The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032865	Bacillus subtilis subsp. subtilis strain N3-1 chromosome, complete genome	4122184	4786	104421	4122184	tail,capsid,transposase,portal,holin,tRNA,coat,protease,integrase,terminase,head,plate	Bacillus_phage(56.36%)	113	37621:37680	102399:102564
AYK80837.1|4786_6139_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
AYK80838.1|6300_6699_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80839.1|6952_7141_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
AYK80840.1|7315_7516_+|coat	spore coat protein CotC	coat	NA	NA	NA	NA
AYK80841.1|7761_8118_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80842.1|8277_8997_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80843.1|9039_9327_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80844.1|9449_10289_-	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	98.2	5.6e-164
AYK80845.1|10563_10728_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80846.1|10858_11083_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80847.1|11134_11398_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80848.1|11998_12433_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A0A1P8CX51	Bacillus_phage	92.3	5.8e-72
AYK80849.1|13351_13777_+	endonuclease	NA	NA	NA	NA	NA
AYK80850.1|14187_15372_+	alanine racemase 2	NA	NA	NA	NA	NA
AYK80851.1|15473_16889_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
AYK80852.1|17301_17937_+	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	68.5	7.7e-73
AYK80853.1|18066_19314_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
AYK80854.1|19798_21298_-	xylulokinase	NA	NA	NA	NA	NA
AYK80855.1|21448_22786_-	xylose isomerase	NA	NA	NA	NA	NA
AYK80856.1|23023_24178_+	ROK family protein	NA	NA	NA	NA	NA
AYK80857.1|24315_25917_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
AYK80858.1|26055_26970_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
AYK80859.1|26966_27284_-|transposase	transposase	transposase	NA	NA	NA	NA
AYK80860.1|27356_28748_-	MFS transporter	NA	NA	NA	NA	NA
AYK80861.1|29544_30015_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80862.1|30154_30319_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80863.1|31830_32061_-	XRE family transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	75.0	2.1e-20
AYK80864.1|32602_32983_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80865.1|33060_33960_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYK80866.1|33956_35111_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.4e-24
AYK84734.1|35273_36821_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AYK80867.1|36817_37576_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
37621:37680	attL	ACTGTTCGATAATCTTGTTAGCTAATTCTACGGAGTTCGGATCTCTTTTCAATTTCCCCA	NA	NA	NA	NA
AYK84735.1|38618_39053_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AYK80868.1|39236_39488_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80869.1|39786_40638_-	toxin	NA	O64021	Bacillus_phage	60.3	1.4e-85
AYK80870.1|40818_41310_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80871.1|41548_41839_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80872.1|42435_42636_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80873.1|42672_43758_+	DUF4917 family protein	NA	NA	NA	NA	NA
AYK84736.1|43773_43845_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80874.1|44014_45778_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	52.3	3.3e-121
AYK80875.1|45796_46261_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AYK80876.1|46306_47284_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	71.4	2.0e-64
AYK80877.1|47339_47603_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	66.7	2.7e-24
AYK80878.1|47617_47830_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	59.4	1.9e-15
AYK80879.1|47881_48052_-	XkdX family protein	NA	NA	NA	NA	NA
AYK80880.1|48048_48348_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	2.0e-39
AYK80881.1|48363_49485_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	92.5	9.8e-196
AYK80882.1|51109_52984_-	autolysin	NA	D6R400	Bacillus_phage	27.8	5.5e-50
AYK80883.1|52997_53831_-|tail	phage tail family protein	tail	M4ZS20	Bacillus_phage	34.1	3.5e-33
AYK80884.1|53843_57584_-	hypothetical protein	NA	A0A0S2SXL7	Bacillus_phage	60.4	9.1e-105
AYK80885.1|57646_57829_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80886.1|57840_58203_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80887.1|58262_58847_-|tail	major tail protein	tail	U5U3Z7	Lactobacillus_phage	36.5	9.1e-28
AYK80888.1|58852_59260_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80889.1|59256_59649_-|tail	phage tail protein	tail	A0A0M5M1E5	Enterococcus_phage	37.9	3.0e-11
AYK80890.1|59648_59975_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AYK80891.1|59964_60258_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	33.0	2.6e-07
AYK80892.1|60312_60696_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	56.8	1.4e-05
AYK80893.1|60723_61932_-|capsid	phage major capsid protein	capsid	A0A2H4J824	uncultured_Caudovirales_phage	49.8	4.9e-76
AYK80894.1|61979_62576_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0MFL1	Staphylococcus_phage	53.8	3.3e-49
AYK80895.1|62568_63795_-|portal	phage portal protein	portal	A0A1J0MFU3	Staphylococcus_phage	39.4	2.4e-70
AYK80896.1|63799_64006_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80897.1|64022_65756_-|terminase	terminase large subunit	terminase	A0A2H4JCI4	uncultured_Caudovirales_phage	48.9	2.1e-144
AYK80898.1|65745_66231_-|terminase	phage terminase small subunit P27 family	terminase	A0A1Q1PVW3	Staphylococcus_phage	36.0	4.2e-18
AYK80899.1|66469_66676_-	hypothetical protein	NA	NA	NA	NA	NA
AYK84737.1|66678_67062_-	HNH endonuclease	NA	A0A075M5R4	Enterococcus_phage	43.3	1.2e-17
AYK84738.1|67433_67847_-	ArpU family transcriptional regulator	NA	D6R428	Bacillus_phage	97.0	2.1e-63
AYK80900.1|68100_68616_-	hypothetical protein	NA	D6R425	Bacillus_phage	93.0	8.7e-91
AYK80901.1|68650_69190_-	nuclease	NA	Q9ZXC2	Bacillus_phage	96.1	1.8e-94
AYK80902.1|69186_69624_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	91.7	4.8e-74
AYK80903.1|69823_72241_-	DNA primase	NA	D6R422	Bacillus_phage	88.7	0.0e+00
AYK80904.1|72301_72739_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	97.2	1.3e-79
AYK80905.1|72759_73074_-	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	99.0	1.5e-53
AYK80906.1|73063_73999_-	hypothetical protein	NA	Q9ZXC7	Bacillus_phage	96.5	2.0e-170
AYK80907.1|74002_74557_-	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	96.2	3.1e-94
AYK80908.1|74752_75028_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	47.1	1.2e-19
AYK84739.1|75024_75216_-	hypothetical protein	NA	Q9ZXD0	Bacillus_phage	53.1	7.1e-06
AYK80909.1|75276_75588_-	DNA-binding protein	NA	NA	NA	NA	NA
AYK80910.1|75603_76368_-	Rha family transcriptional regulator	NA	A8ATN0	Listeria_phage	49.1	1.0e-47
AYK80911.1|76482_76701_-	XRE family transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	63.2	2.1e-17
AYK80912.1|76825_77212_+	XRE family transcriptional regulator	NA	R9W020	Paenibacillus_phage	31.4	9.0e-08
AYK80913.1|77195_78251_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0F6N3H6	Staphylococcus_phage	24.2	1.7e-08
AYK80914.1|78266_79424_+|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	38.9	8.3e-65
AYK80915.1|79536_80871_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
AYK80916.1|80929_81337_-	transcriptional repressor GlnR	NA	NA	NA	NA	NA
AYK80917.1|81446_82712_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AYK80918.1|82729_83992_-	GTPase HflX	NA	NA	NA	NA	NA
AYK80919.1|84124_85093_-	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
AYK80920.1|85733_86501_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.5	1.2e-51
AYK80921.1|86564_87185_-	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
AYK80922.1|87234_88224_-	ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
AYK80923.1|88241_90344_-	ribonucleotide-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
AYK80924.1|90303_90696_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
AYK80925.1|90938_91169_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80926.1|91250_91523_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80927.1|91717_91939_-	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AYK80928.1|91978_92923_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AYK80929.1|93022_93436_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80930.1|93524_93803_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80931.1|93937_94255_+	multidrug resistance protein EbrA	NA	NA	NA	NA	NA
AYK80932.1|94268_94622_+	multidrug resistance protein EbrB	NA	NA	NA	NA	NA
AYK80933.1|94635_95088_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AYK80934.1|95157_95865_-	hypothetical protein	NA	F8WQ53	Bacillus_phage	56.9	3.2e-51
AYK80935.1|96144_96378_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80936.1|96602_97931_+|protease	serine protease	protease	A0A1B0T6A2	Bacillus_phage	33.6	1.2e-27
AYK80937.1|98041_98866_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYK80938.1|98944_99301_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80939.1|99439_100054_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYK80940.1|100174_100732_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80941.1|100886_101342_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80942.1|102388_103600_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	26.8	2.2e-23
102399:102564	attR	TGGGGAAATTGAAAAGAGATCCGAACTCCGTAGAATTAGCTAACAAGATTATCGAACAGTATCAGCCTAAATCAGTAGAAGATATGCAAGAAGCATTAAAAGACATATTTGGTCCCATGTTTGAGTCAATGCTAAAAGGTGAAATGAATCACCATTTGGGCTATGA	NA	NA	NA	NA
AYK80943.1|103887_104421_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	82.5	1.0e-70
>prophage 2
CP032865	Bacillus subtilis subsp. subtilis strain N3-1 chromosome, complete genome	4122184	502055	577263	4122184	tail,transposase,portal,holin,tRNA,protease,terminase,plate	uncultured_Caudovirales_phage(25.0%)	83	NA	NA
AYK81324.1|502055_503015_+|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	49.5	5.6e-75
AYK81325.1|503430_505719_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AYK81326.1|505852_507205_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
AYK81327.1|507473_507944_+|tRNA	tRNA-specific adenosine deaminase	tRNA	S4VYZ2	Pandoravirus	45.8	1.8e-26
AYK81328.1|508191_508602_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
AYK81329.1|508743_509187_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYK81330.1|509217_509643_-	organic hydroperoxide resistance protein OhrA	NA	NA	NA	NA	NA
AYK81331.1|509768_511016_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.1	4.2e-99
AYK81332.1|511027_512125_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.1	4.3e-71
AYK81333.1|512475_513378_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
AYK81334.1|513448_513766_-	multidrug efflux SMR transporter subunit YkkD	NA	NA	NA	NA	NA
AYK81335.1|513765_514104_-	multidrug resistance protein YkkC	NA	NA	NA	NA	NA
AYK81336.1|514325_514844_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYK81337.1|514833_515361_-	DinB family protein	NA	NA	NA	NA	NA
AYK81338.1|515452_516184_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AYK81339.1|516332_516557_+	hypothetical protein	NA	NA	NA	NA	NA
AYK81340.1|516633_517833_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AYK84753.1|518070_518589_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AYK81341.1|519697_520747_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AYK81342.1|520789_521779_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.5	3.2e-17
AYK81343.1|521791_522682_-	NlpC/P60 family protein	NA	A0A0A8WIF2	Clostridium_phage	45.8	5.3e-19
AYK81344.1|522698_523778_-	dipeptide epimerase	NA	NA	NA	NA	NA
AYK81345.1|523774_524734_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AYK84754.1|524821_526471_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYK81346.1|526473_527481_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	1.8e-15
AYK81347.1|527485_528448_-	ABC transporter permease	NA	NA	NA	NA	NA
AYK81348.1|528453_529380_-	ABC transporter permease	NA	NA	NA	NA	NA
AYK81349.1|529396_530221_-	aminopeptidase	NA	NA	NA	NA	NA
AYK81350.1|530350_531169_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
AYK81351.1|531337_532687_+|protease	serine protease HtrA	protease	A0A1B1IT49	uncultured_Mediterranean_phage	34.1	3.4e-25
AYK81352.1|533186_534158_-	glycosyltransferase	NA	I1TED8	Salmonella_phage	41.3	2.5e-62
AYK84755.1|534169_536320_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
AYK81353.1|536536_537487_-	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
AYK81354.1|537875_539192_+	amino acid permease	NA	NA	NA	NA	NA
AYK81355.1|539467_540085_+	DUF47 domain-containing protein	NA	NA	NA	NA	NA
AYK81356.1|540097_541099_+	low-affinity inorganic phosphate transporter	NA	NA	NA	NA	NA
AYK81357.1|541208_541955_+	type II toxin-antitoxin system SpoIISA family toxin	NA	NA	NA	NA	NA
AYK81358.1|541954_542125_+	type II toxin-antitoxin system SpoIISB family antitoxin	NA	NA	NA	NA	NA
AYK81359.1|542210_542348_+	hypothetical protein	NA	NA	NA	NA	NA
AYK81360.1|542385_543279_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	69.2	5.2e-83
AYK81361.1|543291_543555_-|holin	holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	64.4	6.1e-24
AYK81362.1|543567_543837_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	1.4e-23
AYK81363.1|543889_544729_-|portal	phage portal protein	portal	NA	NA	NA	NA
AYK81364.1|544775_544940_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	1.9e-15
AYK81365.1|544936_545266_-|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	40.7	1.3e-15
AYK81366.1|545277_547341_-|terminase	terminase	terminase	A0A2H4J4R1	uncultured_Caudovirales_phage	34.5	2.6e-29
AYK81367.1|547343_547616_-	hypothetical protein	NA	NA	NA	NA	NA
AYK81368.1|547612_548191_-	phage-like element PBSX protein XkdU	NA	A0A2H4J717	uncultured_Caudovirales_phage	34.2	3.9e-15
AYK81369.1|548174_549221_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	1.3e-72
AYK81370.1|549213_549639_-	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	3.0e-12
AYK81371.1|549696_549963_-	phage-like element PBSX protein XkdR	NA	S6C459	Thermus_phage	36.4	1.7e-05
AYK81372.1|549962_550940_-	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
AYK81373.1|550955_551615_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A8WJR4	Clostridium_phage	33.2	1.1e-24
AYK81374.1|551607_556611_-|portal	phage portal protein	portal	A0A2H4JA91	uncultured_Caudovirales_phage	44.8	6.4e-37
AYK81375.1|556611_556752_-	hypothetical protein	NA	NA	NA	NA	NA
AYK81376.1|556793_557240_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	36.8	1.0e-10
AYK81377.1|557331_557775_-	phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	44.5	1.9e-25
AYK81378.1|557776_559177_-|tail	phage tail sheath protein	tail	A0A0A7S087	Clostridium_phage	39.3	3.0e-77
AYK81379.1|559173_559392_-	hypothetical protein	NA	NA	NA	NA	NA
AYK81380.1|559395_559836_-|portal	phage portal protein	portal	NA	NA	NA	NA
AYK81381.1|559848_560334_-	phage-like element PBSX protein XkdI	NA	A0A249XXA4	Clostridium_phage	47.0	2.1e-38
AYK81382.1|560330_560687_-	phage-like element PBSX protein XkdH	NA	NA	NA	NA	NA
AYK81383.1|560683_561067_-	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.5	1.4e-13
AYK81384.1|561088_562024_-	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
AYK81385.1|562049_562877_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	59.2	1.6e-54
AYK81386.1|562896_564384_-	phage-like element PBSX protein XkdE	NA	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
AYK81387.1|564387_565689_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.0	9.1e-153
AYK81388.1|565685_566483_-|terminase	PBSX phage terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	50.2	8.0e-59
AYK81389.1|566598_567108_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	39.2	6.5e-22
AYK81390.1|567223_567430_-	phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	2.1e-11
AYK81391.1|567426_567777_-|portal	phage portal protein	portal	NA	NA	NA	NA
AYK81392.1|567861_568029_-	hypothetical protein	NA	NA	NA	NA	NA
AYK81393.1|568028_568829_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	1.1e-60
AYK81394.1|568728_569565_-|portal	phage portal protein	portal	S6BFM4	Thermus_phage	27.8	6.7e-24
AYK81395.1|569551_569731_-	hypothetical protein	NA	NA	NA	NA	NA
AYK81396.1|569909_570251_+	transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
AYK81397.1|570413_571010_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
AYK81398.1|571965_572568_-	hypothetical protein	NA	F8WQ53	Bacillus_phage	48.7	1.4e-44
AYK81399.1|572672_573050_+	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	7.9e-17
AYK81400.1|573089_574043_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	73.8	1.6e-66
AYK81401.1|574440_574575_-	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
AYK81402.1|574564_575701_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.4	4.9e-94
AYK81403.1|576113_577263_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
>prophage 3
CP032865	Bacillus subtilis subsp. subtilis strain N3-1 chromosome, complete genome	4122184	611973	661517	4122184	transposase,tRNA,coat	Bacillus_phage(55.56%)	55	NA	NA
AYK81434.1|611973_612207_+|coat	spore coat protein	coat	NA	NA	NA	NA
AYK81435.1|612339_613320_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AYK81436.1|613338_613560_-	hypothetical protein	NA	NA	NA	NA	NA
AYK81437.1|613868_614198_+	DUF4306 domain-containing protein	NA	NA	NA	NA	NA
AYK81438.1|614329_614524_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
AYK81439.1|614563_615043_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AYK81440.1|615271_615667_+	hypothetical protein	NA	NA	NA	NA	NA
AYK81441.1|615885_616392_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYK81442.1|616522_617734_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	26.8	2.2e-23
AYK81443.1|617806_618298_-	DUF2992 family protein	NA	NA	NA	NA	NA
AYK81444.1|618467_619415_-	mannose-6-phosphate isomerase ManA	NA	NA	NA	NA	NA
AYK81445.1|619429_621382_-	PTS mannose transporter subunit IIABC	NA	NA	NA	NA	NA
AYK81446.1|621530_623477_-	PRD domain-containing protein	NA	NA	NA	NA	NA
AYK81447.1|623784_624102_-	hypothetical protein	NA	NA	NA	NA	NA
AYK81448.1|624216_624534_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AYK81449.1|624966_625158_+	hypothetical protein	NA	NA	NA	NA	NA
AYK81450.1|625660_625861_+	hypothetical protein	NA	NA	NA	NA	NA
AYK81451.1|625989_626505_+	hypothetical protein	NA	NA	NA	NA	NA
AYK81452.1|627179_627773_-	hypothetical protein	NA	NA	NA	NA	NA
AYK81453.1|628628_629021_-	hypothetical protein	NA	NA	NA	NA	NA
AYK81454.1|629035_629347_-	hypothetical protein	NA	NA	NA	NA	NA
AYK81455.1|629484_629724_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYK81456.1|630098_630386_+	hypothetical protein	NA	NA	NA	NA	NA
AYK81457.1|630543_630849_+	hypothetical protein	NA	NA	NA	NA	NA
AYK81458.1|630892_632140_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
AYK81459.1|632272_632731_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AYK81460.1|632733_634509_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	57.3	5.8e-126
AYK81461.1|634856_635972_+	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	71.9	2.4e-146
AYK81462.1|636329_636557_+	hypothetical protein	NA	NA	NA	NA	NA
AYK81463.1|636645_636912_-	YgiT-type zinc finger protein	NA	NA	NA	NA	NA
AYK81464.1|636952_637540_-	hypothetical protein	NA	NA	NA	NA	NA
AYK81465.1|639906_640122_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYK81466.1|640187_641705_+	glycosyltransferase	NA	NA	NA	NA	NA
AYK81467.1|643401_644571_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	41.8	2.0e-87
AYK84757.1|645510_645786_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYK81468.1|645951_646323_+	helix-turn-helix domain-containing protein	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	46.8	5.1e-16
AYK81469.1|646685_647207_+	hypothetical protein	NA	NA	NA	NA	NA
AYK81470.1|647219_647567_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	67.6	8.6e-18
AYK81471.1|649430_649610_-	hypothetical protein	NA	NA	NA	NA	NA
AYK81472.1|649604_650795_+	DUF819 domain-containing protein	NA	NA	NA	NA	NA
AYK81473.1|650864_651410_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYK81474.1|651442_652615_-	cystathionine beta-lyase MetC	NA	NA	NA	NA	NA
AYK84758.1|652607_653729_-	cystathionine gamma-synthase/O-acetylhomoserine thiolyase	NA	A0A0B5JD48	Pandoravirus	26.3	3.7e-17
AYK81475.1|654084_654807_+	esterase family protein	NA	NA	NA	NA	NA
AYK81476.1|654843_655359_+	hypothetical protein	NA	NA	NA	NA	NA
AYK81477.1|655362_655785_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK81478.1|655857_656112_-	hypothetical protein	NA	NA	NA	NA	NA
AYK81479.1|656228_658508_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	34.9	3.5e-91
AYK81480.1|658581_658836_-	sporulation-specific transcription factor SpoVIF	NA	NA	NA	NA	NA
AYK81481.1|658968_659118_-	sporulation protein YjcZ	NA	NA	NA	NA	NA
AYK81482.1|659199_659406_-	hypothetical protein	NA	NA	NA	NA	NA
AYK81483.1|659687_660044_-	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
AYK81484.1|660203_660590_+|coat	spore coat protein	coat	NA	NA	NA	NA
AYK81485.1|660629_660950_+|coat	spore coat protein	coat	NA	NA	NA	NA
AYK81486.1|661034_661517_+|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 4
CP032865	Bacillus subtilis subsp. subtilis strain N3-1 chromosome, complete genome	4122184	1204132	1212498	4122184		Synechococcus_phage(50.0%)	8	NA	NA
AYK81981.1|1204132_1204720_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	2.4e-28
AYK81982.1|1204716_1205757_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	1.7e-64
AYK81983.1|1205858_1207289_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
AYK81984.1|1207264_1209493_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	3.8e-159
AYK81985.1|1209476_1210160_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AYK81986.1|1210156_1210411_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AYK81987.1|1210403_1211129_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	1.2e-45
AYK81988.1|1211202_1212498_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	5.9e-19
>prophage 5
CP032865	Bacillus subtilis subsp. subtilis strain N3-1 chromosome, complete genome	4122184	1962476	2042439	4122184	transposase,holin,bacteriocin,protease	Bacillus_phage(23.81%)	79	NA	NA
AYK82655.1|1962476_1963679_+|protease	serine protease	protease	W5SAB9	Pithovirus	40.4	5.9e-13
AYK82656.1|1963993_1965379_-	arginine utilization regulatory protein RocR	NA	NA	NA	NA	NA
AYK84804.1|1965605_1965890_+	ArsR family transcriptional regulator	NA	A0A218MNF3	uncultured_virus	41.3	2.8e-06
AYK84805.1|1965889_1966525_+	SdpI family protein	NA	NA	NA	NA	NA
AYK82657.1|1966708_1967263_+	SdpA family antimicrobial peptide system protein	NA	NA	NA	NA	NA
AYK82658.1|1967247_1968201_+	hypothetical protein	NA	NA	NA	NA	NA
AYK82659.1|1968262_1968865_+	sporulation delaying protein family toxin	NA	NA	NA	NA	NA
AYK82660.1|1969196_1970402_+	ornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.5	2.0e-29
AYK82661.1|1970624_1972028_+	amino-acid permease RocE	NA	NA	NA	NA	NA
AYK82662.1|1972100_1972991_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	29.1	2.0e-26
AYK82663.1|1973227_1973344_-	phosphatase RapG inhibitor	NA	NA	NA	NA	NA
AYK82664.1|1973344_1974442_-	transcriptional regulator	NA	D6R410	Bacillus_phage	39.3	6.0e-73
AYK82665.1|1974552_1975023_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK82666.1|1975164_1975902_+	hypothetical protein	NA	NA	NA	NA	NA
AYK82667.1|1975912_1977070_+	hypothetical protein	NA	NA	NA	NA	NA
AYK82668.1|1977085_1977334_+	DUF2651 domain-containing protein	NA	NA	NA	NA	NA
AYK82669.1|1977438_1977609_+	hypothetical protein	NA	NA	NA	NA	NA
AYK82670.1|1977671_1978898_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	29.3	1.1e-11
AYK82671.1|1978931_1979345_-	hypothetical protein	NA	NA	NA	NA	NA
AYK82672.1|1979529_1979700_+	CxxH/CxxC protein	NA	NA	NA	NA	NA
AYK82673.1|1979780_1980260_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AYK82674.1|1980547_1981456_+	hypothetical protein	NA	NA	NA	NA	NA
AYK82675.1|1981412_1984535_+	DEAD/DEAH box helicase	NA	A7WKM3	Acidianus_filamentous_virus	26.4	6.6e-08
AYK82676.1|1984799_1985117_+|transposase	transposase	transposase	NA	NA	NA	NA
AYK82677.1|1985305_1985455_+|transposase	transposase	transposase	NA	NA	NA	NA
AYK82678.1|1985526_1985844_+|transposase	transposase	transposase	NA	NA	NA	NA
AYK82679.1|1985840_1986755_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	4.0e-06
AYK82680.1|1986885_1987242_+|transposase	transposase	transposase	NA	NA	NA	NA
AYK82681.1|1987217_1987424_+	hypothetical protein	NA	NA	NA	NA	NA
AYK84806.1|1987807_1988071_+	hypothetical protein	NA	NA	NA	NA	NA
AYK82682.1|1988769_1989048_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	100.0	7.3e-44
AYK82683.1|1989032_1989479_+	hypothetical protein	NA	A0A1P8CWQ3	Bacillus_phage	97.5	3.2e-57
AYK82684.1|1989559_1990474_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	4.0e-06
AYK82685.1|1990470_1990788_-|transposase	transposase	transposase	NA	NA	NA	NA
AYK82686.1|1991845_1993879_+	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
AYK82687.1|1993859_1995743_+	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	21.8	6.6e-19
AYK82688.1|1995977_1997441_-	hypothetical protein	NA	A0A0S2MYH0	Enterococcus_phage	36.0	1.0e-11
AYK82689.1|1997852_1998239_+	hypothetical protein	NA	NA	NA	NA	NA
AYK84807.1|1998368_1999916_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AYK82690.1|1999912_2000671_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
AYK82691.1|2000910_2001090_-	hypothetical protein	NA	NA	NA	NA	NA
AYK82692.1|2001090_2001531_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	34.4	3.4e-11
AYK82693.1|2002011_2002362_+	hypothetical protein	NA	NA	NA	NA	NA
AYK82694.1|2002812_2004738_-	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
AYK82695.1|2005218_2005848_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
AYK82696.1|2005868_2006591_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AYK82697.1|2006681_2007392_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYK82698.1|2007958_2009398_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AYK82699.1|2009508_2011038_-	alkyl hydroperoxide reductase subunit F	NA	A0A1V0SIN1	Klosneuvirus	29.3	1.0e-33
AYK82700.1|2011051_2011615_-	peroxiredoxin	NA	NA	NA	NA	NA
AYK82701.1|2012080_2013487_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	E3SJC4	Synechococcus_phage	30.6	1.7e-32
AYK82702.1|2013509_2014856_-	gluconate permease	NA	NA	NA	NA	NA
AYK82703.1|2014884_2016426_-	gluconokinase	NA	NA	NA	NA	NA
AYK82704.1|2016418_2017150_-	gluconate operon transcriptional regulator	NA	NA	NA	NA	NA
AYK82705.1|2017345_2018494_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.3	1.4e-48
AYK82706.1|2018586_2019618_+	general stress protein 30	NA	NA	NA	NA	NA
AYK82707.1|2019657_2020350_-	LrgB family protein	NA	NA	NA	NA	NA
AYK82708.1|2020319_2020724_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
AYK82709.1|2020950_2021382_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYK82710.1|2021440_2022511_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYK82711.1|2022641_2023217_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYK82712.1|2023310_2024345_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AYK82713.1|2024463_2024652_-	hypothetical protein	NA	NA	NA	NA	NA
AYK82714.1|2024753_2026223_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYK82715.1|2026223_2028407_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	30.8	1.7e-50
AYK82716.1|2028570_2028825_-	hypothetical protein	NA	NA	NA	NA	NA
AYK82717.1|2029102_2030227_-|transposase	IS4 family transposase IS4Bsu1	transposase	NA	NA	NA	NA
AYK82718.1|2030548_2030770_+	hypothetical protein	NA	NA	NA	NA	NA
AYK82719.1|2030814_2031033_+|bacteriocin	bacteriocin leader domain-containing protein	bacteriocin	NA	NA	NA	NA
AYK82720.1|2031236_2031638_-	hypothetical protein	NA	NA	NA	NA	NA
AYK82721.1|2031655_2031856_-	transcriptional regulator	NA	NA	NA	NA	NA
AYK82722.1|2033047_2033299_+	hypothetical protein	NA	NA	NA	NA	NA
AYK82723.1|2033466_2035347_+	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	33.4	1.1e-93
AYK82724.1|2036892_2037405_-	HPP family protein	NA	NA	NA	NA	NA
AYK82725.1|2038161_2038632_+	hypothetical protein	NA	NA	NA	NA	NA
AYK82726.1|2038735_2039050_-	DUF2628 domain-containing protein	NA	L7TIP7	Escherichia_phage	47.0	1.6e-10
AYK82727.1|2039279_2040212_-	aldo/keto reductase	NA	NA	NA	NA	NA
AYK82728.1|2040265_2041021_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AYK82729.1|2041314_2042439_+|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
>prophage 6
CP032865	Bacillus subtilis subsp. subtilis strain N3-1 chromosome, complete genome	4122184	2189338	2303897	4122184	holin,tRNA,coat,lysis,protease,bacteriocin	Bacillus_phage(23.53%)	114	NA	NA
AYK82861.1|2189338_2190580_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
AYK82862.1|2190830_2191346_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYK82863.1|2191496_2192210_+	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
AYK82864.1|2192320_2193181_+	glycosyltransferase family 8 protein	NA	A0A2P0VP84	Tetraselmis_virus	26.4	1.9e-05
AYK82865.1|2193233_2194076_-	levansucrase and sucrase synthesis operon antiterminator	NA	NA	NA	NA	NA
AYK82866.1|2194129_2195509_-	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
AYK82867.1|2198099_2199422_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
AYK82868.1|2199513_2200191_+	DUF2711 family protein	NA	NA	NA	NA	NA
AYK82869.1|2200229_2200610_-	VOC family protein	NA	NA	NA	NA	NA
AYK82870.1|2200730_2201918_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.0	1.2e-74
AYK82871.1|2201952_2202150_-	YwbE family protein	NA	NA	NA	NA	NA
AYK82872.1|2202183_2203386_-	MFS transporter	NA	NA	NA	NA	NA
AYK82873.1|2203490_2204168_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
AYK82874.1|2204149_2204536_-|holin	holin-like protein CidA	holin	NA	NA	NA	NA
AYK82875.1|2204641_2205547_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYK82876.1|2205554_2206373_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AYK82877.1|2206369_2207038_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
AYK82878.1|2207194_2208637_+	iron transporter	NA	NA	NA	NA	NA
AYK82879.1|2208633_2209791_+	Efem/EfeO family lipoprotein	NA	NA	NA	NA	NA
AYK82880.1|2209809_2211060_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
AYK82881.1|2211342_2211945_+	DsbA family protein	NA	NA	NA	NA	NA
AYK82882.1|2211974_2213516_-	cation acetate symporter	NA	NA	NA	NA	NA
AYK82883.1|2213512_2213821_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
AYK82884.1|2214263_2214422_-	DNA-binding anti-repressor SinI	NA	NA	NA	NA	NA
AYK82885.1|2214776_2215448_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYK82886.1|2215465_2215849_+	GtrA family protein	NA	NA	NA	NA	NA
AYK82887.1|2215926_2217099_+	galactokinase	NA	NA	NA	NA	NA
AYK82888.1|2217102_2218644_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
AYK84811.1|2218714_2218960_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AYK84812.1|2219475_2220441_+	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
AYK82889.1|2220468_2222418_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AYK82890.1|2222431_2223046_+	Quinol oxidase subunit 3	NA	NA	NA	NA	NA
AYK82891.1|2223047_2223422_+	quinol oxidase subunit 4	NA	NA	NA	NA	NA
AYK82892.1|2223463_2223727_-	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
AYK82893.1|2223955_2225101_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK82894.1|2225309_2226491_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
AYK82895.1|2226596_2227346_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
AYK82896.1|2227519_2228521_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AYK82897.1|2228558_2230979_-	peptidase S8	NA	A0A217EQY2	Bacillus_phage	38.2	5.3e-21
AYK84813.1|2231508_2231811_+	hypothetical protein	NA	NA	NA	NA	NA
AYK82898.1|2232720_2233491_-	transporter	NA	NA	NA	NA	NA
AYK82899.1|2233792_2235178_+	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
AYK82900.1|2235174_2236614_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.8	3.7e-22
AYK82901.1|2236707_2236956_+	hypothetical protein	NA	NA	NA	NA	NA
AYK82902.1|2237046_2237862_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AYK82903.1|2238053_2238860_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AYK82904.1|2238873_2239551_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	46.1	8.3e-49
AYK82905.1|2239575_2240946_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AYK82906.1|2241113_2241431_+	hypothetical protein	NA	NA	NA	NA	NA
AYK82907.1|2241450_2242773_+	purine permease	NA	NA	NA	NA	NA
AYK82908.1|2242834_2243206_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
AYK82909.1|2243249_2243795_-|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
AYK82910.1|2243942_2244122_+	hypothetical protein	NA	NA	NA	NA	NA
AYK82911.1|2244114_2244885_+	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	28.6	4.4e-06
AYK82912.1|2244889_2246314_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
AYK82913.1|2246334_2247504_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	28.1	1.2e-15
AYK82914.1|2247504_2248374_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK82915.1|2248373_2249495_+|coat	spore coat biosynthesis protein SpsE	coat	NA	NA	NA	NA
AYK82916.1|2249487_2250210_+|coat	spore coat protein	coat	NA	NA	NA	NA
AYK82917.1|2250212_2251232_+|coat	spore coat protein	coat	NA	NA	NA	NA
AYK82918.1|2251256_2251997_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	41.9	4.5e-48
AYK82919.1|2251996_2252944_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
AYK82920.1|2252957_2253809_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.9	1.3e-38
AYK82921.1|2253801_2254257_+|coat	spore coat protein	coat	NA	NA	NA	NA
AYK82922.1|2254580_2255045_+	hypothetical protein	NA	NA	NA	NA	NA
AYK82923.1|2255222_2256497_+	catabolic NAD-specific glutamate dehydrogenase RocG	NA	NA	NA	NA	NA
AYK82924.1|2256723_2258271_+	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYK82925.1|2258344_2260045_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
AYK82926.1|2260044_2261457_+	amino acid permease	NA	NA	NA	NA	NA
AYK82927.1|2261666_2262905_+	MFS transporter	NA	NA	NA	NA	NA
AYK82928.1|2263056_2263671_+	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
AYK82929.1|2263660_2264368_+	bacilysin biosynthesis protein BacB	NA	NA	NA	NA	NA
AYK84814.1|2264370_2265132_+	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	2.8e-21
AYK82930.1|2265150_2266569_+	alanine-anticapsin ligase BacD	NA	NA	NA	NA	NA
AYK82931.1|2266565_2267750_+	MFS transporter	NA	NA	NA	NA	NA
AYK82932.1|2267750_2268965_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AYK82933.1|2268980_2269760_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYK82934.1|2269892_2270657_-	heme-binding protein	NA	NA	NA	NA	NA
AYK82935.1|2270926_2271898_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
AYK82936.1|2272043_2272943_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
AYK82937.1|2272991_2273837_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
AYK82938.1|2274005_2274896_+	DMT family transporter	NA	NA	NA	NA	NA
AYK82939.1|2275039_2275816_-	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
AYK82940.1|2276030_2276255_+	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
AYK82941.1|2276416_2277718_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
AYK82942.1|2277753_2278254_+	YwgA family protein	NA	NA	NA	NA	NA
AYK82943.1|2278365_2278836_+	transcriptional regulator	NA	NA	NA	NA	NA
AYK82944.1|2278835_2280236_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
AYK82945.1|2280315_2280471_+	hypothetical protein	NA	NA	NA	NA	NA
AYK82946.1|2281080_2282997_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	43.4	1.9e-143
AYK82947.1|2283116_2283536_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYK82948.1|2283578_2283767_-	2-hydroxymuconate tautomerase	NA	NA	NA	NA	NA
AYK82949.1|2283875_2284535_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AYK82950.1|2284548_2285067_+	hypothetical protein	NA	NA	NA	NA	NA
AYK82951.1|2285205_2285640_+	hypothetical protein	NA	NA	NA	NA	NA
AYK82952.1|2285667_2287743_-	penicillin-binding protein	NA	NA	NA	NA	NA
AYK82953.1|2287944_2288775_+	spermidine synthase	NA	NA	NA	NA	NA
AYK82954.1|2288835_2289708_+	agmatinase	NA	NA	NA	NA	NA
AYK82955.1|2289642_2290200_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
AYK82956.1|2290297_2290417_-	phosphatase RapF inhibitor	NA	NA	NA	NA	NA
AYK82957.1|2290400_2291546_-	transcriptional regulator	NA	A0A1P8CWN8	Bacillus_phage	43.5	1.7e-78
AYK82958.1|2291775_2293131_+	YncE family protein	NA	NA	NA	NA	NA
AYK82959.1|2293169_2294546_+	YncE family protein	NA	NA	NA	NA	NA
AYK82960.1|2294551_2295253_-|bacteriocin	bacteriocin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
AYK82961.1|2295249_2296530_-	insulinase family protein	NA	NA	NA	NA	NA
AYK84815.1|2296534_2297695_-	insulinase family protein	NA	NA	NA	NA	NA
AYK82962.1|2297684_2298995_-|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
AYK82963.1|2298987_2299707_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	1.6e-18
AYK82964.1|2299703_2299865_-|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
AYK82965.1|2299877_2301224_-	subtilosin maturase AlbA	NA	NA	NA	NA	NA
AYK82966.1|2301248_2301401_-|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
AYK82967.1|2301357_2301489_-|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
AYK82968.1|2301801_2302230_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
AYK82969.1|2302226_2303897_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 7
CP032865	Bacillus subtilis subsp. subtilis strain N3-1 chromosome, complete genome	4122184	2598612	2636195	4122184	tail,capsid,portal,holin,integrase,protease,plate	Bacillus_phage(33.33%)	49	2599505:2599558	2636334:2636387
AYK83250.1|2598612_2599206_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	55.8	2.6e-54
2599505:2599558	attL	GGTTTCCGGTACCACGTCTGTCGGGGGTTCGAATCCCTCCGAGCGCGTCCAATA	NA	NA	NA	NA
AYK83251.1|2599751_2600741_+	DNA integration/recombination/inversion protein	NA	A0A0U4IBS1	Pseudomonas_phage	28.1	2.7e-08
AYK83252.1|2600899_2601631_+	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	32.7	6.7e-20
AYK83253.1|2601661_2601844_-	hypothetical protein	NA	NA	NA	NA	NA
AYK83254.1|2601903_2602137_-	transcriptional regulator	NA	NA	NA	NA	NA
AYK83255.1|2602725_2603061_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83256.1|2603262_2603478_-	XRE family transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	50.8	1.7e-08
AYK83257.1|2603598_2604774_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83258.1|2605307_2605850_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83259.1|2606211_2606553_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83260.1|2606545_2606746_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83261.1|2607377_2607626_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYK83262.1|2607622_2608006_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83263.1|2608073_2608445_+	DUF134 domain-containing protein	NA	NA	NA	NA	NA
AYK83264.1|2609305_2609584_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83265.1|2609580_2610123_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83266.1|2611167_2611347_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83267.1|2611599_2611911_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83268.1|2612284_2612494_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83269.1|2612523_2613072_-|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	51.6	7.0e-38
AYK83270.1|2613155_2614916_+	hypothetical protein	NA	A0A142F1L6	Bacillus_phage	44.8	8.3e-133
AYK83271.1|2614932_2615367_+	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	49.3	1.5e-27
AYK83272.1|2615371_2617042_+|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	55.3	1.5e-155
AYK83273.1|2617041_2617854_+|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	52.7	8.1e-75
AYK83274.1|2617959_2618520_+	ribonucleoside-triphosphate reductase	NA	NA	NA	NA	NA
AYK83275.1|2618551_2619460_+|capsid	phage major capsid protein	capsid	A0A0N9S7T7	Paenibacillus_phage	52.5	1.4e-80
AYK83276.1|2619516_2619708_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83277.1|2619725_2620118_+	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.5	7.5e-18
AYK83278.1|2620118_2620457_+	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	47.3	8.1e-21
AYK83279.1|2620453_2620861_+	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	55.5	2.1e-31
AYK83280.1|2620865_2621240_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83281.1|2621280_2621850_+	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	63.0	1.0e-52
AYK84826.1|2621936_2622293_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83282.1|2622388_2622610_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83283.1|2622614_2625437_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	36.4	6.7e-68
AYK83284.1|2625440_2626859_+|tail	phage tail protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	42.4	1.3e-56
AYK83285.1|2626873_2628268_+	endopeptidase	NA	A6M966	Geobacillus_virus	30.3	3.0e-37
AYK83286.1|2628280_2629858_+	hypothetical protein	NA	M4ZSB3	Bacillus_phage	86.8	3.3e-258
AYK83287.1|2629894_2631118_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	74.9	4.1e-163
AYK83288.1|2631133_2631427_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	80.2	1.6e-41
AYK83289.1|2631427_2631598_+	XkdX family protein	NA	M4ZS22	Bacillus_phage	68.1	1.1e-10
AYK83290.1|2631622_2631826_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	46.5	1.9e-09
AYK83291.1|2631898_2632846_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	62.7	2.5e-91
AYK83292.1|2632865_2633123_+|holin	holin	holin	A0A0U4JE55	Bacillus_phage	57.6	5.6e-22
AYK83293.1|2633244_2633547_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83294.1|2633588_2634221_-	hypothetical protein	NA	Q0H249	Geobacillus_phage	57.1	7.2e-63
AYK83295.1|2634207_2635392_-	DNA translocase FtsK	NA	Q0H250	Geobacillus_phage	53.4	1.3e-108
AYK83296.1|2635404_2635683_-	hypothetical protein	NA	NA	NA	NA	NA
AYK83297.1|2635961_2636195_+	helix-turn-helix domain-containing protein	NA	B3RH35	Bacillus_virus	62.0	4.3e-21
2636334:2636387	attR	GGTTTCCGGTACCACGTCTGTCGGGGGTTCGAATCCCTCCGAGCGCGTCCAATA	NA	NA	NA	NA
>prophage 8
CP032865	Bacillus subtilis subsp. subtilis strain N3-1 chromosome, complete genome	4122184	2715977	2766346	4122184	tail,capsid,portal,holin,protease,terminase,head	Bacillus_phage(71.79%)	62	NA	NA
AYK83367.1|2715977_2716631_+|holin	choline ABC transporter permease	holin	NA	NA	NA	NA
AYK83368.1|2716642_2717563_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYK83369.1|2717579_2718260_+	ABC transporter permease	NA	NA	NA	NA	NA
AYK83370.1|2718300_2720001_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	8.0e-24
AYK83371.1|2720128_2720455_-	HxlR family transcriptional regulator	NA	NA	NA	NA	NA
AYK83372.1|2720546_2720966_-	XRE family transcriptional regulator	NA	S6C481	Thermus_phage	62.7	5.4e-14
AYK83373.1|2720995_2721403_-	transcriptional regulator	NA	S6C481	Thermus_phage	64.8	1.9e-16
AYK83374.1|2721554_2721788_+	transcriptional regulator	NA	NA	NA	NA	NA
AYK83375.1|2721821_2722595_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYK83376.1|2722743_2722974_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AYK83377.1|2723105_2723846_+	carboxylesterase	NA	NA	NA	NA	NA
AYK83378.1|2723864_2726204_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	42.9	2.4e-87
AYK83379.1|2726348_2726819_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.4	3.2e-47
AYK83380.1|2728743_2729844_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYK83381.1|2730276_2730675_-	XRE family transcriptional regulator	NA	S5M5X8	Brevibacillus_phage	33.7	4.3e-05
AYK83382.1|2730909_2731113_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYK83383.1|2731164_2731356_+	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	59.0	1.0e-12
AYK83384.1|2731380_2731599_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83385.1|2731591_2732473_+	replication protein	NA	V9QKF6	Oenococcus_phage	33.1	6.8e-27
AYK83386.1|2732456_2733284_+	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	35.9	3.7e-35
AYK83387.1|2733598_2734147_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83388.1|2734254_2734395_+	BH0509 family protein	NA	NA	NA	NA	NA
AYK83389.1|2734641_2734839_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83390.1|2734881_2735244_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AYK83391.1|2735240_2735558_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83392.1|2735554_2735962_+	hypothetical protein	NA	W8CYU3	Bacillus_phage	45.8	1.3e-25
AYK83393.1|2735958_2736216_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	41.7	6.6e-07
AYK83394.1|2736333_2736990_+	dUTPase	NA	R9TQ23	Paenibacillus_phage	46.0	9.9e-39
AYK83395.1|2736989_2737322_+	hypothetical protein	NA	F8WQ59	Bacillus_phage	53.3	8.3e-18
AYK83396.1|2737318_2737738_+	hypothetical protein	NA	A0A2I6UHP7	Bacillus_phage	61.2	1.6e-42
AYK83397.1|2737734_2737935_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83398.1|2738188_2738641_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	56.6	3.4e-38
AYK83399.1|2739831_2740215_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83400.1|2740365_2741139_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83401.1|2741529_2742276_+	hypothetical protein	NA	NA	NA	NA	NA
AYK84830.1|2742325_2742700_+	HNH endonuclease	NA	Q38456	Bacillus_phage	82.3	7.5e-60
AYK83402.1|2743079_2743613_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	82.5	1.0e-70
AYK83403.1|2743612_2745322_+|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	92.3	0.0e+00
AYK83404.1|2745334_2745550_+	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	80.6	1.3e-24
AYK83405.1|2745555_2746803_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	86.5	1.3e-217
AYK83406.1|2746792_2747419_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	92.8	1.8e-106
AYK83407.1|2747455_2748658_+|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	71.5	3.3e-157
AYK83408.1|2748673_2748988_+	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	68.8	6.8e-30
AYK83409.1|2749016_2749508_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	69.1	1.3e-27
AYK83410.1|2749523_2749871_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	87.0	2.0e-51
AYK83411.1|2749803_2750175_+|head,tail	head-tail adaptor protein	head,tail	Q9ZXF2	Bacillus_phage	68.3	3.5e-41
AYK83412.1|2750167_2750551_+	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	86.6	2.9e-59
AYK83413.1|2750547_2750928_+	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	66.1	2.6e-39
AYK83414.1|2750928_2751540_+|tail	phage tail protein	tail	Q9ZXE9	Bacillus_phage	89.7	7.9e-99
AYK83415.1|2751594_2751933_+	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	70.5	3.0e-39
AYK83416.1|2751935_2752115_+	hypothetical protein	NA	D6R3Z7	Bacillus_phage	68.5	1.6e-12
AYK83417.1|2752127_2756006_+|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	81.0	0.0e+00
AYK83418.1|2756855_2758562_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	81.8	9.4e-267
AYK83419.1|2758598_2760173_+	hypothetical protein	NA	M4ZSB3	Bacillus_phage	88.7	1.1e-264
AYK83420.1|2760209_2761433_+	DUF2479 domain-containing protein	NA	M4ZRP1	Bacillus_phage	79.9	6.5e-177
AYK83421.1|2761448_2761748_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	1.5e-39
AYK83422.1|2761744_2761915_+	XkdX family protein	NA	NA	NA	NA	NA
AYK83423.1|2761968_2762391_+|holin	holin family protein	holin	D6R405	Bacillus_phage	85.7	3.0e-57
AYK83424.1|2762432_2763374_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	77.1	3.0e-97
AYK84831.1|2763413_2764016_-	hypothetical protein	NA	NA	NA	NA	NA
AYK83425.1|2764358_2764748_-	hypothetical protein	NA	NA	NA	NA	NA
AYK83426.1|2764762_2766346_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	59.7	4.2e-75
>prophage 9
CP032865	Bacillus subtilis subsp. subtilis strain N3-1 chromosome, complete genome	4122184	3338096	3395204	4122184	transposase,tRNA,coat,protease,integrase	Staphylococcus_phage(20.0%)	47	3337772:3337826	3349172:3349226
3337772:3337826	attL	AGCTGGATAGAGCAACGGCCTTCTAAGCCGTCGGTCGGGAGTTCGAATCTCTCCT	NA	NA	NA	NA
AYK84860.1|3338096_3338984_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AYK83951.1|3339321_3339618_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83952.1|3340406_3341459_+	hypothetical protein	NA	NA	NA	NA	NA
AYK83953.1|3341763_3344970_+	type I restriction-modification system endonuclease	NA	Q5YA94	Bacillus_phage	29.5	1.7e-06
AYK83954.1|3345102_3346533_+	SAM-dependent methyltransferase	NA	A0A220A2U4	Liberibacter_phage	25.9	2.6e-28
AYK83955.1|3346529_3347849_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	35.9	1.3e-16
AYK83956.1|3349352_3350503_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
3349172:3349226	attR	AGCTGGATAGAGCAACGGCCTTCTAAGCCGTCGGTCGGGAGTTCGAATCTCTCCT	NA	NA	NA	NA
AYK83957.1|3350637_3351462_-	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
AYK83958.1|3352263_3352599_-	hypothetical protein	NA	NA	NA	NA	NA
AYK83959.1|3353411_3355136_+	acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.2	2.4e-60
AYK83960.1|3355132_3355651_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
AYK83961.1|3355674_3356703_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AYK83962.1|3356689_3358246_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	39.4	6.0e-10
AYK83963.1|3358266_3359364_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AYK83964.1|3359413_3360832_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AYK83965.1|3360844_3361444_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AYK83966.1|3361563_3362568_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AYK83967.1|3362795_3364070_+	trigger factor	NA	NA	NA	NA	NA
AYK83968.1|3364341_3365604_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
AYK83969.1|3365757_3367416_+|protease	Lon protease 2	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
AYK83970.1|3367596_3369921_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	2.6e-182
AYK83971.1|3369917_3370505_+	GTP-binding protein	NA	NA	NA	NA	NA
AYK83972.1|3370526_3371024_-	hypothetical protein	NA	NA	NA	NA	NA
AYK83973.1|3371253_3372621_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
AYK83974.1|3372628_3373459_+	protein HemX	NA	NA	NA	NA	NA
AYK83975.1|3373491_3374436_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AYK83976.1|3374425_3375214_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AYK83977.1|3375210_3376185_+	porphobilinogen synthase	NA	NA	NA	NA	NA
AYK83978.1|3376214_3377507_+	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
AYK83979.1|3377637_3379359_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AYK83980.1|3379391_3380417_+|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
AYK83981.1|3380435_3380627_-	hypothetical protein	NA	NA	NA	NA	NA
AYK83982.1|3381074_3383717_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	3.7e-161
AYK83983.1|3383776_3385069_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AYK83984.1|3385208_3385955_+	prepilin peptidase	NA	NA	NA	NA	NA
AYK83985.1|3386088_3387087_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
AYK83986.1|3387239_3387809_+	septum formation protein Maf	NA	NA	NA	NA	NA
AYK83987.1|3387845_3388541_+	JAB domain-containing protein	NA	NA	NA	NA	NA
AYK83988.1|3388632_3389646_+	rod shape-determining protein	NA	NA	NA	NA	NA
AYK83989.1|3389676_3390549_+	cell shape-determining protein MreC	NA	NA	NA	NA	NA
AYK83990.1|3390545_3391064_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AYK83991.1|3391116_3391797_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
AYK83992.1|3391798_3392605_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
AYK83993.1|3392754_3393549_+	stage IV sporulation protein FA	NA	NA	NA	NA	NA
AYK83994.1|3393541_3394408_+	stage IV sporulation protein FB	NA	NA	NA	NA	NA
AYK83995.1|3394554_3394863_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
AYK83996.1|3394865_3395204_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
>prophage 10
CP032865	Bacillus subtilis subsp. subtilis strain N3-1 chromosome, complete genome	4122184	3789237	3795332	4122184		Staphylococcus_phage(66.67%)	8	NA	NA
AYK84397.1|3789237_3790323_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	6.6e-56
AYK84398.1|3790333_3790981_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	8.5e-43
AYK84399.1|3790995_3792192_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	4.1e-115
AYK84400.1|3792224_3792689_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
AYK84401.1|3792801_3793176_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK84402.1|3793189_3793714_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
AYK84885.1|3793993_3794749_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	5.5e-09
AYK84403.1|3794738_3795332_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.6e-14
>prophage 11
CP032865	Bacillus subtilis subsp. subtilis strain N3-1 chromosome, complete genome	4122184	4007771	4033914	4122184	transposase,holin	Bacillus_phage(60.0%)	31	NA	NA
AYK84632.1|4007771_4009208_-	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	30.6	2.6e-07
AYK84633.1|4009335_4009893_+	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	95.7	7.0e-102
AYK84634.1|4009991_4011794_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	87.0	1.3e-218
AYK84635.1|4011803_4012262_+	antitoxin YobK	NA	NA	NA	NA	NA
AYK84636.1|4012354_4012813_+	SMI1/KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	85.5	2.8e-72
AYK84637.1|4012868_4013423_+	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	91.3	4.3e-96
AYK84638.1|4013482_4014016_+	N-acetyltransferase	NA	O64026	Bacillus_phage	97.2	2.9e-97
AYK84639.1|4014304_4014388_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AYK84640.1|4014647_4015007_+	hypothetical protein	NA	A0A1P8CWJ9	Bacillus_phage	98.3	2.2e-61
AYK84641.1|4017213_4018461_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
AYK84642.1|4018544_4019777_+	MFS transporter	NA	NA	NA	NA	NA
AYK84643.1|4019788_4020619_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AYK84644.1|4020623_4021769_+	ThiF family adenylyltransferase	NA	A0A1V0SCZ9	Indivirus	21.1	4.3e-05
AYK84645.1|4022128_4023253_-|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
AYK84646.1|4023466_4024111_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
AYK84898.1|4024229_4024583_+	hypothetical protein	NA	NA	NA	NA	NA
AYK84647.1|4024617_4024842_+	hypothetical protein	NA	NA	NA	NA	NA
AYK84648.1|4024886_4025279_+	UPF0715 family protein	NA	O64087	Bacillus_phage	81.4	3.7e-49
AYK84649.1|4025288_4025519_-	hypothetical protein	NA	NA	NA	NA	NA
AYK84650.1|4025652_4027080_+	serine hydrolase	NA	NA	NA	NA	NA
AYK84651.1|4027448_4027700_+	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	96.4	1.0e-36
AYK84652.1|4027936_4028080_+	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	92.5	9.6e-16
AYK84653.1|4028152_4029400_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
AYK84654.1|4029461_4029773_+	hypothetical protein	NA	NA	NA	NA	NA
AYK84655.1|4029859_4030093_+	3-ketosteroid-delta-1-dehydrogenase	NA	NA	NA	NA	NA
AYK84656.1|4030129_4030369_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
AYK84657.1|4030409_4031560_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
AYK84658.1|4031683_4031878_+	hypothetical protein	NA	NA	NA	NA	NA
AYK84659.1|4031919_4032216_+	hypothetical protein	NA	NA	NA	NA	NA
AYK84660.1|4032368_4032665_+	hypothetical protein	NA	NA	NA	NA	NA
AYK84661.1|4032666_4033914_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
