The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024680	Citrobacter freundii strain UMH14 chromosome, complete genome	4859315	939635	1046016	4859315	terminase,holin,plate,capsid,protease,tail,portal,tRNA,head,integrase	Escherichia_phage(26.42%)	101	950540:950559	1050629:1050648
AYL46141.1|939635_939890_+|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	50.6	7.0e-17
AYL46142.1|939886_940921_-	acyltransferase	NA	NA	NA	NA	NA
AYL46143.1|943016_944702_-	transporter	NA	NA	NA	NA	NA
AYL46144.1|944971_945352_+	hypothetical protein	NA	NA	NA	NA	NA
AYL46145.1|945386_945650_-	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	67.9	3.8e-26
AYL46146.1|945822_946113_+	hypothetical protein	NA	NA	NA	NA	NA
AYL46147.1|946096_946819_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AYL46148.1|946878_947781_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.0	2.6e-37
AYL46149.1|947871_948348_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
AYL46150.1|948781_949894_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AYL46151.1|950032_951166_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	1.1e-29
950540:950559	attL	CTGCTGCTGCTGGATGAACC	NA	NA	NA	NA
AYL46152.1|951175_952129_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AYL46153.1|952125_952971_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AYL46154.1|953030_953519_+	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AYL46155.1|953560_954688_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.4	1.6e-28
AYL46156.1|956516_957194_-	amidohydrolase	NA	NA	NA	NA	NA
AYL46157.1|957210_958071_-	pirin family protein	NA	NA	NA	NA	NA
AYL46158.1|958179_959091_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYL46159.1|959170_959389_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AYL46160.1|959674_960379_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AYL46161.1|960423_962145_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.6	8.1e-16
AYL46162.1|962145_963912_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	25.6	1.4e-23
AYL46163.1|964026_964995_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	1.9e-62
AYL46164.1|965542_966037_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AYL46165.1|966171_970233_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	2.9e-88
AYL46166.1|970344_970956_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AYL46167.1|970966_972310_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	4.3e-81
AYL46168.1|972402_973695_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.1	2.5e-94
AYL46169.1|973931_976376_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.6	1.0e-221
AYL46170.1|976386_977004_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	59.1	2.8e-75
AYL46171.1|977005_977869_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AYL46172.1|977978_978605_-	hydrolase	NA	NA	NA	NA	NA
AYL46173.1|978990_980139_+	MFS transporter	NA	NA	NA	NA	NA
AYL46174.1|980352_981774_+	amino acid permease	NA	NA	NA	NA	NA
AYL46175.1|981817_982615_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.7e-21
AYL46176.1|982646_983642_-|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	87.3	2.2e-167
AYL46177.1|983784_984084_-	XRE family transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	73.7	7.4e-34
AYL46178.1|984190_984550_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	74.4	1.3e-45
AYL46179.1|984530_984731_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	67.9	4.1e-12
AYL46180.1|984727_985228_+	replication protein B	NA	M1SV55	Escherichia_phage	75.3	5.3e-69
AYL46181.1|985291_985624_+	hypothetical protein	NA	NA	NA	NA	NA
AYL46182.1|985656_985848_+	hypothetical protein	NA	NA	NA	NA	NA
AYL46183.1|985847_986123_+	hypothetical protein	NA	S4TP00	Salmonella_phage	64.8	3.6e-27
AYL46184.1|986112_988404_+	replication protein A	NA	Q858T4	Yersinia_virus	74.3	0.0e+00
AYL46185.1|988403_988748_+	hypothetical protein	NA	NA	NA	NA	NA
AYL46186.1|988748_988985_+	hypothetical protein	NA	Q6K1F0	Salmonella_virus	69.2	3.1e-19
AYL46187.1|989052_989484_-	hypothetical protein	NA	S4TUD6	Salmonella_phage	93.0	2.7e-69
AYL46188.1|989482_989677_+	hypothetical protein	NA	S4TRZ0	Salmonella_phage	89.1	3.8e-23
AYL46189.1|990090_991074_+	hypothetical protein	NA	NA	NA	NA	NA
AYL46190.1|991070_991760_+	hypothetical protein	NA	NA	NA	NA	NA
AYL46191.1|991817_992846_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	79.7	3.4e-163
AYL46192.1|992845_994615_-	oxidoreductase	NA	Q9T0R3	Escherichia_phage	81.2	8.5e-287
AYL46193.1|994779_995643_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	66.6	1.8e-101
AYL46194.1|995674_996835_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	62.8	9.6e-130
AYL46195.1|996838_997597_+|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	66.7	1.3e-79
AYL46196.1|997694_998195_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	3.8e-59
AYL46197.1|998194_998398_+|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
AYL46198.1|998388_998610_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
AYL46199.1|998593_999103_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.6	4.6e-76
AYL46200.1|999099_999513_+	protein lysB	NA	O80310	Escherichia_phage	59.1	7.1e-35
AYL46201.1|999412_999658_+|holin	holin	holin	S4TNY4	Salmonella_phage	73.1	7.2e-27
AYL46202.1|999620_1000088_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.7	1.4e-55
AYL46203.1|1000080_1000536_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	69.1	1.3e-50
AYL46204.1|1000549_1001293_+	hypothetical protein	NA	NA	NA	NA	NA
AYL46205.1|1001367_1002009_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	83.1	1.1e-95
AYL46206.1|1002005_1002353_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	69.6	1.0e-39
AYL46207.1|1002768_1003287_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	2.0e-71
AYL46208.1|1003349_1003631_+|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	79.1	4.7e-30
AYL46209.1|1003663_1003783_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	3.7e-13
AYL46210.1|1003775_1006205_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	74.4	2.4e-263
AYL46211.1|1006216_1006681_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	74.8	7.6e-62
AYL46212.1|1006683_1007877_+	hypothetical protein	NA	Q6K1G4	Salmonella_virus	78.4	2.3e-166
AYL46213.1|1007939_1008161_+	transcriptional regulator	NA	S4TNZ3	Salmonella_phage	72.6	2.1e-25
AYL46214.1|1008469_1010752_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	3.8e-162
AYL46215.1|1010811_1011759_-	formate transporter FocA	NA	NA	NA	NA	NA
AYL46216.1|1012074_1013835_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AYL46217.1|1013971_1014664_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AYL46218.1|1014876_1015965_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.2	5.9e-81
AYL46219.1|1016034_1017318_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AYL46220.1|1017456_1018218_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYL46221.1|1018389_1019073_+	(d)CMP kinase	NA	NA	NA	NA	NA
AYL46222.1|1019186_1020860_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
AYL46223.1|1021019_1021304_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	39.1	9.2e-10
AYL46224.1|1021510_1023775_+	ComEC family protein	NA	NA	NA	NA	NA
AYL46225.1|1023811_1025560_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	2.4e-60
AYL46226.1|1025556_1026534_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AYL46227.1|1026575_1027808_+	hypothetical protein	NA	NA	NA	NA	NA
AYL46228.1|1027859_1028042_+	protein YcaR	NA	NA	NA	NA	NA
AYL46229.1|1028038_1028785_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AYL46230.1|1028948_1029842_+	hypothetical protein	NA	NA	NA	NA	NA
AYL46231.1|1029948_1030713_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AYL46232.1|1030848_1031652_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AYL46233.1|1031644_1032967_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
AYL46234.1|1032947_1033652_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
AYL46235.1|1033651_1038112_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
AYL46236.1|1038357_1040109_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AYL46237.1|1040286_1040835_+	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	32.6	3.5e-05
AYL46238.1|1040863_1041511_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYL46239.1|1041564_1042755_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AYL46240.1|1042938_1044015_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	53.9	8.7e-101
AYL46241.1|1044615_1046016_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.9	5.0e-80
1050629:1050648	attR	GGTTCATCCAGCAGCAGCAG	NA	NA	NA	NA
>prophage 2
CP024680	Citrobacter freundii strain UMH14 chromosome, complete genome	4859315	1265900	1272853	4859315		uncultured_Caudovirales_phage(57.14%)	8	NA	NA
AYL46447.1|1265900_1267151_+	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	94.4	9.4e-22
AYL46448.1|1267286_1267796_-	DedA family protein	NA	NA	NA	NA	NA
AYL46449.1|1267970_1268213_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
AYL46450.1|1268600_1269299_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	67.2	2.5e-88
AYL49695.1|1269384_1269705_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	1.4e-19
AYL46451.1|1269749_1271039_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.0	2.7e-165
AYL46452.1|1271051_1271477_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	7.3e-51
AYL46453.1|1272358_1272853_+	hypothetical protein	NA	A0A1B0VBR9	Salmonella_phage	32.4	3.4e-07
>prophage 3
CP024680	Citrobacter freundii strain UMH14 chromosome, complete genome	4859315	1364087	1393205	4859315	tail,integrase	Enterobacteria_phage(40.0%)	41	1363885:1363907	1393641:1393663
1363885:1363907	attL	TCTTTGTATGTGATCTTACGTGT	NA	NA	NA	NA
AYL46539.1|1364087_1365296_+|integrase	integrase	integrase	I6R9B6	Salmonella_phage	76.9	8.7e-182
AYL46540.1|1365253_1365490_-	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	53.7	3.3e-13
AYL46541.1|1365594_1365786_-	hypothetical protein	NA	NA	NA	NA	NA
AYL46542.1|1365795_1366035_-	hypothetical protein	NA	M1FPC8	Enterobacteria_phage	46.2	5.0e-09
AYL46543.1|1365997_1366390_-	protein ninX	NA	A0A1P8DTT2	Salmonella_phage	44.3	2.3e-19
AYL46544.1|1366394_1366652_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	53.8	9.6e-06
AYL46545.1|1366651_1366867_-	conjugal transfer protein TraR	NA	A0A0N7C211	Escherichia_phage	55.6	4.0e-13
AYL46546.1|1366863_1367136_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	61.2	1.1e-20
AYL49704.1|1367138_1367354_-	hypothetical protein	NA	NA	NA	NA	NA
AYL46547.1|1367359_1367911_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	58.3	8.2e-55
AYL46548.1|1367907_1368069_-	cruciferin	NA	M1FJ61	Enterobacteria_phage	69.8	1.2e-14
AYL46549.1|1368059_1368740_-	exonuclease	NA	M9NZE1	Enterobacteria_phage	93.4	4.2e-125
AYL46550.1|1368736_1369582_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	61.2	6.2e-70
AYL46551.1|1369600_1369885_-	hypothetical protein	NA	G8C7T1	Escherichia_phage	88.3	3.0e-45
AYL46552.1|1369892_1370864_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	76.3	3.8e-39
AYL46553.1|1370940_1371147_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	100.0	3.6e-32
AYL46554.1|1371614_1372052_-	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	97.9	4.6e-77
AYL46555.1|1372135_1372348_-	hypothetical protein	NA	K7P7B4	Enterobacteria_phage	92.9	7.3e-28
AYL46556.1|1372869_1373355_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
AYL49705.1|1373391_1374096_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	79.1	2.7e-103
AYL46557.1|1374207_1374435_+	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	70.4	2.6e-23
AYL46558.1|1374465_1375008_+	regulator	NA	M9NZI6	Enterobacteria_phage	95.6	1.4e-91
AYL46559.1|1375193_1376135_+	replication protein	NA	A5VW95	Enterobacteria_phage	80.3	8.3e-55
AYL46560.1|1376131_1376821_+	phage replication protein	NA	G8C7U6	Escherichia_phage	95.6	1.0e-126
AYL46561.1|1376822_1377122_+	protein ren	NA	M1FPD5	Enterobacteria_phage	53.7	4.4e-18
AYL46562.1|1377555_1377741_+	hypothetical protein	NA	K7P7P5	Enterobacteria_phage	91.8	6.0e-26
AYL46563.1|1377737_1378322_+	hypothetical protein	NA	K7P6J7	Enterobacteria_phage	32.8	1.7e-10
AYL46564.1|1379184_1379463_+	hypothetical protein	NA	NA	NA	NA	NA
AYL46565.1|1379462_1379660_+	hypothetical protein	NA	NA	NA	NA	NA
AYL46566.1|1379725_1379983_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	80.3	8.0e-29
AYL46567.1|1379982_1380237_+	hypothetical protein	NA	NA	NA	NA	NA
AYL46568.1|1380436_1380886_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	50.7	7.0e-36
AYL46569.1|1380878_1381049_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	61.8	7.7e-12
AYL46570.1|1381452_1382127_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	45.8	3.1e-48
AYL46571.1|1382235_1382565_+	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	50.0	1.6e-21
AYL46572.1|1382607_1385100_+|tail	phage tail tape measure protein	tail	A0A1B1W284	Salmonella_phage	41.1	1.7e-86
AYL46573.1|1385099_1385597_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	88.5	1.6e-86
AYL46574.1|1385596_1386067_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	92.9	1.8e-79
AYL46575.1|1386029_1386446_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	89.0	1.2e-69
AYL46576.1|1386432_1388910_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	87.6	0.0e+00
AYL46577.1|1391243_1393205_-	hypothetical protein	NA	A0A193GZ69	Enterobacter_phage	33.8	9.4e-77
1393641:1393663	attR	TCTTTGTATGTGATCTTACGTGT	NA	NA	NA	NA
>prophage 4
CP024680	Citrobacter freundii strain UMH14 chromosome, complete genome	4859315	1397241	1407279	4859315	tRNA	Tupanvirus(14.29%)	10	NA	NA
AYL46582.1|1397241_1398225_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
AYL46583.1|1398240_1400628_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AYL46584.1|1400632_1400932_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AYL46585.1|1401085_1402066_+	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.7e-15
AYL46586.1|1402126_1402678_+	glutathione peroxidase	NA	NA	NA	NA	NA
AYL46587.1|1402677_1403427_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	7.1e-09
AYL46588.1|1403504_1403969_+	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
AYL46589.1|1404285_1404999_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYL46590.1|1405060_1406503_+	hypothetical protein	NA	A0A075BSJ0	Microcystis_phage	35.3	7.7e-52
AYL46591.1|1406499_1407279_-	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.7	7.9e-11
>prophage 5
CP024680	Citrobacter freundii strain UMH14 chromosome, complete genome	4859315	2327159	2336737	4859315	protease	Bacillus_phage(28.57%)	8	NA	NA
AYL47439.1|2327159_2328563_+	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	29.6	3.9e-32
AYL47440.1|2328559_2329282_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
AYL47441.1|2329417_2329750_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AYL47442.1|2329909_2331271_+	U32 family peptidase	NA	Q6DW11	Phage_TP	92.9	5.3e-204
AYL47443.1|2331540_2333817_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
AYL47444.1|2333847_2334168_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
AYL47445.1|2334491_2334716_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
AYL47446.1|2334790_2336737_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.3	1.6e-39
>prophage 6
CP024680	Citrobacter freundii strain UMH14 chromosome, complete genome	4859315	2374871	2383290	4859315	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
AYL47483.1|2374871_2376905_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	4.0e-54
AYL47484.1|2377111_2377570_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	68.0	5.1e-50
AYL49740.1|2377612_2378083_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
AYL47485.1|2378129_2378849_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AYL47486.1|2378845_2380531_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.8	2.3e-281
AYL47487.1|2380756_2381488_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.8e-105
AYL47488.1|2381539_2381647_+	hypothetical protein	NA	NA	NA	NA	NA
AYL47489.1|2381627_2382359_-	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AYL47490.1|2382342_2383290_-	ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.1	2.6e-08
>prophage 7
CP024680	Citrobacter freundii strain UMH14 chromosome, complete genome	4859315	2912084	2923361	4859315	integrase	Cronobacter_phage(77.78%)	13	2918467:2918482	2934984:2934999
AYL47936.1|2912084_2914037_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.2	1.9e-223
AYL47937.1|2914419_2914653_-	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
AYL47938.1|2914720_2915122_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	2.9e-49
AYL47939.1|2915121_2915550_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	54.0	9.6e-27
AYL47940.1|2915558_2915732_-	hypothetical protein	NA	NA	NA	NA	NA
AYL47941.1|2915971_2916433_+	hypothetical protein	NA	NA	NA	NA	NA
AYL47942.1|2916481_2916985_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	71.9	2.3e-59
AYL47943.1|2917041_2917230_-	hypothetical protein	NA	F1BUN7	Cronobacter_phage	63.8	7.0e-14
AYL47944.1|2917381_2917957_+	Repressor protein CI	NA	F1BUN8	Cronobacter_phage	74.3	5.9e-80
AYL47945.1|2917956_2918973_+|integrase	integrase	integrase	F1BUN9	Cronobacter_phage	86.1	7.8e-176
2918467:2918482	attL	ATGGTCTCTTTTTTGT	NA	NA	NA	NA
AYL47946.1|2918973_2919966_+	hypothetical protein	NA	NA	NA	NA	NA
AYL47947.1|2920292_2921522_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	86.6	4.6e-207
AYL47948.1|2921804_2923361_+	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	30.0	3.2e-19
2934984:2934999	attR	ACAAAAAAGAGACCAT	NA	NA	NA	NA
>prophage 8
CP024680	Citrobacter freundii strain UMH14 chromosome, complete genome	4859315	4733658	4747174	4859315	capsid,integrase	Enterobacteria_phage(66.67%)	14	4735057:4735071	4746338:4746352
AYL49831.1|4733658_4735161_-	hypothetical protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	5.7e-82
4735057:4735071	attL	ACCGGTCCCGGTGGC	NA	NA	NA	NA
AYL49541.1|4735308_4736328_-	alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	32.0	3.2e-44
AYL49542.1|4736796_4738050_+|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.1	1.0e-76
AYL49543.1|4738087_4739956_-	hypothetical protein	NA	A0A1B3AYT3	Gordonia_phage	27.8	2.4e-21
AYL49544.1|4740394_4740970_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	51.4	5.1e-39
AYL49545.1|4740986_4741229_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.4e-19
AYL49546.1|4741225_4742029_-|capsid	capsid protein	capsid	Q7M2A2	Enterobacteria_phage	26.1	1.1e-12
AYL49547.1|4742580_4742847_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	63.6	5.2e-23
AYL49548.1|4742843_4743443_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	78.1	1.1e-49
AYL49549.1|4743435_4743735_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	67.7	1.3e-30
AYL49550.1|4743727_4744177_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	66.4	1.4e-44
AYL49832.1|4744281_4744509_+	hypothetical protein	NA	NA	NA	NA	NA
AYL49551.1|4744505_4744826_+	hypothetical protein	NA	NA	NA	NA	NA
AYL49552.1|4744840_4747174_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.7	0.0e+00
4746338:4746352	attR	ACCGGTCCCGGTGGC	NA	NA	NA	NA
>prophage 1
CP024681	Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence	134386	33275	41554	134386	transposase	Escherichia_phage(71.43%)	8	NA	NA
AYL49860.1|33275_34385_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.6	1.7e-30
AYL49861.1|34419_34695_-	regulator protein FrmR	NA	NA	NA	NA	NA
AYL49862.1|35419_35956_-	ferredoxin-type protein NapF	NA	A0A077SLP0	Escherichia_phage	65.7	2.0e-66
AYL49863.1|35952_36549_-	dehydrogenase	NA	A0A077SLS7	Escherichia_phage	63.6	3.0e-71
AYL49864.1|36585_37359_-	dimethyl sulfoxide reductase	NA	A0A077SK59	Escherichia_phage	71.3	1.5e-94
AYL49865.1|37351_37978_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	88.9	7.3e-116
AYL49866.1|37991_40424_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	76.4	0.0e+00
AYL49867.1|40498_41554_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	24.2	1.2e-06
>prophage 1
CP024682	Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence	71274	59430	70206	71274		Enterobacteria_phage(22.22%)	10	NA	NA
AYL50039.1|59430_60090_+	DNA breaking-rejoining protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	58.8	1.0e-75
AYL50022.1|60269_60692_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
AYL50023.1|60691_61963_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.2	2.7e-157
AYL50024.1|62108_63080_-	chromosome partitioning protein ParB	NA	Q1MVJ4	Enterobacteria_phage	68.9	9.6e-115
AYL50025.1|63076_64282_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
AYL50026.1|64889_66716_+	OLD family endonuclease	NA	E5E3R2	Burkholderia_phage	23.2	1.5e-12
AYL50027.1|66887_67238_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	55.2	2.4e-20
AYL50028.1|67386_67818_-	copper-binding protein	NA	NA	NA	NA	NA
AYL50029.1|68054_69533_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.0	1.8e-27
AYL50030.1|69525_70206_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.5	1.9e-32
