The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024683	Citrobacter freundii strain UMH13 chromosome, complete genome	4917351	1205548	1214209	4917351	transposase	uncultured_Caudovirales_phage(37.5%)	9	NA	NA
AYL41826.1|1205548_1206139_+	DUF4326 domain-containing protein	NA	A0A0S0N995	Pseudomonas_phage	43.0	4.4e-14
AYL41827.1|1207201_1208370_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.1	7.1e-165
AYL41828.1|1208653_1209163_-	DedA family protein	NA	NA	NA	NA	NA
AYL41829.1|1209337_1209580_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
AYL41830.1|1209658_1209892_+	DNA polymerase V	NA	A0A222YZE2	Escherichia_phage	81.8	6.6e-22
AYL41831.1|1209968_1210667_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	67.7	3.8e-89
AYL45169.1|1210752_1211073_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	3.2e-19
AYL41832.1|1212408_1212834_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	7.3e-51
AYL41833.1|1213723_1214209_+	hypothetical protein	NA	A0A1B0VBR9	Salmonella_phage	34.9	3.0e-08
>prophage 2
CP024683	Citrobacter freundii strain UMH13 chromosome, complete genome	4917351	1309057	1326995	4917351	transposase,tRNA	Salmonella_phage(15.38%)	20	NA	NA
AYL41921.1|1309057_1310533_-	hypothetical protein	NA	A0A192Y7W8	Salmonella_phage	26.3	1.1e-34
AYL41922.1|1310596_1310719_+	ABC transporter	NA	NA	NA	NA	NA
AYL41923.1|1310757_1311738_-|transposase	IS5/IS1182 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
AYL41924.1|1311783_1312653_-	glycosyltransferase	NA	U5P087	Shigella_phage	92.6	3.3e-151
AYL41925.1|1312649_1313012_-	GtrA family protein	NA	B9UDL8	Salmonella_phage	71.7	3.6e-43
AYL41926.1|1313059_1313320_+	hypothetical protein	NA	NA	NA	NA	NA
AYL41927.1|1313407_1315336_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	9.7e-127
AYL41928.1|1315339_1315882_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	8.2e-15
AYL41929.1|1315978_1316176_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AYL41930.1|1316231_1316588_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AYL41931.1|1316957_1317941_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
AYL41932.1|1317956_1320344_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AYL41933.1|1320348_1320648_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AYL41934.1|1320801_1321782_+	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.7e-15
AYL41935.1|1321842_1322394_+	glutathione peroxidase	NA	NA	NA	NA	NA
AYL41936.1|1322393_1323143_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
AYL41937.1|1323220_1323685_+	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
AYL41938.1|1324001_1324715_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYL41939.1|1324776_1326219_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	7.7e-52
AYL41940.1|1326215_1326995_-	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.3	1.2e-11
>prophage 3
CP024683	Citrobacter freundii strain UMH13 chromosome, complete genome	4917351	1654248	1678103	4917351	terminase,plate,tail	Escherichia_phage(88.0%)	28	NA	NA
AYL42233.1|1654248_1654686_-	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	55.6	3.3e-30
AYL42234.1|1654711_1654888_-	addiction module toxin, HicA family	NA	NA	NA	NA	NA
AYL42235.1|1655355_1655901_-|tail	phage tail protein	tail	F1BUK2	Cronobacter_phage	29.8	2.0e-16
AYL42236.1|1657507_1658134_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	76.0	6.0e-94
AYL42237.1|1658117_1659344_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	72.5	6.3e-164
AYL42238.1|1659365_1659857_+	hypothetical protein	NA	NA	NA	NA	NA
AYL42239.1|1659859_1660207_-	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	76.5	9.2e-44
AYL45190.1|1660209_1660887_-|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	64.3	1.7e-81
AYL42240.1|1660922_1661927_-	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	53.0	9.3e-97
AYL42241.1|1661926_1662190_-	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	60.0	1.7e-26
AYL42242.1|1662189_1662849_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	74.0	4.2e-90
AYL42243.1|1662849_1664742_-	lytic transglycosylase	NA	A0A0U2QV45	Escherichia_phage	48.9	1.3e-168
AYL42244.1|1664806_1665424_-	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	65.2	1.5e-73
AYL42245.1|1665423_1665852_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	85.9	1.8e-65
AYL42246.1|1665877_1667206_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	68.5	2.1e-168
AYL42247.1|1667205_1668156_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	72.1	9.3e-123
AYL42248.1|1668142_1668571_-	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	59.6	1.4e-41
AYL42249.1|1668567_1669023_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	62.0	2.4e-44
AYL42250.1|1669022_1669493_-	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	68.6	1.2e-54
AYL42251.1|1669558_1670587_-	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	74.8	2.4e-148
AYL42252.1|1670597_1671209_-	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	66.3	2.2e-72
AYL42253.1|1671201_1672512_-	NUDIX hydrolase	NA	A0A0U2QW61	Escherichia_phage	69.7	4.9e-130
AYL42254.1|1672492_1673323_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	76.4	3.1e-122
AYL42255.1|1673282_1674704_-	hypothetical protein	NA	A0A0U2S5X9	Escherichia_phage	74.7	1.4e-210
AYL45191.1|1674719_1675850_-|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	75.6	1.6e-169
AYL42256.1|1676041_1677166_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	50.4	7.8e-68
AYL45192.1|1677169_1677379_-	hypothetical protein	NA	NA	NA	NA	NA
AYL42257.1|1677398_1678103_-	hypothetical protein	NA	A0A1J0ME72	Mycobacterium_phage	32.1	2.9e-20
>prophage 4
CP024683	Citrobacter freundii strain UMH13 chromosome, complete genome	4917351	1693749	1703962	4917351	integrase	Escherichia_phage(57.14%)	12	1697579:1697592	1712247:1712260
AYL42283.1|1693749_1696626_+	exodeoxyribonuclease	NA	A0A0U2I1R6	Escherichia_phage	41.2	5.4e-206
AYL42284.1|1696637_1697747_+	enterohemolysin	NA	A0A0U2S5Y9	Escherichia_phage	64.9	1.7e-128
1697579:1697592	attL	CATCGAGAAAATGA	NA	NA	NA	NA
AYL42285.1|1697784_1698237_+	hypothetical protein	NA	NA	NA	NA	NA
AYL42286.1|1698233_1698542_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	68.0	7.4e-29
AYL42287.1|1698538_1699204_+	morphogenetic protein	NA	R9VWB9	Serratia_phage	42.3	2.5e-37
AYL42288.1|1699200_1699650_+	hypothetical protein	NA	NA	NA	NA	NA
AYL45194.1|1699689_1699875_+	hypothetical protein	NA	A0A0U2QL97	Escherichia_phage	60.7	1.5e-13
AYL42289.1|1699874_1700132_+	hypothetical protein	NA	NA	NA	NA	NA
AYL45195.1|1700122_1702111_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	48.6	8.4e-182
AYL42290.1|1702107_1702500_+	hypothetical protein	NA	NA	NA	NA	NA
AYL42291.1|1702581_1702842_+	hypothetical protein	NA	NA	NA	NA	NA
AYL42292.1|1702819_1703962_+|integrase	integrase	integrase	O21925	Phage_21	42.3	6.7e-75
1712247:1712260	attR	TCATTTTCTCGATG	NA	NA	NA	NA
>prophage 5
CP024683	Citrobacter freundii strain UMH13 chromosome, complete genome	4917351	1963005	2048639	4917351	terminase,holin,protease,tail,head,tRNA,integrase,portal,capsid	Klebsiella_phage(28.85%)	97	1996483:1996510	2048770:2048797
AYL42519.1|1963005_1963701_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	A0A0R6PI74	Moraxella_phage	35.4	5.8e-05
AYL42520.1|1963759_1965670_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.1	9.1e-93
AYL42521.1|1965810_1966155_+	RidA family protein	NA	NA	NA	NA	NA
AYL42522.1|1966161_1966341_-	YoaH family protein	NA	NA	NA	NA	NA
AYL42523.1|1966421_1967786_+	aminodeoxychorismate synthase component 1	NA	S4VNU7	Pandoravirus	40.2	2.9e-40
AYL42524.1|1967789_1968368_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
AYL42525.1|1968551_1969916_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AYL42526.1|1970046_1971648_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AYL42527.1|1971654_1973214_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	5.1e-41
AYL42528.1|1973673_1974636_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AYL42529.1|1974694_1975495_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AYL42530.1|1975507_1976359_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AYL42531.1|1976419_1976878_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
AYL42532.1|1977256_1977877_+	hypothetical protein	NA	NA	NA	NA	NA
AYL42533.1|1977873_1978683_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AYL42534.1|1978746_1980492_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
AYL42535.1|1980711_1980921_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AYL42536.1|1980933_1981077_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
AYL42537.1|1981038_1981221_+	hypothetical protein	NA	NA	NA	NA	NA
AYL42538.1|1981713_1981998_-	hypothetical protein	NA	NA	NA	NA	NA
AYL42539.1|1982072_1982216_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
AYL42540.1|1982380_1982620_+	hypothetical protein	NA	NA	NA	NA	NA
AYL42541.1|1982734_1983526_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AYL42542.1|1983700_1985074_+	MFS transporter	NA	NA	NA	NA	NA
AYL42543.1|1985120_1986002_-|protease	protease HtpX	protease	NA	NA	NA	NA
AYL42544.1|1986194_1988243_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	1.2e-87
AYL42545.1|1988262_1988949_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AYL42546.1|1989045_1989543_-	Free methionine-R-sulfoxide reductase	NA	NA	NA	NA	NA
AYL42547.1|1989671_1990955_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AYL42548.1|1990923_1993557_+	MCE family protein	NA	NA	NA	NA	NA
AYL42549.1|1993636_1995058_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AYL42550.1|1995155_1995395_+	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
AYL42551.1|1995497_1995689_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AYL42552.1|1995689_1996331_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.5	6.6e-56
1996483:1996510	attL	ATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
AYL45210.1|1996671_1996770_+	hypothetical protein	NA	S4TND2	Salmonella_phage	85.7	1.8e-05
AYL42553.1|1996882_1997554_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.0	2.2e-78
AYL42554.1|1997904_1998228_-	hypothetical protein	NA	NA	NA	NA	NA
AYL42555.1|1998303_1998771_-	hypothetical protein	NA	NA	NA	NA	NA
AYL45211.1|1999006_1999186_+	hypothetical protein	NA	NA	NA	NA	NA
AYL42556.1|1999286_1999700_+	hypothetical protein	NA	NA	NA	NA	NA
AYL42557.1|1999995_2000385_-	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.1	3.0e-51
AYL42558.1|2000705_2000948_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	79.2	1.2e-29
AYL42559.1|2001117_2002110_+	hypothetical protein	NA	A0A1V0SAH6	Catovirus	31.5	2.6e-06
AYL42560.1|2002182_2002779_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	56.5	5.0e-58
AYL42561.1|2002778_2005358_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	49.5	2.5e-61
AYL42562.1|2005398_2008803_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	70.2	0.0e+00
AYL42563.1|2008875_2009553_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	70.2	5.9e-79
AYL42564.1|2009450_2010185_-|tail	phage tail protein	tail	A5LH41	Enterobacteria_phage	76.2	8.8e-113
AYL42565.1|2010196_2010892_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	72.3	4.2e-96
AYL42566.1|2010900_2011233_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	67.9	2.4e-41
AYL45212.1|2011233_2014536_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	66.4	0.0e+00
AYL45213.1|2014535_2014763_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	65.3	9.0e-24
AYL42567.1|2014783_2015146_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	56.8	4.8e-27
AYL42568.1|2015208_2015691_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	80.6	2.3e-61
AYL42569.1|2015724_2016126_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	86.5	4.4e-58
AYL42570.1|2016122_2016512_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	66.9	1.3e-43
AYL45214.1|2016827_2017145_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	79.6	2.1e-39
AYL42571.1|2017601_2018888_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	1.5e-211
AYL42572.1|2018960_2019881_-	serine peptidase	NA	Q6UAX7	Klebsiella_phage	80.1	2.7e-135
AYL42573.1|2019917_2021177_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	5.8e-221
AYL42574.1|2021176_2021356_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	71.2	3.3e-13
AYL42575.1|2021349_2023077_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	92.8	0.0e+00
AYL42576.1|2023073_2023580_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	93.9	1.0e-83
AYL42577.1|2023691_2023892_-	hypothetical protein	NA	Q6UAR8	Klebsiella_phage	87.9	6.5e-10
AYL42578.1|2023888_2024251_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	85.8	1.3e-56
AYL45215.1|2024529_2025069_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	80.0	3.8e-44
AYL42579.1|2025426_2025600_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
AYL42580.1|2025803_2026034_-	hypothetical protein	NA	NA	NA	NA	NA
AYL45216.1|2026107_2026296_-	cold-shock protein	NA	NA	NA	NA	NA
AYL42581.1|2026306_2026519_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	7.8e-22
AYL42582.1|2026908_2027442_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	40.9	1.8e-06
AYL42583.1|2027423_2027969_-	lysozyme	NA	K7PM52	Enterobacteria_phage	95.0	3.2e-99
AYL42584.1|2027940_2028219_-|holin	holin	holin	K7PGZ9	Enterobacteria_phage	97.8	5.1e-45
AYL42585.1|2028374_2028563_-	hypothetical protein	NA	NA	NA	NA	NA
AYL42586.1|2029486_2029702_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	80.6	5.9e-25
AYL42587.1|2029998_2030211_+	cold-shock protein	NA	NA	NA	NA	NA
AYL42588.1|2030534_2030930_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	60.0	3.3e-37
AYL42589.1|2030944_2031985_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	52.0	1.7e-101
AYL42590.1|2031981_2032341_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	64.4	4.0e-42
AYL42591.1|2032343_2032544_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	63.1	1.1e-17
AYL42592.1|2032671_2032911_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	59.7	5.7e-21
AYL42593.1|2033444_2034671_+	hypothetical protein	NA	NA	NA	NA	NA
AYL42594.1|2034716_2035019_-	hypothetical protein	NA	NA	NA	NA	NA
AYL42595.1|2035395_2036139_+	hypothetical protein	NA	NA	NA	NA	NA
AYL42596.1|2036679_2038920_+	NTPase	NA	NA	NA	NA	NA
AYL42597.1|2039101_2040460_-	hypothetical protein	NA	NA	NA	NA	NA
AYL42598.1|2040684_2041110_-	hypothetical protein	NA	NA	NA	NA	NA
AYL42599.1|2041165_2041576_-	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	63.6	2.4e-06
AYL42600.1|2041695_2042490_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	55.2	7.2e-68
AYL42601.1|2042544_2043099_-	hypothetical protein	NA	NA	NA	NA	NA
AYL42602.1|2043101_2043317_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	54.8	1.3e-16
AYL42603.1|2043418_2043808_+	transcriptional regulator	NA	A0A0M4R5D1	Salmonella_phage	60.8	3.5e-36
AYL42604.1|2044036_2044252_+	hypothetical protein	NA	NA	NA	NA	NA
AYL45217.1|2044309_2044636_+	transcriptional regulator	NA	NA	NA	NA	NA
AYL42605.1|2044777_2047258_+	exonuclease	NA	K7P6V4	Enterobacteria_phage	38.7	5.6e-111
AYL42606.1|2047303_2047582_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	40.3	1.9e-12
AYL42607.1|2047559_2048639_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	55.6	3.5e-110
2048770:2048797	attR	ATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 6
CP024683	Citrobacter freundii strain UMH13 chromosome, complete genome	4917351	2238946	2246981	4917351		Enterobacteria_phage(33.33%)	8	NA	NA
AYL42807.1|2238946_2240053_-	aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	31.0	2.9e-43
AYL42808.1|2240056_2240590_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYL42809.1|2240579_2240978_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
AYL42810.1|2240984_2241854_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	68.8	5.2e-112
AYL42811.1|2241853_2242939_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	7.4e-100
AYL42812.1|2243312_2244206_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.3	4.3e-45
AYL42813.1|2244443_2245439_-	UDP-N-acetylglucosamine 4-epimerase	NA	A0A0K1L6Z1	Scale_drop_disease_virus	28.5	1.1e-09
AYL42814.1|2245586_2246981_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.8	1.7e-19
>prophage 7
CP024683	Citrobacter freundii strain UMH13 chromosome, complete genome	4917351	2288824	2298403	4917351	protease	Bacillus_phage(28.57%)	8	NA	NA
AYL42844.1|2288824_2290228_+	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	29.2	5.0e-32
AYL42845.1|2290224_2290947_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
AYL42846.1|2291082_2291415_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AYL42847.1|2291574_2292936_+	U32 family peptidase	NA	Q6DW11	Phage_TP	92.9	4.1e-204
AYL42848.1|2293206_2295483_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
AYL42849.1|2295513_2295834_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
AYL42850.1|2296157_2296382_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
AYL42851.1|2296456_2298403_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	41.3	1.6e-39
>prophage 8
CP024683	Citrobacter freundii strain UMH13 chromosome, complete genome	4917351	2336639	2345058	4917351	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
AYL42888.1|2336639_2338673_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	5.2e-54
AYL42889.1|2338879_2339338_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	68.0	5.6e-49
AYL45227.1|2339380_2339851_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
AYL42890.1|2339897_2340617_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AYL42891.1|2340613_2342299_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
AYL42892.1|2342524_2343256_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.0	1.4e-105
AYL42893.1|2343307_2343415_+	hypothetical protein	NA	NA	NA	NA	NA
AYL42894.1|2343395_2344127_-	ABC transporter permease	NA	NA	NA	NA	NA
AYL42895.1|2344110_2345058_-	ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.1	2.6e-08
>prophage 9
CP024683	Citrobacter freundii strain UMH13 chromosome, complete genome	4917351	4783282	4791856	4917351	capsid,integrase	Enterobacteria_phage(88.89%)	11	4777517:4777530	4799527:4799540
4777517:4777530	attL	CCGCCAGCGCTTTT	NA	NA	NA	NA
AYL45019.1|4783282_4783858_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	50.8	1.9e-38
AYL45020.1|4783874_4784117_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	59.3	1.1e-19
AYL45021.1|4784113_4784917_-|capsid	capsid protein	capsid	Q7M2A2	Enterobacteria_phage	26.5	5.1e-13
AYL45022.1|4785469_4785736_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	64.8	2.8e-24
AYL45023.1|4785732_4786287_+	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	73.9	3.9e-36
AYL45024.1|4786279_4786579_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	69.7	5.3e-32
AYL45025.1|4786571_4787021_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	67.3	1.7e-45
AYL45326.1|4787125_4787353_+	hypothetical protein	NA	NA	NA	NA	NA
AYL45026.1|4787349_4787670_+	hypothetical protein	NA	NA	NA	NA	NA
AYL45027.1|4787681_4790015_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.0	0.0e+00
AYL45028.1|4790590_4791856_+|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	43.0	8.2e-82
4799527:4799540	attR	AAAAGCGCTGGCGG	NA	NA	NA	NA
