The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032897	Enterobacter kobei strain WCHEK045523 chromosome, complete genome	4953590	1834226	1850464	4953590		Bacteriophage(41.67%)	19	NA	NA
AYL05114.1|1834226_1835330_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	5.9e-60
AYL05115.1|1835341_1836595_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	1.7e-92
AYL05116.1|1836935_1838108_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	50.3	5.9e-111
AYL05117.1|1838104_1838293_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AYL05118.1|1838289_1839684_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.6	4.2e-212
AYL05119.1|1839716_1840031_+	hypothetical protein	NA	NA	NA	NA	NA
AYL05120.1|1840027_1840297_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	65.9	2.3e-26
AYL05121.1|1840296_1840491_-	hypothetical protein	NA	NA	NA	NA	NA
AYL05122.1|1840483_1840702_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
AYL05123.1|1840712_1840910_-	hypothetical protein	NA	NA	NA	NA	NA
AYL05124.1|1840906_1841119_-	hypothetical protein	NA	NA	NA	NA	NA
AYL05125.1|1841124_1843185_-	DNA polymerase	NA	Q775A3	Bordetella_phage	67.8	5.1e-275
AYL05126.1|1843262_1843811_-	DUF2815 family protein	NA	Q3LZQ2	Bacteriophage	57.4	5.5e-51
AYL05127.1|1843825_1845127_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	57.3	1.5e-139
AYL05128.1|1845129_1846038_-	hypothetical protein	NA	NA	NA	NA	NA
AYL05129.1|1846308_1846821_-	hypothetical protein	NA	C9EH97	Sodalis_phage	50.6	2.8e-41
AYL05130.1|1847317_1847941_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	45.3	1.0e-37
AYL05131.1|1848061_1848274_+	XRE family transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	46.0	9.3e-07
AYL05132.1|1848277_1850464_+	replication protein	NA	B6SCY1	Bacteriophage	70.5	3.0e-172
>prophage 2
CP032897	Enterobacter kobei strain WCHEK045523 chromosome, complete genome	4953590	1854282	1874808	4953590	holin,tail	uncultured_Caudovirales_phage(58.82%)	19	NA	NA
AYL05137.1|1854282_1855908_+|tail	phage tail protein	tail	A0A2H4J3N6	uncultured_Caudovirales_phage	58.5	8.7e-169
AYL05138.1|1855904_1856138_+	hypothetical protein	NA	NA	NA	NA	NA
AYL05139.1|1856124_1856961_+	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	44.2	6.7e-48
AYL05140.1|1856994_1857504_+	hypothetical protein	NA	A0AR14	Salmonella_phage	72.8	1.9e-42
AYL05141.1|1857729_1858641_+	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	37.2	4.6e-42
AYL05142.1|1858698_1859262_+	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	52.4	1.1e-51
AYL05143.1|1859263_1861252_+	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	48.9	6.6e-187
AYL05144.1|1861253_1861703_+	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	41.6	1.3e-21
AYL05145.1|1861705_1862173_+	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	46.9	8.4e-08
AYL05146.1|1862175_1864884_+	lytic transglycosylase domain-containing protein	NA	G9L6D3	Escherichia_phage	65.4	0.0e+00
AYL05147.1|1864883_1867772_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	70.9	0.0e+00
AYL05148.1|1867782_1868130_+	hypothetical protein	NA	NA	NA	NA	NA
AYL05149.1|1868194_1868536_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	51.8	6.3e-21
AYL05150.1|1868532_1870143_+	transcriptional regulator	NA	A0A2H4JCA3	uncultured_Caudovirales_phage	70.3	1.4e-224
AYL05151.1|1870162_1872508_+	hypothetical protein	NA	T1S9Y2	Salmonella_phage	40.9	2.3e-37
AYL05152.1|1872535_1873579_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	29.9	2.7e-22
AYL05153.1|1873701_1873932_+|holin	holin	holin	A5LH82	Enterobacteria_phage	71.0	2.9e-22
AYL05154.1|1873912_1874452_+	lysozyme	NA	H6WRZ4	Salmonella_phage	88.8	7.5e-93
AYL05155.1|1874448_1874808_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	43.5	1.3e-13
>prophage 3
CP032897	Enterobacter kobei strain WCHEK045523 chromosome, complete genome	4953590	2060303	2111086	4953590	head,holin,tail,integrase	Salmonella_phage(39.68%)	77	2060244:2060292	2111267:2111315
2060244:2060292	attL	CTTCTAAGCCGTAGGTCGTAGGTTCGAATCCTACAGGGCGTGCCATTAA	NA	NA	NA	NA
AYL07966.1|2060303_2061347_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	98.6	5.9e-203
AYL05325.1|2061343_2061679_-	DNA-binding protein	NA	NA	NA	NA	NA
AYL05326.1|2061687_2061888_-	hypothetical protein	NA	G8C7S1	Escherichia_phage	98.5	2.7e-32
AYL05327.1|2062001_2062379_-	hypothetical protein	NA	Q7Y3U8	Yersinia_phage	65.6	3.2e-42
AYL05328.1|2062444_2062633_-	hypothetical protein	NA	NA	NA	NA	NA
AYL05329.1|2062859_2063084_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	51.4	2.4e-13
AYL05330.1|2063068_2063287_-	hypothetical protein	NA	NA	NA	NA	NA
AYL05331.1|2063283_2063556_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	57.5	5.5e-20
AYL05332.1|2063767_2065774_-	phage N-6-adenine-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	48.3	1.9e-117
AYL05333.1|2065770_2065923_-	DUF1317 family protein	NA	NA	NA	NA	NA
AYL05334.1|2065919_2066348_-	regulator	NA	M9NYX4	Enterobacteria_phage	95.1	1.3e-71
AYL05335.1|2066344_2067025_-	exonuclease	NA	M9NZE1	Enterobacteria_phage	95.6	3.4e-127
AYL05336.1|2067021_2067867_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	61.6	9.6e-71
AYL05337.1|2067885_2068170_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	92.6	7.2e-47
AYL05338.1|2068177_2069254_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	70.2	5.8e-36
AYL05339.1|2069407_2069728_-	hypothetical protein	NA	NA	NA	NA	NA
AYL05340.1|2069757_2069988_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	92.5	1.1e-29
AYL05341.1|2070142_2070340_-	hypothetical protein	NA	NA	NA	NA	NA
AYL05342.1|2070489_2070771_-	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	33.7	5.5e-07
AYL05343.1|2071051_2071393_-	hypothetical protein	NA	G8C7T6	Escherichia_phage	95.6	9.6e-54
AYL05344.1|2071726_2071933_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	100.0	2.4e-31
AYL05345.1|2072139_2072487_-	hypothetical protein	NA	NA	NA	NA	NA
AYL05346.1|2072722_2073448_-	helix-turn-helix transcriptional regulator	NA	K7P7I4	Enterobacteria_phage	69.0	8.0e-90
AYL05347.1|2073552_2073786_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	67.6	1.1e-21
AYL05348.1|2073824_2074046_+	transcriptional regulator	NA	NA	NA	NA	NA
AYL05349.1|2074177_2074906_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	63.6	4.3e-35
AYL05350.1|2074902_2075682_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	64.6	1.0e-95
AYL05351.1|2075678_2076023_+	winged helix-turn-helix domain-containing protein	NA	K7PHG5	Enterobacteria_phage	86.0	6.5e-50
AYL07967.1|2076058_2076538_+	hypothetical protein	NA	G9L663	Escherichia_phage	57.6	1.5e-28
AYL05352.1|2076534_2076762_+	hypothetical protein	NA	NA	NA	NA	NA
AYL05353.1|2076758_2077181_+	hypothetical protein	NA	A0A2H4N7C3	Pectobacterium_phage	70.7	1.8e-30
AYL05354.1|2077182_2077458_+	hypothetical protein	NA	A0A077KAZ4	Edwardsiella_phage	87.4	2.1e-35
AYL05355.1|2077461_2078352_+	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	34.5	1.5e-29
AYL05356.1|2078729_2079161_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	42.9	1.3e-26
AYL05357.1|2079153_2079726_+	endonuclease	NA	A0A2D1GLP6	Escherichia_phage	59.4	1.1e-57
AYL05358.1|2079718_2079889_+	NinE family protein	NA	G8C7V4	Escherichia_phage	87.5	3.1e-21
AYL05359.1|2079881_2080493_+	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	47.0	2.7e-38
AYL05360.1|2080489_2080879_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	42.0	6.7e-19
AYL05361.1|2080868_2080985_+	hypothetical protein	NA	NA	NA	NA	NA
AYL05362.1|2080984_2081794_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	97.4	1.3e-152
AYL05363.1|2082090_2082597_+	HNH endonuclease	NA	A0A2P0XMZ8	Shigella_phage	46.8	2.4e-16
AYL05364.1|2082872_2083214_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	53.3	3.1e-28
AYL07968.1|2083197_2083641_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	81.2	7.3e-62
AYL05365.1|2083637_2084024_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	37.7	3.0e-11
AYL05366.1|2084004_2084178_+	rz1 lytic protein	NA	U5P461	Shigella_phage	57.1	1.1e-10
AYL05367.1|2084217_2084418_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	75.0	1.3e-18
AYL05368.1|2084488_2084707_+	hypothetical protein	NA	NA	NA	NA	NA
AYL05369.1|2084714_2085149_+	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	74.8	2.2e-47
AYL05370.1|2087376_2088729_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	82.4	1.9e-217
AYL05371.1|2088682_2089612_+|head	phage head morphogenesis protein	head	H6WRT1	Salmonella_phage	82.2	6.5e-137
AYL05372.1|2089615_2090881_+	hypothetical protein	NA	H6WRT2	Salmonella_phage	94.0	1.5e-224
AYL05373.1|2090893_2091355_+	hypothetical protein	NA	G0ZND8	Cronobacter_phage	81.1	2.6e-62
AYL05374.1|2091367_2092465_+	hypothetical protein	NA	G0ZND9	Cronobacter_phage	84.4	8.7e-181
AYL05375.1|2092475_2092760_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	73.2	1.1e-31
AYL05376.1|2092822_2093224_+	hypothetical protein	NA	I6S619	Salmonella_phage	78.9	4.9e-57
AYL05377.1|2093223_2093403_+	DUF551 domain-containing protein	NA	Q5G8X7	Enterobacteria_phage	91.5	1.2e-26
AYL05378.1|2093395_2093758_+	hypothetical protein	NA	A0A1V0E5P3	Salmonella_phage	90.0	1.9e-60
AYL07969.1|2093765_2094203_+	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	94.5	1.0e-71
AYL05379.1|2094199_2094586_+	hypothetical protein	NA	A0A1V0E5P4	Salmonella_phage	96.1	7.3e-66
AYL05380.1|2094603_2095341_+	hypothetical protein	NA	H6WRU1	Salmonella_phage	86.2	2.3e-116
AYL05381.1|2095378_2096032_+	hypothetical protein	NA	I6R0Q2	Salmonella_phage	91.7	1.6e-113
AYL05382.1|2096664_2096838_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	83.9	1.6e-17
AYL05383.1|2096827_2097541_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	55.6	8.2e-39
AYL07970.1|2097609_2098386_+	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	62.0	5.4e-76
AYL05384.1|2098560_2098779_+	hypothetical protein	NA	H6WRV2	Salmonella_phage	98.6	1.0e-29
AYL05385.1|2098851_2099214_+	hypothetical protein	NA	NA	NA	NA	NA
AYL05386.1|2099273_2101868_+|tail	phage tail tape measure protein	tail	A0A1V0E5N4	Salmonella_phage	42.2	8.8e-115
AYL05387.1|2101897_2102119_+	hypothetical protein	NA	NA	NA	NA	NA
AYL05388.1|2102175_2102523_+|tail	phage tail protein	tail	H6WRV8	Salmonella_phage	94.8	7.0e-60
AYL05389.1|2102678_2102876_-	hypothetical protein	NA	NA	NA	NA	NA
AYL05390.1|2103041_2103746_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	97.9	7.9e-135
AYL07971.1|2103745_2104465_+|tail	phage tail protein	tail	A0A1V0E5M9	Salmonella_phage	81.0	1.8e-118
AYL05391.1|2104407_2104941_+|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	67.6	1.0e-54
AYL05392.1|2104950_2109054_+	DUF1983 domain-containing protein	NA	H6WRW4	Salmonella_phage	85.7	0.0e+00
AYL05393.1|2109118_2110417_+|tail	phage tail protein	tail	K7P6X7	Enterobacteria_phage	71.4	3.9e-164
AYL05394.1|2110523_2110763_+	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	70.5	1.7e-25
AYL05395.1|2110762_2111086_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.3	2.6e-24
2111267:2111315	attR	CTTCTAAGCCGTAGGTCGTAGGTTCGAATCCTACAGGGCGTGCCATTAA	NA	NA	NA	NA
>prophage 4
CP032897	Enterobacter kobei strain WCHEK045523 chromosome, complete genome	4953590	2512341	2523683	4953590	protease	Vibrio_phage(33.33%)	7	NA	NA
AYL05745.1|2512341_2514282_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	3.2e-37
AYL05746.1|2514352_2514574_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
AYL05747.1|2514841_2515162_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.9	4.5e-13
AYL05748.1|2515189_2517469_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	2.4e-164
AYL05749.1|2517881_2518322_+	hypothetical protein	NA	NA	NA	NA	NA
AYL05750.1|2519472_2520456_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YZM7	Vibrio_phage	36.3	1.6e-45
AYL05751.1|2520452_2523683_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	27.2	2.3e-80
>prophage 5
CP032897	Enterobacter kobei strain WCHEK045523 chromosome, complete genome	4953590	3926805	3933078	4953590		Enterobacteria_phage(50.0%)	6	NA	NA
AYL07011.1|3926805_3927342_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.6	1.1e-51
AYL07012.1|3927345_3928224_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
AYL07013.1|3928276_3929176_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.5	4.4e-29
AYL07014.1|3929175_3930261_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.5	7.7e-97
AYL07015.1|3930613_3931510_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.9	2.0e-42
AYL07016.1|3931686_3933078_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	30.9	1.3e-19
>prophage 6
CP032897	Enterobacter kobei strain WCHEK045523 chromosome, complete genome	4953590	4446005	4535193	4953590	holin,terminase,integrase,head,tRNA,capsid,portal,protease,transposase,tail	Enterobacteria_phage(26.79%)	99	4469250:4469266	4552966:4552982
AYL07447.1|4446005_4446743_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
AYL07448.1|4446875_4448204_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	7.1e-44
AYL07449.1|4448256_4448640_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	72.8	7.3e-34
AYL07450.1|4448954_4449644_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.8	1.3e-54
AYL07451.1|4449684_4450815_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AYL07452.1|4451019_4451439_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	7.7e-13
AYL07453.1|4451508_4452207_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AYL07454.1|4452242_4454906_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AYL07455.1|4455016_4456372_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AYL07456.1|4456417_4456741_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
AYL07457.1|4456737_4458033_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.8e-44
AYL07458.1|4463655_4466229_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.3e-128
AYL07459.1|4466359_4467091_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AYL07460.1|4467087_4468068_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AYL07461.1|4468199_4468937_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AYL07462.1|4469204_4469546_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
4469250:4469266	attL	ATTCGCCAGCACGTCGC	NA	NA	NA	NA
AYL08061.1|4469650_4469698_+	hypothetical protein	NA	NA	NA	NA	NA
AYL07463.1|4469805_4470966_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AYL07464.1|4470962_4471835_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AYL07465.1|4471895_4473017_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AYL07466.1|4473027_4474098_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	9.0e-90
AYL07467.1|4474312_4474687_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
AYL07468.1|4474780_4475377_+	YfiR family protein	NA	NA	NA	NA	NA
AYL07469.1|4475369_4476590_+	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	39.8	1.9e-06
AYL07470.1|4476602_4477088_+	OmpA family protein	NA	NA	NA	NA	NA
AYL07471.1|4477090_4478461_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
AYL07472.1|4478499_4478904_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AYL07473.1|4479037_4479385_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AYL07474.1|4479428_4480196_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AYL07475.1|4480227_4480767_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AYL07476.1|4480782_4481031_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AYL07477.1|4481147_4482509_-	signal recognition particle protein	NA	NA	NA	NA	NA
AYL08062.1|4482675_4483467_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AYL07478.1|4483485_4484772_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AYL07479.1|4484823_4485441_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AYL07480.1|4485539_4486418_+	NAD(+) kinase	NA	NA	NA	NA	NA
AYL07481.1|4486503_4488165_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AYL07482.1|4488112_4488322_+	hypothetical protein	NA	NA	NA	NA	NA
AYL07483.1|4488303_4488642_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AYL07484.1|4488746_4489034_-	RnfH family protein	NA	NA	NA	NA	NA
AYL07485.1|4489023_4489500_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AYL07486.1|4489617_4490100_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
AYL07487.1|4490824_4491091_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	90.9	2.0e-38
AYL07488.1|4491133_4492447_-|tail	phage tail protein	tail	K7P6X7	Enterobacteria_phage	75.1	2.4e-169
AYL07489.1|4492507_4493473_-	hypothetical protein	NA	G1CSU0	Cronobacter_virus	39.9	9.7e-59
AYL07490.1|4493474_4497314_-	DUF1983 domain-containing protein	NA	Q9MCR7	Enterobacteria_phage	60.5	0.0e+00
AYL07491.1|4497367_4497955_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	47.9	6.1e-48
AYL07492.1|4497954_4498665_-	peptidase P60	NA	F1C573	Cronobacter_phage	70.6	2.7e-98
AYL07493.1|4498667_4499426_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	62.8	5.6e-94
AYL07494.1|4499422_4499761_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	60.7	1.1e-38
AYL07495.1|4499763_4503255_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	84.4	0.0e+00
AYL07496.1|4503298_4503715_-	hypothetical protein	NA	B9UDL3	Salmonella_phage	77.2	6.6e-57
AYL07497.1|4503785_4504070_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	92.1	1.0e-37
AYL07498.1|4504078_4504462_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
AYL07499.1|4504470_4504914_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	92.4	1.5e-70
AYL07500.1|4504973_4505321_-	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	81.7	2.8e-48
AYL07501.1|4505317_4505767_-	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	98.0	2.5e-73
AYL07502.1|4505763_4506102_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	68.8	1.6e-37
AYL07503.1|4506110_4506437_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	87.0	1.0e-49
AYL07504.1|4506479_4507691_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.2	8.9e-195
AYL07505.1|4507700_4508549_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	92.5	1.4e-138
AYL07506.1|4508562_4509867_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	88.9	1.3e-223
AYL07507.1|4509866_4511609_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.9	9.1e-140
AYL07508.1|4511562_4512027_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	3.7e-48
AYL07509.1|4512154_4512499_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	73.9	1.8e-47
AYL08063.1|4512495_4513086_-	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	79.1	1.6e-93
AYL07510.1|4513251_4513509_+	hypothetical protein	NA	K7P7V5	Enterobacteria_phage	100.0	5.7e-35
AYL07511.1|4513809_4515267_-	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	90.3	1.5e-268
AYL07512.1|4515507_4515957_-	hypothetical protein	NA	NA	NA	NA	NA
AYL07513.1|4516635_4516827_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	71.7	2.8e-18
AYL07514.1|4516777_4517053_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	61.5	3.6e-19
AYL07515.1|4517060_4517690_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	94.7	5.4e-111
AYL07516.1|4517689_4517968_-|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	97.8	4.7e-43
AYL07517.1|4517957_4518347_-	hypothetical protein	NA	G8C7V8	Escherichia_phage	99.2	8.9e-64
AYL07518.1|4518852_4519113_+	hypothetical protein	NA	NA	NA	NA	NA
AYL07519.1|4519193_4520030_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	80.4	5.0e-128
AYL07520.1|4520026_4520338_-	hypothetical protein	NA	NA	NA	NA	NA
AYL07521.1|4520340_4522212_-	toprim domain-containing protein	NA	I6S1U6	Salmonella_phage	58.6	9.2e-223
AYL07522.1|4522318_4523242_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	50.9	8.4e-36
AYL07523.1|4523238_4523427_-	hypothetical protein	NA	NA	NA	NA	NA
AYL07524.1|4523423_4523621_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AYL07525.1|4523622_4523850_-	transcriptional regulator	NA	NA	NA	NA	NA
AYL07526.1|4523961_4524651_+	helix-turn-helix domain-containing protein	NA	K7PK07	Enterobacteria_phage	64.8	2.7e-71
AYL07527.1|4524840_4525053_+	hypothetical protein	NA	NA	NA	NA	NA
AYL07528.1|4525546_4526206_+	hypothetical protein	NA	L0AQZ0	Klebsiella_phage	43.0	2.1e-44
AYL07529.1|4526342_4526546_+	hypothetical protein	NA	NA	NA	NA	NA
AYL08064.1|4526526_4526937_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	86.5	1.0e-46
AYL07530.1|4526988_4527630_+	hypothetical protein	NA	A0A142IDY2	Pseudomonas_phage	44.1	7.9e-33
AYL07531.1|4527626_4528040_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	66.2	1.8e-46
AYL07532.1|4528039_4528618_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	69.3	4.0e-76
AYL07533.1|4528629_4529379_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	87.9	1.8e-121
AYL07534.1|4529375_4529942_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	37.8	5.7e-27
AYL07535.1|4529938_4530163_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	68.5	6.6e-19
AYL07536.1|4530263_4530548_+	hypothetical protein	NA	NA	NA	NA	NA
AYL07537.1|4530537_4530747_+	excisionase	NA	I6PBM8	Cronobacter_phage	95.6	5.7e-33
AYL07538.1|4530701_4531874_+|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	91.0	1.2e-204
AYL07539.1|4532236_4533478_+	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	47.1	9.1e-102
AYL07540.1|4533592_4534024_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYL07541.1|4534073_4535193_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
4552966:4552982	attR	GCGACGTGCTGGCGAAT	NA	NA	NA	NA
>prophage 1
CP032893	Enterobacter kobei strain WCHEK045523 plasmid p1_045523, complete sequence	156442	1708	97686	156442	transposase,integrase	Escherichia_phage(26.47%)	84	NA	NA
AYL03290.1|1708_2449_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AYL03291.1|2812_3736_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
AYL03292.1|3932_4136_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AYL03293.1|4149_4380_+	hypothetical protein	NA	NA	NA	NA	NA
AYL03294.1|4824_5091_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AYL03295.1|5078_5561_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYL03296.1|5762_7166_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
AYL03426.1|7194_7827_-	hypothetical protein	NA	NA	NA	NA	NA
AYL03297.1|8216_9035_-	hypothetical protein	NA	NA	NA	NA	NA
AYL03298.1|9782_10613_-	hypothetical protein	NA	NA	NA	NA	NA
AYL03299.1|11014_12161_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.8e-51
AYL03300.1|12187_13111_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.4	1.5e-173
AYL03301.1|13878_14394_-	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	37.6	7.1e-08
AYL03302.1|14608_16036_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.6	6.8e-101
AYL03303.1|16286_17606_+	DUF1173 family protein	NA	NA	NA	NA	NA
AYL03304.1|17618_17822_+	hypothetical protein	NA	NA	NA	NA	NA
AYL03305.1|17885_19091_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
AYL03306.1|19087_19906_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AYL03307.1|20374_20647_-	transcriptional repressor RcnR	NA	NA	NA	NA	NA
AYL03308.1|20769_21885_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AYL03309.1|22142_22577_-	copper-binding protein	NA	NA	NA	NA	NA
AYL03310.1|22794_24141_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	2.3e-18
AYL03311.1|24224_25148_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	8.4e-177
AYL03312.1|25336_26956_+	phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
AYL03313.1|27032_27509_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AYL03314.1|27721_29071_-	sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.6	2.9e-08
AYL03315.1|29046_29715_-	response regulator	NA	W8CYM9	Bacillus_phage	31.9	2.7e-23
AYL03316.1|29908_30934_-	AAA family ATPase	NA	NA	NA	NA	NA
AYL03317.1|31826_32531_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYL03318.1|32814_33977_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AYL03319.1|35717_36047_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
AYL03320.1|36027_36309_+	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
AYL03321.1|36392_37090_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	99.1	2.8e-132
AYL03322.1|37335_37533_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AYL03323.1|37573_40018_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.4	5.2e-85
AYL03324.1|40145_40586_-	hypothetical protein	NA	NA	NA	NA	NA
AYL03325.1|40671_43818_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.4	2.3e-61
AYL03326.1|43828_45121_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYL03327.1|45234_45588_-	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYL03328.1|45615_47001_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
AYL03329.1|47190_47871_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.1	6.0e-31
AYL03330.1|47863_49339_+	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.4e-27
AYL03331.1|49589_50021_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AYL03332.1|50167_50518_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	2.3e-18
AYL03333.1|51781_53071_-|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.7	2.5e-86
AYL03334.1|53410_54415_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AYL03335.1|54493_55051_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
AYL03336.1|55044_55416_-	hypothetical protein	NA	NA	NA	NA	NA
AYL03337.1|55909_56236_-	hypothetical protein	NA	NA	NA	NA	NA
AYL03338.1|56490_56847_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AYL03339.1|57083_57470_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AYL03340.1|57466_57757_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AYL03341.1|57882_58587_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYL03427.1|58611_58797_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
AYL03342.1|58925_59492_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	53.7	5.1e-44
AYL03343.1|59840_60854_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYL03428.1|60999_61791_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AYL03344.1|61954_62302_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AYL03345.1|62295_63135_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AYL03429.1|63064_63244_-	hypothetical protein	NA	NA	NA	NA	NA
AYL03346.1|63306_64011_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYL03347.1|63956_64157_-	hypothetical protein	NA	NA	NA	NA	NA
AYL03348.1|64697_64886_+	hypothetical protein	NA	NA	NA	NA	NA
AYL03430.1|65406_65973_+	hypothetical protein	NA	NA	NA	NA	NA
AYL03349.1|66911_68315_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
AYL03431.1|68343_68976_-	hypothetical protein	NA	NA	NA	NA	NA
AYL03432.1|69201_70548_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AYL03350.1|70596_70992_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYL03351.1|71180_72578_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AYL03352.1|72817_73096_-	hypothetical protein	NA	NA	NA	NA	NA
AYL03353.1|73430_73997_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AYL03354.1|74121_75765_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	25.0	1.5e-22
AYL03355.1|75878_78326_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	70.5	9.4e-26
AYL03356.1|78344_79778_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
AYL03357.1|79867_81151_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
AYL03358.1|81280_83473_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
AYL03359.1|83890_84814_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
AYL03360.1|85114_85315_+	glycogen synthesis protein GlgS	NA	NA	NA	NA	NA
AYL03361.1|89572_90124_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	79.0	1.0e-73
AYL03362.1|90139_92236_+	ATP-binding protein	NA	NA	NA	NA	NA
AYL03363.1|94312_94801_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	34.7	2.1e-14
AYL03433.1|95324_95513_-	hypothetical protein	NA	NA	NA	NA	NA
AYL03364.1|95423_96543_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AYL03365.1|96981_97686_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
CP032893	Enterobacter kobei strain WCHEK045523 plasmid p1_045523, complete sequence	156442	142734	155692	156442	transposase	Macacine_betaherpesvirus(25.0%)	13	NA	NA
AYL03413.1|142734_144744_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.4	1.6e-26
AYL03414.1|144814_145045_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AYL03415.1|145643_146341_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	99.1	2.8e-132
AYL03416.1|146792_147913_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AYL03417.1|148361_148868_+	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	3.7e-09
AYL03418.1|148910_149102_+	hypothetical protein	NA	NA	NA	NA	NA
AYL03419.1|149294_149549_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	2.1e-13
AYL03420.1|150848_151970_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	61.8	2.5e-130
AYL03421.1|152048_152300_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AYL03422.1|152353_152659_+	hypothetical protein	NA	NA	NA	NA	NA
AYL03423.1|152684_152942_+	hypothetical protein	NA	NA	NA	NA	NA
AYL03424.1|153554_154526_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	1.0e-148
AYL03425.1|154525_155692_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
