592299_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
AYL57454.1|2592524_2593256_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.0e-105
AYL57455.1|2593307_2593415_+	hypothetical protein	NA	NA	NA	NA	NA
AYL57456.1|2593395_2594127_-	ABC transporter permease	NA	NA	NA	NA	NA
AYL57457.1|2594110_2595058_-	ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.1	2.6e-08
>prophage 10
CP024677	Citrobacter freundii strain UMH16 chromosome, complete genome	5195086	3570198	3577322	5195086		uncultured_Caudovirales_phage(100.0%)	9	NA	NA
AYL58291.1|3570198_3570552_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	47.2	5.9e-22
AYL58292.1|3570608_3571088_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	51.3	1.8e-34
AYL58293.1|3571110_3571476_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AYL58294.1|3571499_3573266_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AYL58295.1|3573306_3574596_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.5	3.3e-171
AYL58296.1|3574653_3575082_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.8e-49
AYL58297.1|3575154_3575664_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	37.8	6.5e-22
AYL58298.1|3575803_3576301_+	phosphatase	NA	NA	NA	NA	NA
AYL58299.1|3576599_3577322_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.0	1.8e-97
>prophage 11
CP024677	Citrobacter freundii strain UMH16 chromosome, complete genome	5195086	4886736	4937260	5195086	transposase,integrase	Shigella_phage(18.18%)	46	4876822:4876843	4937416:4937437
4876822:4876843	attL	GAATAGTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYL59956.1|4886736_4887943_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.1	4.0e-102
AYL59468.1|4888391_4888616_-	hypothetical protein	NA	NA	NA	NA	NA
AYL59469.1|4888844_4889060_+	glycogen synthesis protein GlgS	NA	NA	NA	NA	NA
AYL59470.1|4889662_4890271_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYL59471.1|4890267_4891419_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYL59472.1|4891415_4892621_+	ABC transporter permease	NA	NA	NA	NA	NA
AYL59473.1|4892622_4893333_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	2.8e-31
AYL59474.1|4893361_4893835_+	cytochrome C	NA	NA	NA	NA	NA
AYL59475.1|4893821_4895309_+	RND transporter	NA	NA	NA	NA	NA
AYL59957.1|4895439_4895997_+|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	80.5	7.5e-48
AYL59476.1|4895999_4898972_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	71.9	0.0e+00
AYL59477.1|4900093_4901095_-	hypothetical protein	NA	NA	NA	NA	NA
AYL59478.1|4901221_4901884_+	DUF1956 domain-containing protein	NA	NA	NA	NA	NA
AYL59479.1|4905233_4906514_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
AYL59480.1|4906659_4908828_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
AYL59481.1|4909584_4909800_-	glycogen synthesis protein GlgS	NA	NA	NA	NA	NA
AYL59482.1|4910028_4910253_+	hypothetical protein	NA	NA	NA	NA	NA
AYL59483.1|4910700_4911908_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.1	4.0e-102
AYL59484.1|4911950_4913543_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	60.6	8.8e-174
AYL59485.1|4913573_4913924_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	67.2	9.6e-41
AYL59486.1|4913920_4914325_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	67.5	1.6e-23
AYL59487.1|4915108_4915405_-	hypothetical protein	NA	NA	NA	NA	NA
AYL59488.1|4916279_4917224_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	40.6	1.1e-54
AYL59489.1|4917546_4917783_+	antitoxin	NA	NA	NA	NA	NA
AYL59490.1|4917785_4918100_+	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AYL59491.1|4918096_4918849_-	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
AYL59492.1|4918857_4920594_-	MFS transporter	NA	NA	NA	NA	NA
AYL59493.1|4921369_4921675_-	dpoa decarboxylase	NA	NA	NA	NA	NA
AYL59494.1|4921723_4922026_-	kikA from plasmid origin	NA	NA	NA	NA	NA
AYL59495.1|4922074_4922473_-	Cag pathogenicity island protein Cag12	NA	NA	NA	NA	NA
AYL59496.1|4922469_4923495_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
AYL59497.1|4923484_4924711_-	type VI secretion protein	NA	NA	NA	NA	NA
AYL59498.1|4924724_4925633_-	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
AYL59499.1|4925629_4926313_-	type IV secretion system protein	NA	NA	NA	NA	NA
AYL59500.1|4926536_4927604_-	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
AYL59958.1|4927615_4927831_-	hypothetical protein	NA	NA	NA	NA	NA
AYL59501.1|4927861_4928566_-	type IV secretion system protein VirB5	NA	NA	NA	NA	NA
AYL59502.1|4928586_4931331_-	ATPase	NA	NA	NA	NA	NA
AYL59503.1|4931341_4931635_-	TriB protein	NA	NA	NA	NA	NA
AYL59504.1|4931634_4932345_-	type VI secretion protein	NA	NA	NA	NA	NA
AYL59505.1|4932421_4932655_-	hypothetical protein	NA	NA	NA	NA	NA
AYL59506.1|4933049_4933259_-	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AYL59507.1|4933248_4933839_-	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
AYL59508.1|4933861_4934047_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	50.0	7.3e-08
AYL59509.1|4934182_4935109_-	hypothetical protein	NA	NA	NA	NA	NA
AYL59510.1|4935991_4937260_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	36.0	8.8e-68
4937416:4937437	attR	GAATAGTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 1
CP024678	Citrobacter freundii strain UMH16 plasmid pUMH16, complete sequence	51504	8951	24603	51504		Enterobacteria_phage(18.18%)	15	NA	NA
AYL59974.1|8951_11822_-	hypothetical protein	NA	A0A1B2LRT6	Wolbachia_phage	34.2	3.2e-17
AYL59975.1|11868_12018_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
AYL59976.1|12135_12555_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AYL59977.1|12565_12787_-	hypothetical protein	NA	NA	NA	NA	NA
AYL59978.1|12786_13464_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.9e-29
AYL59979.1|13815_14487_+	DNA breaking-rejoining protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	1.5e-79
AYL59980.1|14666_15089_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
AYL59981.1|15088_16360_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.2	2.7e-157
AYL59982.1|16505_17477_-	chromosome partitioning protein ParB	NA	Q1MVJ4	Enterobacteria_phage	68.9	9.6e-115
AYL59983.1|17473_18679_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
AYL59984.1|19286_21113_+	OLD family endonuclease	NA	E5E3R2	Burkholderia_phage	23.2	1.5e-12
AYL59985.1|21284_21635_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	55.2	2.4e-20
AYL59986.1|21783_22215_-	copper-binding protein	NA	NA	NA	NA	NA
AYL59987.1|22451_23930_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.0	1.8e-27
AYL59988.1|23922_24603_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.5	1.9e-32
