The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	0	49361	4122398	transposase,coat,tail,protease,holin	Bacillus_phage(50.0%)	46	NA	NA
AYK89087.1|320_1154_+|tail	phage tail family protein	tail	M4ZS20	Bacillus_phage	34.1	3.5e-33
AYK89088.1|3750_4458_+	hypothetical protein	NA	M4ZSB3	Bacillus_phage	94.3	1.9e-112
AYK89089.1|6095_6266_+	XkdX family protein	NA	NA	NA	NA	NA
AYK89090.1|6317_6530_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	59.4	1.9e-15
AYK89091.1|6544_6808_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	66.7	2.7e-24
AYK89092.1|7885_8350_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AYK92984.1|10302_10374_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89093.1|10389_11475_-	DUF4917 family protein	NA	NA	NA	NA	NA
AYK89094.1|11511_11712_-	hypothetical protein	NA	NA	NA	NA	NA
AYK89095.1|12308_12599_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89096.1|12837_13329_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89097.1|13509_14361_+	toxin	NA	O64021	Bacillus_phage	60.3	1.4e-85
AYK89098.1|14659_14911_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92985.1|15094_15529_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AYK89099.1|16571_17330_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
AYK92986.1|17326_18874_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AYK89100.1|19036_20191_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.4e-24
AYK89101.1|20187_21087_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYK89102.1|21164_21545_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89103.1|22086_22317_+	XRE family transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	75.0	2.1e-20
AYK89104.1|23828_23993_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89105.1|24132_24603_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89106.1|25399_26791_+	MFS transporter	NA	NA	NA	NA	NA
AYK89107.1|26863_27181_+|transposase	transposase	transposase	NA	NA	NA	NA
AYK89108.1|27177_28092_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
AYK89109.1|28230_29832_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
AYK89110.1|29969_31124_-	ROK family protein	NA	NA	NA	NA	NA
AYK89111.1|31361_32699_+	xylose isomerase	NA	NA	NA	NA	NA
AYK89112.1|32849_34349_+	xylulokinase	NA	NA	NA	NA	NA
AYK89113.1|34833_36081_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
AYK89114.1|36210_36846_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	68.5	7.7e-73
AYK89115.1|37258_38674_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
AYK89116.1|38775_39960_-	alanine racemase 2	NA	NA	NA	NA	NA
AYK89117.1|40370_40796_-	endonuclease	NA	NA	NA	NA	NA
AYK89118.1|41714_42149_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A0A1P8CX51	Bacillus_phage	92.3	5.8e-72
AYK89119.1|42749_43013_-	hypothetical protein	NA	NA	NA	NA	NA
AYK89120.1|43064_43289_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89121.1|43419_43584_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89122.1|43858_44698_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	98.2	5.6e-164
AYK89123.1|44820_45108_-	hypothetical protein	NA	NA	NA	NA	NA
AYK89124.1|45150_45870_-	hypothetical protein	NA	NA	NA	NA	NA
AYK89125.1|46029_46386_-	hypothetical protein	NA	NA	NA	NA	NA
AYK89126.1|46631_46832_-|coat	spore coat protein CotC	coat	NA	NA	NA	NA
AYK89127.1|47006_47195_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
AYK89128.1|47448_47847_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89129.1|48008_49361_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 2
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	56771	59801	4122398		Bacillus_phage(66.67%)	4	NA	NA
AYK89136.1|56771_57530_+	hypothetical protein	NA	O64134	Bacillus_phage	52.9	3.3e-54
AYK89137.1|57556_58096_-	DUF2512 family protein	NA	NA	NA	NA	NA
AYK89138.1|58214_58634_+	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	66.1	2.0e-40
AYK89139.1|59183_59801_-	LexA repressor	NA	A0A1B2APZ1	Phage_Wrath	62.3	2.5e-15
>prophage 3
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	75022	79414	4122398		Bacillus_virus(50.0%)	2	NA	NA
AYK89162.1|75022_76990_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.2	6.7e-123
AYK89163.1|76993_79414_+	DNA topoisomerase 4 subunit A	NA	A0A172JHV7	Bacillus_phage	32.5	2.8e-99
>prophage 4
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	88337	89231	4122398		Bacillus_phage(100.0%)	1	NA	NA
AYK89170.1|88337_89231_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	54.9	2.3e-83
>prophage 5
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	96159	97809	4122398		Staphylococcus_phage(100.0%)	1	NA	NA
AYK89178.1|96159_97809_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	28.3	1.2e-29
>prophage 6
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	105173	112877	4122398		Tupanvirus(100.0%)	1	NA	NA
AYK89183.1|105173_112877_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	26.1	1.9e-149
>prophage 7
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	118206	168560	4122398	transposase,holin,integrase	Bacillus_phage(52.38%)	50	118113:118172	144678:145963
118113:118172	attL	GGGACTGACCCCATAAGATGAGACAAATAAAAACACCTTCAAGTTTGAATACGGATGATT	NA	NA	NA	NA
AYK89188.1|118206_119356_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
AYK89189.1|119602_120148_-|integrase	integrase	integrase	A0A1B0T6D2	Bacillus_phage	51.4	3.6e-42
AYK89190.1|120464_120695_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYK89191.1|120879_122643_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AYK89192.1|122804_123662_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	35.0	4.5e-07
AYK89193.1|123789_124779_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
AYK89194.1|124834_126316_-	glutamate synthase	NA	NA	NA	NA	NA
AYK89195.1|126332_130895_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
AYK89196.1|131040_131943_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYK89197.1|134035_134404_-	replication termination protein	NA	A0A0K2CP62	Brevibacillus_phage	41.8	9.2e-18
AYK89198.1|134702_135419_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	78.0	9.7e-48
AYK89199.1|135569_135878_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
AYK89200.1|135944_136715_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89201.1|136758_137292_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYK89202.1|137431_138424_-	ABC transporter permease	NA	NA	NA	NA	NA
AYK89203.1|138417_139164_-	ABC transporter permease	NA	NA	NA	NA	NA
AYK89204.1|139173_140112_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.7	6.1e-26
AYK89205.1|140127_140679_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYK89206.1|141074_142319_-	MFS transporter	NA	NA	NA	NA	NA
AYK89207.1|142417_143665_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
AYK89208.1|143666_143963_-	hypothetical protein	NA	NA	NA	NA	NA
AYK89209.1|144115_144412_-	hypothetical protein	NA	NA	NA	NA	NA
AYK89210.1|144453_144648_-	hypothetical protein	NA	NA	NA	NA	NA
AYK89211.1|144771_145921_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
AYK89212.1|145962_146202_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
144678:145963	attR	GGGACTGACCCCATAAGATGAGACAAATAAAAACACCTTCAAGTTTGAATACGGATGATTGTTATCCGAAATTAGACTTGGAGGTGTTTTTTCTATGGGGACAAGAGTGAGTTATCCGGTTGAAGTGAAACAGAAGGCTGTAGAAATGAGATTGGCAGGCGTACCTATGAAAGAGATCATGCAGGAGTTGAATATCAAAAATAATACGCAGATTAAGACATGGGTCAGATGGTATAAGGCTGGTGATACACATCGATTTGAACAGCCTGTTGGTAAGCAATACACTTATGGAAAAGGTCCGGAGTATTCTTCCGAATTAGAGAAACTGCAGGCAGAGAATCGATATCTGAGACAACAGAATGAAGTGTTAAAAAAGTACAACGAATTGGAAAGGAAGTTGATAGCCAAACGTCAGTCGAACTTGTAGAAGAATTGCACAGCACAATGACCGTGCAGGATATCTGTATTCATTTAGGTATCTCTCGCTCGTCTTATTATCGTTGGAAGAAGAATCTGAAGAAAGATCATCCCAAGCGCCATTTAGAAAAACAAATCGGCACGTTGTGCCGAGAGCACCAGTATCGATATGGATATCGAAAAATCACAGCTATATTAAAAAAGAGAATGTGTATTAACCATAAAACGGTTCAGCGTATTATGCAGAAAAATCAGTGGCAGTGCCGGGTTAAGGTGAAAAAGCGCAAGAAGAATGGGCAGCCATATGCCGTGGTCGACAATATATTAGATAGGAACTTTCAGTCTGATCATCCTCTTGAAAAACTAGTAACAGACATCACGTATTTGCCTTATGGACAGAAACAATTGTACCTTTCCAGTATATTGGATGTATATAATGGAGAAGTGATTGCTTTTACGATTGGAGATAAGCAGGACACAGACTTTGTCTTACACACACTTGATCAACTGCCAACACTGCCTGAGAACTGCGTGTTACATAGTGACCAAGGATCTGTGTATACATCTTACGAGTATCAGAAAGCTGTTAAAACAAAAGGCATTACCATGAGCATGTCCCGCAAAGGGACACCCGCTGATAATGCCTCCATCGAATCGTTTCATTCCTCACTAAAGTCTGAAACGTTCTATCTTAACAGCATTGATCGAACCACGACCGCCATCGTAGAACGCACTGTCATAGAATACATTCATTATTATAACAATATTCGTATTCAAACGAAACTAAACAACCAATCACCGATAAATTATCGGCAATTGGCTGTTTAAAAGGTGTTTTGATCCCTGTCTCAAAAACGGGGGTCAGTCCC	NA	NA	NA	NA
AYK89213.1|146238_146472_-	3-ketosteroid-delta-1-dehydrogenase	NA	NA	NA	NA	NA
AYK89214.1|146558_146870_-	hypothetical protein	NA	NA	NA	NA	NA
AYK89215.1|146931_148179_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
AYK89216.1|148251_148395_-	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	92.5	9.6e-16
AYK89217.1|148631_148883_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	96.4	1.0e-36
AYK92989.1|149251_150679_-	serine hydrolase	NA	NA	NA	NA	NA
AYK89218.1|150812_151043_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89219.1|151052_151445_-	UPF0715 family protein	NA	O64087	Bacillus_phage	81.4	3.7e-49
AYK89220.1|151489_151714_-	hypothetical protein	NA	NA	NA	NA	NA
AYK92990.1|151748_152102_-	hypothetical protein	NA	NA	NA	NA	NA
AYK89221.1|152220_152865_-	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
AYK89222.1|153078_154203_+|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
AYK89223.1|154562_155708_-	ThiF family adenylyltransferase	NA	A0A1V0SCZ9	Indivirus	21.1	4.3e-05
AYK89224.1|155712_156543_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AYK89225.1|156554_157787_-	MFS transporter	NA	NA	NA	NA	NA
AYK89226.1|157870_159118_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
AYK89227.1|161324_161684_-	hypothetical protein	NA	A0A1P8CWJ9	Bacillus_phage	98.3	2.2e-61
AYK89228.1|161943_162027_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AYK89229.1|162315_162849_-	N-acetyltransferase	NA	O64026	Bacillus_phage	97.2	2.9e-97
AYK89230.1|162908_163463_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	91.3	4.3e-96
AYK89231.1|163518_163977_-	SMI1/KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	85.5	2.8e-72
AYK89232.1|164069_164528_-	antitoxin YobK	NA	NA	NA	NA	NA
AYK89233.1|164537_166340_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	87.0	1.3e-218
AYK92991.1|166438_166996_-	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	95.7	7.0e-102
AYK89234.1|167123_168560_+	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	30.6	2.6e-07
>prophage 8
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	172660	175573	4122398		Streptococcus_phage(100.0%)	4	NA	NA
AYK92992.1|172660_173599_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	26.0	9.2e-06
AYK89241.1|173805_174351_+	kinase	NA	NA	NA	NA	NA
AYK89242.1|174377_174701_-	transcriptional regulator	NA	NA	NA	NA	NA
AYK89243.1|174895_175573_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	35.0	7.6e-18
>prophage 9
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	182504	185391	4122398		Bacillus_phage(50.0%)	2	NA	NA
AYK89250.1|182504_183368_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	71.7	3.1e-32
AYK89251.1|183615_185391_-	DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	36.7	1.8e-79
>prophage 10
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	193672	194509	4122398		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
AYK89263.1|193672_194509_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	39.1	1.4e-34
>prophage 11
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	203370	207864	4122398		Halovirus(33.33%)	4	NA	NA
AYK89269.1|203370_204285_-	MoxR family ATPase	NA	R4TG24	Halovirus	27.6	3.0e-09
AYK89270.1|204348_204939_-	superoxide dismutase-like protein YojM	NA	NA	NA	NA	NA
AYK89271.1|205031_206276_-	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	41.2	1.0e-15
AYK89272.1|206646_207864_-	glycosyl transferase family 1	NA	G4WEM5	Phthorimaea_operculella_granulovirus	30.7	1.1e-11
>prophage 12
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	218137	219287	4122398	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
AYK89284.1|218137_219287_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
>prophage 13
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	225450	226272	4122398		Freshwater_phage(100.0%)	1	NA	NA
AYK89291.1|225450_226272_-	D-alanyl-D-alanine carboxypeptidase family protein	NA	A0A1B0XTX0	Freshwater_phage	33.1	8.9e-05
>prophage 14
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	242507	243533	4122398		Catovirus(100.0%)	1	NA	NA
AYK89315.1|242507_243533_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.0	5.9e-38
>prophage 15
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	253086	254269	4122398		Bacillus_virus(100.0%)	2	NA	NA
AYK89329.1|253086_253593_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	49.1	4.2e-37
AYK89330.1|253735_254269_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	57.9	2.0e-50
>prophage 16
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	259672	260290	4122398		Pandoravirus(100.0%)	1	NA	NA
AYK89336.1|259672_260290_-	HD domain-containing protein	NA	S4W232	Pandoravirus	27.4	3.1e-10
>prophage 17
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	263655	267636	4122398		Lactococcus_phage(50.0%)	9	NA	NA
AYK89341.1|263655_263856_+	cold-shock protein CspD	NA	A0A1X9IGI9	Lactococcus_phage	61.9	4.2e-17
AYK89342.1|263907_264090_-	transcriptional regulator DegR	NA	NA	NA	NA	NA
AYK89343.1|264245_264515_+	DUF2564 family protein	NA	NA	NA	NA	NA
AYK89344.1|264542_264725_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
AYK89345.1|264717_265398_-	reverse transcriptase-like protein	NA	NA	NA	NA	NA
AYK89346.1|265480_266170_+	VUT family protein	NA	NA	NA	NA	NA
AYK89347.1|266169_266568_+	reverse transcriptase-like protein	NA	NA	NA	NA	NA
AYK89348.1|266609_266738_+	small, acid-soluble spore protein L	NA	NA	NA	NA	NA
AYK89349.1|266745_267636_-	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	28.7	3.2e-24
>prophage 18
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	283237	285163	4122398		Streptomyces_phage(100.0%)	1	NA	NA
AYK89364.1|283237_285163_-	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	23.3	1.0e-11
>prophage 19
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	290332	292582	4122398		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AYK89372.1|290332_292582_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	29.3	3.0e-10
>prophage 20
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	296552	297173	4122398		Bacillus_phage(100.0%)	1	NA	NA
AYK89380.1|296552_297173_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	36.6	9.4e-23
>prophage 21
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	301183	312824	4122398	tRNA	Bacillus_phage(40.0%)	11	NA	NA
AYK89384.1|301183_301882_-	DNA replication protein DnaD	NA	A0A0N7AE27	Bacillus_phage	42.7	4.3e-24
AYK92997.1|301975_303268_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.1	1.7e-58
AYK89385.1|303411_304593_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AYK89386.1|304615_305101_-	hypothetical protein	NA	NA	NA	NA	NA
AYK89387.1|305109_305280_-	DUF4264 domain-containing protein	NA	NA	NA	NA	NA
AYK89388.1|305422_308218_-	ATP-dependent helicase DinG	NA	A0A127AW80	Bacillus_phage	26.6	6.5e-55
AYK89389.1|308343_308727_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AYK89390.1|308728_309589_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
AYK89391.1|309590_310424_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	39.4	8.4e-51
AYK89392.1|310668_311646_-	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
AYK89393.1|311630_312824_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	44.8	2.6e-37
>prophage 22
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	316380	317253	4122398		Streptococcus_phage(100.0%)	1	NA	NA
AYK89399.1|316380_317253_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	45.8	9.6e-74
>prophage 23
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	321486	322026	4122398		Bacillus_virus(100.0%)	1	NA	NA
AYK89405.1|321486_322026_-	YpiB family protein	NA	G3MAV7	Bacillus_virus	48.6	2.1e-42
>prophage 24
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	326164	331651	4122398		Acinetobacter_phage(66.67%)	5	NA	NA
AYK89408.1|326164_327247_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	28.2	1.3e-24
AYK89409.1|328054_329257_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AYK89410.1|329237_329885_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AYK89411.1|329889_330642_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	43.6	3.1e-44
AYK89412.1|330634_331651_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.7	8.3e-61
>prophage 25
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	334854	341576	4122398		Pandoravirus(25.0%)	9	NA	NA
AYK89416.1|334854_336027_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	34.9	4.2e-40
AYK89417.1|336101_336872_-	chemotaxis protein methyltransferase	NA	NA	NA	NA	NA
AYK89418.1|337108_337558_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	44.3	2.4e-28
AYK89419.1|337673_338720_-	Heptaprenyl diphosphate synthase component 2	NA	NA	NA	NA	NA
AYK89420.1|338661_339363_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
AYK89421.1|339369_340125_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
AYK89422.1|340288_340516_-	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
AYK89423.1|340537_341110_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	55.7	4.9e-50
AYK89424.1|341297_341576_-	DNA-binding protein HU 1	NA	A7KV42	Bacillus_phage	75.3	1.1e-28
>prophage 26
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	354907	355825	4122398		Bacillus_phage(100.0%)	1	NA	NA
AYK89438.1|354907_355825_-	spore cortex-lytic enzyme	NA	A0A0E3XAL9	Bacillus_phage	40.3	1.6e-18
>prophage 27
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	362681	373659	4122398		Bacillus_phage(60.0%)	10	NA	NA
AYK89446.1|362681_364172_-	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	39.3	3.2e-61
AYK89447.1|364164_365223_-	hypothetical protein	NA	NA	NA	NA	NA
AYK89448.1|365488_365737_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	56.8	1.6e-18
AYK89449.1|365776_366349_-	ECF transporter S component	NA	NA	NA	NA	NA
AYK89450.1|366845_368423_+	D-3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	35.1	1.3e-36
AYK89451.1|368464_369232_-	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AYK89452.1|369343_370447_-	anti-sigma-X factor RsiX	NA	NA	NA	NA	NA
AYK89453.1|370382_370967_-	RNA polymerase sigma factor SigX	NA	NA	NA	NA	NA
AYK89454.1|371170_372940_-	sensor histidine kinase ResE	NA	W8CYF6	Bacillus_phage	38.9	1.2e-38
AYK89455.1|372936_373659_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	42.2	2.7e-45
>prophage 28
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	379138	387098	4122398		Staphylococcus_phage(57.14%)	10	NA	NA
AYK89462.1|379138_380287_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	29.5	6.0e-23
AYK89463.1|380409_380949_-	DUF3907 family protein	NA	NA	NA	NA	NA
AYK89464.1|381003_381597_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.6e-14
AYK93002.1|381586_382342_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	5.5e-09
AYK89465.1|382621_383146_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
AYK89466.1|383159_383534_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK89467.1|383646_384111_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
AYK89468.1|384143_385340_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	4.1e-115
AYK89469.1|385354_386002_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	8.5e-43
AYK89470.1|386012_387098_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	6.6e-56
>prophage 29
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	391705	403336	4122398	transposase	Bacillus_phage(20.0%)	16	NA	NA
AYK89475.1|391705_392425_+	hypothetical protein	NA	D2XR29	Bacillus_phage	37.8	7.2e-43
AYK89476.1|392809_393775_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
AYK89477.1|393848_394169_-	hypothetical protein	NA	NA	NA	NA	NA
AYK89478.1|394192_395047_-	hypothetical protein	NA	A0A1X6WFA2	Pacmanvirus	29.5	3.4e-23
AYK89479.1|395330_396053_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89480.1|396274_397522_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
AYK89481.1|397647_398013_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
AYK93003.1|398062_399478_+	lipase	NA	NA	NA	NA	NA
AYK89482.1|399490_399796_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89483.1|399905_400145_-	hypothetical protein	NA	NA	NA	NA	NA
AYK93004.1|400267_400465_-	XRE family transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	33.9	2.1e-05
AYK89484.1|400656_400968_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89485.1|400982_401375_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89486.1|401568_401817_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89487.1|402522_402777_-	hypothetical protein	NA	NA	NA	NA	NA
AYK89488.1|402904_403336_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	42.9	1.2e-16
>prophage 30
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	411264	417316	4122398		Bacillus_phage(25.0%)	7	NA	NA
AYK89497.1|411264_412032_-	RNA polymerase sporulation sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	60.7	1.0e-71
AYK89498.1|412043_412484_-	anti-sigma F factor	NA	NA	NA	NA	NA
AYK89499.1|412480_412834_-	anti-sigma F factor antagonist	NA	NA	NA	NA	NA
AYK89500.1|412929_414099_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	30.0	1.4e-35
AYK89501.1|414252_415068_-	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	48.2	1.3e-69
AYK89502.1|415080_416265_-	phosphopentomutase	NA	NA	NA	NA	NA
AYK89503.1|416425_417316_-	tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	33.7	2.2e-41
>prophage 31
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	430022	441771	4122398		Erysipelothrix_phage(14.29%)	13	NA	NA
AYK89521.1|430022_431054_-	GNAT family N-acetyltransferase	NA	A0A2K5B2B6	Erysipelothrix_phage	40.6	8.2e-32
AYK89522.1|431046_431391_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AYK89523.1|431400_431871_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK89524.1|432056_432395_-	YolD-like family protein	NA	A0A2H4JAP8	uncultured_Caudovirales_phage	27.9	2.8e-05
AYK89525.1|432391_433630_-	DNA polymerase IV 2	NA	O64031	Bacillus_phage	42.8	2.3e-76
AYK89526.1|433795_434002_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89527.1|434504_435737_+	MFS transporter	NA	NA	NA	NA	NA
AYK89528.1|435942_436329_-	hypothetical protein	NA	V5UQY3	Oenococcus_phage	56.5	1.5e-34
AYK89529.1|436333_437293_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	34.3	5.5e-30
AYK89530.1|437364_438711_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
AYK89531.1|438786_439566_-	SDR family oxidoreductase	NA	A0A0K0KVL6	Prochlorococcus_phage	27.1	7.4e-09
AYK89532.1|439571_440531_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYK89533.1|440934_441771_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	33.8	3.1e-29
>prophage 32
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	444780	451525	4122398	transposase	Streptococcus_phage(33.33%)	6	NA	NA
AYK89537.1|444780_446134_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.4	2.6e-86
AYK89538.1|446335_447097_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYK89539.1|447140_447290_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AYK89540.1|447371_448295_-	ribonuclease Z	NA	NA	NA	NA	NA
AYK89541.1|448521_449991_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.7	6.1e-81
AYK89542.1|450115_451525_-	NADP-dependent phosphogluconate dehydrogenase	NA	V5UT40	Synechococcus_phage	33.4	4.4e-36
>prophage 33
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	459949	460672	4122398		Planktothrix_phage(100.0%)	1	NA	NA
AYK89550.1|459949_460672_-	arginine transport ATP-binding protein ArtM	NA	G9BWD6	Planktothrix_phage	40.9	2.6e-32
>prophage 34
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	483540	488206	4122398		Staphylococcus_phage(33.33%)	6	NA	NA
AYK89571.1|483540_484272_-	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	29.2	1.1e-17
AYK89572.1|484350_484971_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	42.5	2.9e-24
AYK93007.1|484990_485287_-	hypothetical protein	NA	NA	NA	NA	NA
AYK89573.1|485594_485747_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89574.1|485819_486938_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
AYK89575.1|487402_488206_-	sporulation transcription factor Spo0A	NA	W8CYM9	Bacillus_phage	35.0	7.1e-07
>prophage 35
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	496299	498635	4122398		Gordonia_phage(50.0%)	2	NA	NA
AYK89583.1|496299_497646_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	32.9	1.5e-28
AYK89584.1|497783_498635_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	43.0	4.5e-44
>prophage 36
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	501821	503174	4122398	transposase	Streptococcus_phage(100.0%)	1	NA	NA
AYK89589.1|501821_503174_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 37
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	513397	522407	4122398		Prochlorococcus_phage(50.0%)	8	NA	NA
AYK89605.1|513397_514273_-	hypothetical protein	NA	A0A1V0SFX9	Hokovirus	28.3	3.7e-17
AYK89606.1|514398_514827_-	transcriptional regulator MntR	NA	NA	NA	NA	NA
AYK89607.1|514926_515763_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
AYK89608.1|515953_516334_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AYK89609.1|516368_517835_-	glycine dehydrogenase subunit 2	NA	E3ST28	Prochlorococcus_phage	42.2	8.3e-86
AYK89610.1|517827_519174_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	38.4	7.6e-62
AYK89611.1|519203_520292_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
AYK89612.1|520733_522407_+	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	31.2	4.4e-59
>prophage 38
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	539529	541446	4122398		Streptococcus_phage(100.0%)	1	NA	NA
AYK89637.1|539529_541446_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	37.9	1.0e-99
>prophage 39
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	548165	549768	4122398		Indivirus(50.0%)	2	NA	NA
AYK89648.1|548165_548975_-	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.5	2.2e-16
AYK89649.1|548958_549768_-	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.1	1.2e-14
>prophage 40
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	556391	557000	4122398		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
AYK89655.1|556391_557000_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	61.1	4.2e-68
>prophage 41
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	563206	573265	4122398	tRNA	Bodo_saltans_virus(20.0%)	10	NA	NA
AYK89664.1|563206_564100_-	endonuclease	NA	A0A2H4UU70	Bodo_saltans_virus	33.0	1.3e-25
AYK89665.1|564109_565426_-	DEAD/DEAH box family ATP-dependent RNA helicase	NA	A0A1V0SIR5	Klosneuvirus	34.5	8.6e-50
AYK89666.1|565594_566338_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89667.1|566460_567405_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
AYK89668.1|567427_568549_-	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	48.0	7.1e-21
AYK93012.1|568541_569231_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
AYK89669.1|569448_569811_-	cytochrome c550	NA	NA	NA	NA	NA
AYK93013.1|570007_570187_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89670.1|570139_571255_-	RNA polymerase sigma factor SigA	NA	A0A2I7SAT0	Vibrio_phage	35.1	7.5e-39
AYK89671.1|571453_573265_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.0	8.7e-53
>prophage 42
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	584421	585381	4122398		Rhizobium_phage(100.0%)	1	NA	NA
AYK89683.1|584421_585381_-	PhoH-like protein	NA	L7TP00	Rhizobium_phage	54.0	1.8e-52
>prophage 43
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	589835	590282	4122398		Xanthomonas_phage(100.0%)	1	NA	NA
AYK89689.1|589835_590282_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	36.7	9.7e-14
>prophage 44
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	594709	602672	4122398		Catovirus(33.33%)	6	NA	NA
AYK89695.1|594709_595837_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	28.8	4.5e-23
AYK89696.1|596036_597872_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.5	6.2e-139
AYK89697.1|597895_598459_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AYK89698.1|598529_599561_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AYK89699.1|599641_600781_-	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYK89700.1|600833_602672_-	elongation factor 4	NA	A0A1B0RXH7	Streptococcus_phage	24.6	2.6e-20
>prophage 45
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	607466	610370	4122398		Clostridium_botulinum_C_phage(50.0%)	2	NA	NA
AYK89708.1|607466_609797_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332B9	Clostridium_botulinum_C_phage	34.7	1.2e-35
AYK89709.1|609800_610370_-	ComE operon protein 2	NA	A0A127AWN5	Bacillus_phage	52.5	2.8e-34
>prophage 46
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	613688	614258	4122398		Bacillus_virus(100.0%)	1	NA	NA
AYK89715.1|613688_614258_-	nicotinate-nicotinamide nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	31.5	1.1e-22
>prophage 47
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	618826	623644	4122398		Bacillus_phage(75.0%)	6	NA	NA
AYK89722.1|618826_619579_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	64.8	6.1e-69
AYK89723.1|619765_620392_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
AYK89724.1|620410_621304_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	35.4	2.4e-56
AYK89725.1|621554_622277_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
AYK89726.1|622309_622720_-	sporulation-specific extracellular nuclease	NA	F8WPS9	Bacillus_phage	60.6	7.8e-42
AYK93015.1|622918_623644_+	RNA polymerase sporulation sigma factor SigK	NA	A0A0A0RV91	Bacillus_phage	27.5	1.8e-12
>prophage 48
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	628691	629819	4122398		Bacillus_phage(100.0%)	1	NA	NA
AYK89731.1|628691_629819_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	48.8	5.0e-91
>prophage 49
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	639124	639883	4122398		Enterobacteria_phage(100.0%)	1	NA	NA
AYK89738.1|639124_639883_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
>prophage 50
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	644173	644326	4122398		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYK93017.1|644173_644326_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	76.0	8.4e-18
>prophage 51
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	652584	653622	4122398		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYK89749.1|652584_653622_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	26.5	6.4e-16
>prophage 52
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	663848	664703	4122398		Streptococcus_phage(100.0%)	1	NA	NA
AYK89758.1|663848_664703_-	aminoglycoside 6-adenylyltransferase AadK	NA	E4ZFP8	Streptococcus_phage	58.6	9.7e-95
>prophage 53
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	672211	673027	4122398		Streptomyces_phage(100.0%)	1	NA	NA
AYK89767.1|672211_673027_-	chitosanase	NA	A0A223LHY0	Streptomyces_phage	33.2	3.7e-19
>prophage 54
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	677663	684292	4122398	coat	Synechococcus_phage(33.33%)	8	NA	NA
AYK89775.1|677663_678800_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.1	7.7e-15
AYK89776.1|678818_679016_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89777.1|679031_679331_+|coat	spore coat protein	coat	NA	NA	NA	NA
AYK89778.1|679593_680016_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AYK89779.1|680198_680393_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AYK89780.1|680523_681573_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	41.8	8.6e-69
AYK89781.1|681705_682215_+	glutamine amidotransferase	NA	NA	NA	NA	NA
AYK89782.1|682258_684292_-	levanase	NA	S6ATV4	Bacillus_phage	37.8	8.2e-84
>prophage 55
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	709006	712869	4122398	transposase	Streptococcus_phage(33.33%)	4	NA	NA
AYK89801.1|709006_710359_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
AYK89802.1|710491_710722_-	hypothetical protein	NA	NA	NA	NA	NA
AYK89803.1|710804_711944_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	A0A0B5JD48	Pandoravirus	31.0	5.9e-23
AYK89804.1|711945_712869_-	cysteine synthase family protein	NA	A0A1W6JHY1	Lactococcus_phage	42.1	2.4e-59
>prophage 56
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	718020	728890	4122398	protease,tRNA	Catovirus(20.0%)	11	NA	NA
AYK89811.1|718020_718656_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.7	3.2e-34
AYK89812.1|718662_719931_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	31.8	9.5e-38
AYK89813.1|719949_720879_-	U32 family peptidase	NA	NA	NA	NA	NA
AYK89814.1|720884_721538_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	31.7	3.2e-05
AYK89815.1|721689_722772_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
AYK89816.1|722902_723184_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
AYK89817.1|723201_723618_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AYK89818.1|723625_723892_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
AYK89819.1|723976_726613_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	34.5	1.1e-67
AYK89820.1|726943_728005_-	AI-2E family transporter	NA	NA	NA	NA	NA
AYK89821.1|728161_728890_+	polar amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.9	1.9e-35
>prophage 57
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	732087	734484	4122398		Brevibacillus_phage(100.0%)	1	NA	NA
AYK89828.1|732087_734484_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.2	1.4e-79
>prophage 58
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	738137	754913	4122398	tRNA	Bacillus_phage(25.0%)	13	NA	NA
AYK89832.1|738137_739403_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	53.2	1.4e-113
AYK89833.1|739442_740207_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	31.8	9.1e-20
AYK89834.1|740541_742320_-|tRNA	aspartate--tRNA ligase	tRNA	K7Y9W2	Megavirus	33.6	5.4e-07
AYK89835.1|742333_743608_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AYK89836.1|743989_744160_-	hypothetical protein	NA	NA	NA	NA	NA
AYK89837.1|744292_745849_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.7	9.3e-11
AYK89838.1|745875_746316_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AYK89839.1|746328_748533_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	34.4	1.9e-09
AYK89840.1|748700_749213_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.9	1.5e-29
AYK89841.1|749218_751579_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.9	7.3e-92
AYK89842.1|751645_751969_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
AYK89843.1|752044_752542_-	hypothetical protein	NA	NA	NA	NA	NA
AYK89844.1|752699_754913_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.7	1.5e-30
>prophage 59
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	758223	761954	4122398	tRNA	uncultured_Mediterranean_phage(66.67%)	5	NA	NA
AYK89849.1|758223_758490_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.3	1.5e-06
AYK89850.1|758526_759672_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.0	3.4e-87
AYK89851.1|759698_760727_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AYK89852.1|760756_760957_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
AYK89853.1|760949_761954_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	1.1e-07
>prophage 60
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	765909	766557	4122398		Marseillevirus(100.0%)	1	NA	NA
AYK89858.1|765909_766557_+	serine/threonine protein kinase	NA	A0A2R3ZQF2	Marseillevirus	26.3	9.2e-05
>prophage 61
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	770630	834573	4122398	coat,protease,tRNA,transposase	Staphylococcus_phage(18.18%)	57	NA	NA
AYK89864.1|770630_771794_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
AYK89865.1|771910_773017_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
AYK89866.1|773003_773873_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
AYK89867.1|773826_775422_-	L-aspartate oxidase	NA	NA	NA	NA	NA
AYK89868.1|775524_776712_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A141ZJV0	Faustovirus	27.4	1.7e-33
AYK89869.1|776671_777214_+	transcription repressor NadR	NA	NA	NA	NA	NA
AYK89870.1|777238_778096_-	prephenate dehydratase	NA	NA	NA	NA	NA
AYK89871.1|778112_778556_-	ACT domain-containing protein	NA	NA	NA	NA	NA
AYK89872.1|778616_779903_-	GTPase ObgE	NA	NA	NA	NA	NA
AYK89873.1|779936_780515_-	sporulation initiation phosphotransferase B	NA	NA	NA	NA	NA
AYK89874.1|780592_780715_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89875.1|780835_781120_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
AYK89876.1|781132_781471_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
AYK89877.1|781473_781782_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AYK89878.1|781928_782795_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
AYK89879.1|782787_783582_-	stage IV sporulation protein FA	NA	NA	NA	NA	NA
AYK89880.1|783731_784538_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
AYK89881.1|784539_785220_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
AYK89882.1|785272_785791_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AYK89883.1|785787_786660_-	cell shape-determining protein MreC	NA	NA	NA	NA	NA
AYK89884.1|786690_787704_-	rod shape-determining protein	NA	NA	NA	NA	NA
AYK89885.1|787795_788491_-	JAB domain-containing protein	NA	NA	NA	NA	NA
AYK89886.1|788527_789097_-	septum formation protein Maf	NA	NA	NA	NA	NA
AYK89887.1|789249_790248_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
AYK89888.1|790381_791128_-	prepilin peptidase	NA	NA	NA	NA	NA
AYK89889.1|791267_792560_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AYK89890.1|792619_795262_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	3.7e-161
AYK89891.1|795709_795901_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89892.1|795919_796945_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
AYK89893.1|796977_798699_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AYK89894.1|798829_800122_-	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
AYK89895.1|800151_801126_-	porphobilinogen synthase	NA	NA	NA	NA	NA
AYK89896.1|801122_801911_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AYK89897.1|801900_802845_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AYK89898.1|802877_803708_-	protein HemX	NA	NA	NA	NA	NA
AYK89899.1|803715_805083_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
AYK89900.1|805312_805810_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89901.1|805831_806419_-	GTP-binding protein	NA	NA	NA	NA	NA
AYK89902.1|806415_808740_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	2.6e-182
AYK89903.1|808920_810579_-|protease	Lon protease 2	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
AYK89904.1|810732_811995_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
AYK89905.1|812266_813541_-	trigger factor	NA	NA	NA	NA	NA
AYK89906.1|813768_814773_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AYK89907.1|814892_815492_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AYK89908.1|815504_816923_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AYK89909.1|816972_818070_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AYK89910.1|818090_819647_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	39.4	6.0e-10
AYK89911.1|819633_820662_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AYK89912.1|820685_821204_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
AYK89913.1|821200_822925_-	acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.2	2.4e-60
AYK89914.1|822988_823177_-	hypothetical protein	NA	NA	NA	NA	NA
AYK89915.1|823737_824073_+	hypothetical protein	NA	NA	NA	NA	NA
AYK89916.1|824874_825699_+	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
AYK89917.1|825833_826983_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
AYK89918.1|828487_829807_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	35.9	1.3e-16
AYK89919.1|829803_831234_-	SAM-dependent methyltransferase	NA	A0A220A2U4	Liberibacter_phage	25.9	2.6e-28
AYK89920.1|831366_834573_-	type I restriction-modification system endonuclease	NA	Q5YA94	Bacillus_phage	29.5	1.7e-06
>prophage 62
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	839233	839830	4122398		Bodo_saltans_virus(100.0%)	1	NA	NA
AYK89924.1|839233_839830_-	non-canonical purine NTP pyrophosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	33.5	5.5e-12
>prophage 63
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	843416	843641	4122398		Caldibacillus_phage(100.0%)	1	NA	NA
AYK89928.1|843416_843641_-	helix-turn-helix transcriptional regulator	NA	A0A290GJH9	Caldibacillus_phage	78.7	1.2e-15
>prophage 64
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	851713	852028	4122398		Indivirus(100.0%)	1	NA	NA
AYK89937.1|851713_852028_-	thiol reductase thioredoxin	NA	A0A1V0SD63	Indivirus	43.0	3.5e-10
>prophage 65
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	857308	863689	4122398		Staphylococcus_phage(33.33%)	4	NA	NA
AYK89942.1|857308_858991_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.7	6.0e-32
AYK89943.1|859179_859584_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
AYK89944.1|859598_861956_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	43.4	2.9e-16
AYK89945.1|861976_863689_-	DNA polymerase/3'-5' exonuclease PolX	NA	E3T5M9	Cafeteria_roenbergensis_virus	24.8	1.4e-12
>prophage 66
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	868255	869290	4122398	tRNA	Tupanvirus(100.0%)	1	NA	NA
AYK89950.1|868255_869290_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.0	7.7e-30
>prophage 67
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	891633	892155	4122398		Agrobacterium_phage(100.0%)	1	NA	NA
AYK89972.1|891633_892155_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	36.5	7.1e-16
>prophage 68
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	895255	905558	4122398	tRNA	Enterobacteria_phage(25.0%)	9	NA	NA
AYK89977.1|895255_897037_-	sensor protein LytS	NA	Q9EYF3	Enterobacteria_phage	31.0	7.0e-71
AYK89978.1|897203_897986_+	HAD family hydrolase	NA	NA	NA	NA	NA
AYK89979.1|898025_899957_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.3	4.9e-110
AYK89980.1|900350_901196_-	putative sporulation protein YtxC	NA	NA	NA	NA	NA
AYK93028.1|901274_901916_-	TVP38/TMEM64 family membrane protein YtxB	NA	NA	NA	NA	NA
AYK89981.1|901949_902885_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	34.4	9.7e-40
AYK89982.1|902912_904331_-	replication initiation and membrane attachment protein	NA	NA	NA	NA	NA
AYK89983.1|904445_904904_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AYK89984.1|905177_905558_-	S-adenosylmethionine decarboxylase proenzyme	NA	Q5GQE8	Synechococcus_phage	41.8	1.6e-17
>prophage 69
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	908802	919751	4122398		Bacillus_phage(50.0%)	9	NA	NA
AYK89988.1|908802_909645_+	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	54.8	4.2e-82
AYK89989.1|909684_910278_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
AYK89990.1|910293_910926_-	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
AYK89991.1|911092_911923_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	31.3	1.5e-23
AYK89992.1|911945_914588_-	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	26.7	2.9e-41
AYK89993.1|914831_916571_-	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	40.6	8.4e-45
AYK89994.1|916563_917286_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	43.6	3.5e-45
AYK89995.1|917497_918436_-	malate dehydrogenase	NA	NA	NA	NA	NA
AYK89996.1|918479_919751_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	1.1e-12
>prophage 70
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	923554	925312	4122398		Staphylococcus_phage(100.0%)	1	NA	NA
AYK90001.1|923554_925312_-	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	49.4	1.7e-13
>prophage 71
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	930035	933383	4122398		Streptomyces_phage(100.0%)	1	NA	NA
AYK90006.1|930035_933383_-	DNA polymerase III subunit alpha	NA	A0A291AWR1	Streptomyces_phage	36.2	6.5e-179
>prophage 72
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	937590	938943	4122398	transposase	Streptococcus_phage(100.0%)	1	NA	NA
AYK90013.1|937590_938943_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 73
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	949199	954814	4122398		Klebsiella_phage(33.33%)	5	NA	NA
AYK90026.1|949199_950207_-	signal peptide peptidase SppA	NA	Q6UAX7	Klebsiella_phage	26.3	4.0e-15
AYK90027.1|950392_951196_+	NAD kinase	NA	NA	NA	NA	NA
AYK90028.1|951227_952817_-	amidohydrolase	NA	NA	NA	NA	NA
AYK90029.1|952836_954426_-	acyl--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.7	3.9e-73
AYK90030.1|954604_954814_-	small, acid-soluble spore protein A	NA	Q77YX0	Bacillus_phage	76.9	4.7e-19
>prophage 74
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	962856	969103	4122398	tRNA	Bacillus_phage(33.33%)	5	NA	NA
AYK90038.1|962856_964596_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.1	1.1e-20
AYK90039.1|964678_964861_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90040.1|964890_965493_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
AYK90041.1|965774_967043_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	43.7	3.4e-80
AYK90042.1|967384_969103_-	acetyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	73.2	1.1e-209
>prophage 75
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	974616	975693	4122398		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
AYK90049.1|974616_975693_-	protein AroA(G)	NA	E3T537	Cafeteria_roenbergensis_virus	28.5	1.6e-14
>prophage 76
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	978897	983337	4122398		Mycobacterium_phage(50.0%)	3	NA	NA
AYK90054.1|978897_981747_-	DUF87 domain-containing protein	NA	S5VNE3	Mycobacterium_phage	49.6	9.1e-89
AYK90055.1|981906_982512_-	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
AYK90056.1|982527_983337_-	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	54.5	9.6e-36
>prophage 77
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	995613	1001272	4122398		Streptococcus_phage(33.33%)	5	NA	NA
AYK90069.1|995613_996549_+	cysteine synthase	NA	A0A1X9I5F1	Streptococcus_phage	52.9	5.5e-83
AYK90070.1|996582_997974_-	dipeptidase PepV	NA	NA	NA	NA	NA
AYK90071.1|998070_999369_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.8	4.6e-48
AYK90072.1|999407_1000565_-	ABC transporter permease	NA	NA	NA	NA	NA
AYK90073.1|1000561_1001272_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	1.4e-19
>prophage 78
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1004529	1007520	4122398		Staphylococcus_phage(50.0%)	2	NA	NA
AYK93032.1|1004529_1005792_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	57.9	8.8e-28
AYK90077.1|1005981_1007520_+	glycine/betaine ABC transporter	NA	A0A2I7QNT1	Vibrio_phage	26.3	2.0e-21
>prophage 79
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1021051	1023503	4122398		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
AYK90086.1|1021051_1022167_-	8-amino-7-oxononanoate synthase	NA	G9E4Q1	Emiliania_huxleyi_virus	29.2	1.0e-35
AYK90087.1|1022156_1023503_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.4	1.1e-12
>prophage 80
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1031393	1040851	4122398	tRNA	Staphylococcus_phage(66.67%)	7	NA	NA
AYK90095.1|1031393_1033808_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	73.3	0.0e+00
AYK90096.1|1034232_1034568_-	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
AYK90097.1|1034972_1035758_+	blue-light photoreceptor	NA	NA	NA	NA	NA
AYK90098.1|1035994_1037188_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	51.8	1.0e-105
AYK90099.1|1037376_1038123_+	hypothetical protein	NA	NA	NA	NA	NA
AYK90100.1|1038159_1040100_-	ABC transporter permease	NA	NA	NA	NA	NA
AYK90101.1|1040089_1040851_-	bacitracin export ATP-binding protein BceA	NA	G9BWD6	Planktothrix_phage	35.8	6.1e-32
>prophage 81
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1044041	1067090	4122398	holin	Staphylococcus_phage(58.33%)	28	NA	NA
AYK90105.1|1044041_1044737_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	8.0e-39
AYK90106.1|1044751_1045729_-	ABC transporter permease	NA	NA	NA	NA	NA
AYK90107.1|1045760_1046747_-	ABC transporter permease	NA	NA	NA	NA	NA
AYK90108.1|1046740_1047619_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.7	6.8e-19
AYK90109.1|1047611_1048004_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYK90110.1|1048037_1048175_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90111.1|1048330_1048603_-	DUF2524 family protein	NA	NA	NA	NA	NA
AYK90112.1|1048764_1049733_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	75.2	4.2e-54
AYK90113.1|1049729_1050314_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	52.1	9.7e-46
AYK90114.1|1050303_1051407_-	tetraprenyl-beta-curcumene synthase family protein	NA	NA	NA	NA	NA
AYK90115.1|1051427_1052207_-	phospholipase YtpA	NA	A0A220T682	Eptesipox_virus	25.7	3.6e-11
AYK90116.1|1052255_1052771_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AYK90117.1|1053016_1054408_-	amino acid permease	NA	NA	NA	NA	NA
AYK90118.1|1054543_1056442_-	asparagine synthetase B	NA	R4TIC1	Phaeocystis_globosa_virus	29.4	4.3e-34
AYK90119.1|1056591_1057794_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	74.6	4.3e-165
AYK90120.1|1058296_1059880_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	64.4	1.6e-196
AYK90121.1|1059918_1060161_-	DUF2584 domain-containing protein	NA	NA	NA	NA	NA
AYK90122.1|1060212_1060986_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	41.5	7.5e-38
AYK90123.1|1061136_1062141_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYK90124.1|1062153_1062936_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.4	7.4e-33
AYK90125.1|1062910_1063723_+	ABC transporter permease	NA	NA	NA	NA	NA
AYK90126.1|1063749_1064226_-	nucleoside triphosphatase YtkD	NA	NA	NA	NA	NA
AYK90127.1|1064434_1064839_-|holin	holin family protein	holin	NA	NA	NA	NA
AYK90128.1|1065004_1065442_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	1.3e-47
AYK90129.1|1065534_1065711_+	YtzI protein	NA	NA	NA	NA	NA
AYK90130.1|1065704_1066142_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90131.1|1066261_1066735_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
AYK90132.1|1066862_1067090_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	70.3	2.8e-25
>prophage 82
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1073033	1077577	4122398		Brazilian_cedratvirus(50.0%)	4	NA	NA
AYK90140.1|1073033_1073786_-	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	5.1e-15
AYK90141.1|1073804_1074725_-	manganese-binding lipoprotein MntA	NA	NA	NA	NA	NA
AYK90142.1|1075004_1076120_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
AYK90143.1|1076116_1077577_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.7	1.5e-74
>prophage 83
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1083498	1086722	4122398		Bacillus_phage(66.67%)	3	NA	NA
AYK90149.1|1083498_1084317_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	6.3e-51
AYK90150.1|1084488_1085775_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	34.5	5.0e-71
AYK90151.1|1085771_1086722_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	32.9	3.8e-31
>prophage 84
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1092494	1094891	4122398		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AYK90158.1|1092494_1094891_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.2e-12
>prophage 85
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1109232	1110762	4122398		Orpheovirus(100.0%)	1	NA	NA
AYK90165.1|1109232_1110762_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.9	2.7e-07
>prophage 86
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1119602	1120451	4122398		Brevibacillus_phage(100.0%)	1	NA	NA
AYK90174.1|1119602_1120451_-	exo-glucosaminidase LytG	NA	A0A0K2CP65	Brevibacillus_phage	41.1	1.0e-24
>prophage 87
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1134950	1141111	4122398		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
AYK90186.1|1134950_1136936_-	methyl-accepting chemotaxis protein McpA	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.8	5.8e-26
AYK90187.1|1139122_1141111_-	methyl-accepting chemotaxis protein McpB	NA	A0A2H4J162	uncultured_Caudovirales_phage	53.4	4.4e-13
>prophage 88
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1147531	1148518	4122398		Lactobacillus_phage(100.0%)	1	NA	NA
AYK90197.1|1147531_1148518_+	potassium channel protein	NA	A0A1B0Y2S3	Lactobacillus_phage	34.8	4.8e-05
>prophage 89
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1156257	1157079	4122398		Mycobacterium_phage(100.0%)	1	NA	NA
AYK90206.1|1156257_1157079_+	alpha/beta hydrolase	NA	A0A0B5A484	Mycobacterium_phage	27.5	3.3e-07
>prophage 90
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1169758	1174790	4122398		Brazilian_cedratvirus(50.0%)	4	NA	NA
AYK90218.1|1169758_1171291_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.3	3.6e-07
AYK90219.1|1171283_1172330_+	ABC transporter permease	NA	NA	NA	NA	NA
AYK90220.1|1172330_1173290_+	ABC transporter permease	NA	NA	NA	NA	NA
AYK90221.1|1173443_1174790_+	Na+-malate symporter	NA	A0A140XAH4	Dickeya_phage	48.4	8.8e-18
>prophage 91
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1188111	1189584	4122398		Bacillus_virus(100.0%)	1	NA	NA
AYK90239.1|1188111_1189584_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.8	1.1e-106
>prophage 92
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1198570	1203058	4122398		Mycobacterium_phage(100.0%)	1	NA	NA
AYK90249.1|1198570_1203058_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	22.6	2.9e-33
>prophage 93
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1209176	1216313	4122398		Tupanvirus(100.0%)	1	NA	NA
AYK90257.1|1209176_1216313_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.9	3.4e-100
>prophage 94
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1225074	1242034	4122398	tail	Mycoplasma_phage(16.67%)	21	NA	NA
AYK90266.1|1225074_1226577_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	35.3	1.3e-57
AYK90267.1|1226734_1227211_+	divergent PAP2 family protein	NA	NA	NA	NA	NA
AYK90268.1|1227241_1227898_-	hypothetical protein	NA	A0A217ER34	Bacillus_phage	31.8	7.4e-10
AYK90269.1|1228001_1228322_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90270.1|1228375_1228519_-	hypothetical protein	NA	NA	NA	NA	NA
AYK93041.1|1228691_1229912_-	NADH dehydrogenase	NA	NA	NA	NA	NA
AYK90271.1|1230243_1231242_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	4.7e-32
AYK90272.1|1231280_1231421_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90273.1|1231697_1232678_+	GMP reductase	NA	G3MBI2	Bacillus_virus	85.5	9.5e-163
AYK90274.1|1232751_1233375_-	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
AYK90275.1|1233398_1233917_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK90276.1|1234568_1235021_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
AYK90277.1|1235154_1238268_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	57.1	2.5e-07
AYK90278.1|1238267_1238600_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90279.1|1238656_1239283_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90280.1|1239294_1239780_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90281.1|1239776_1240127_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90282.1|1240123_1240498_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90283.1|1240476_1240677_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90284.1|1240807_1241026_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90285.1|1241101_1242034_-	hypothetical protein	NA	A0A0A8WF99	Clostridium_phage	27.9	1.0e-20
>prophage 95
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1247817	1255926	4122398	integrase	Bacillus_phage(50.0%)	9	1248991:1249004	1253898:1253911
AYK90294.1|1247817_1248369_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	45.8	6.3e-39
AYK90295.1|1248700_1249426_-	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	31.5	3.6e-18
1248991:1249004	attL	TTTGAGAAATAATA	NA	NA	NA	NA
AYK90296.1|1249586_1250633_-|integrase	integrase	integrase	A0A142F1N9	Bacillus_phage	27.6	9.2e-31
AYK93042.1|1250803_1251166_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	45.3	1.4e-18
AYK90297.1|1252222_1253437_-	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	22.3	1.6e-13
AYK90298.1|1253573_1253810_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
AYK90299.1|1254072_1255140_+	NADH dehydrogenase	NA	NA	NA	NA	NA
1253898:1253911	attR	TATTATTTCTCAAA	NA	NA	NA	NA
AYK90300.1|1255165_1255492_-	DUF1462 family protein	NA	NA	NA	NA	NA
AYK90301.1|1255689_1255926_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	44.3	2.9e-09
>prophage 96
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1262706	1263207	4122398		Bacillus_virus(100.0%)	1	NA	NA
AYK90306.1|1262706_1263207_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	56.0	1.2e-41
>prophage 97
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1266657	1267638	4122398		Microcystis_phage(100.0%)	1	NA	NA
AYK90312.1|1266657_1267638_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	37.3	3.0e-07
>prophage 98
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1275707	1278355	4122398		Enterobacteria_phage(100.0%)	2	NA	NA
AYK93045.1|1275707_1277057_+	purine permease	NA	Q9KX94	Enterobacteria_phage	28.1	2.3e-26
AYK90320.1|1277062_1278355_+	purine permease	NA	Q9KX94	Enterobacteria_phage	30.0	7.7e-27
>prophage 99
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1290363	1291467	4122398		Mycoplasma_phage(100.0%)	1	NA	NA
AYK90333.1|1290363_1291467_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	29.7	5.0e-19
>prophage 100
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1296453	1297440	4122398		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
AYK90338.1|1296453_1297440_-	SIS domain-containing protein	NA	A0A2L2DN46	Acanthamoeba_polyphaga_mimivirus	23.6	1.9e-09
>prophage 101
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1302353	1312272	4122398		Mycobacterium_phage(20.0%)	15	NA	NA
AYK90346.1|1302353_1302797_-	SUF system NifU family Fe-S cluster assembly protein	NA	A0A2P1CJL8	Mycobacterium_phage	38.7	2.5e-14
AYK90347.1|1302786_1304007_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	47.6	2.2e-116
AYK90348.1|1304006_1305320_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AYK90349.1|1305337_1306123_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.6	6.5e-05
AYK90350.1|1306156_1306354_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90351.1|1306316_1306454_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90352.1|1307109_1307934_-	methionine-binding lipoprotein MetQ	NA	NA	NA	NA	NA
AYK90353.1|1307947_1308616_-	methionine import system permease MetP	NA	NA	NA	NA	NA
AYK90354.1|1308608_1309634_-	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.5	1.4e-31
AYK90355.1|1309960_1310305_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90356.1|1310411_1310732_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AYK90357.1|1310733_1311174_-	toprim domain-containing protein	NA	NA	NA	NA	NA
AYK90358.1|1311173_1311410_-	DUF2553 family protein	NA	NA	NA	NA	NA
AYK90359.1|1311465_1311849_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
AYK90360.1|1311915_1312272_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	54.6	1.8e-23
>prophage 102
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1318085	1318994	4122398		Staphylococcus_phage(100.0%)	1	NA	NA
AYK90364.1|1318085_1318994_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	42.2	1.4e-62
>prophage 103
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1322363	1325285	4122398		Trichoplusia_ni_ascovirus(50.0%)	4	NA	NA
AYK90370.1|1322363_1323104_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.1	8.0e-13
AYK90371.1|1323237_1324125_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYK90372.1|1324144_1324390_-	DUF2573 family protein	NA	NA	NA	NA	NA
AYK90373.1|1324457_1325285_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.7	4.2e-10
>prophage 104
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1330669	1331395	4122398		Staphylococcus_phage(100.0%)	1	NA	NA
AYK90377.1|1330669_1331395_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.7e-20
>prophage 105
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1341278	1344115	4122398	protease	Clostridium_phage(33.33%)	3	NA	NA
AYK90385.1|1341278_1341740_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	49.6	2.0e-30
AYK90386.1|1341783_1343160_-|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	4.3e-20
AYK90387.1|1343437_1344115_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.5	1.1e-27
>prophage 106
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1352134	1352770	4122398		Caldibacillus_phage(100.0%)	1	NA	NA
AYK90396.1|1352134_1352770_-	DNA-binding response regulator	NA	A0A290GJH9	Caldibacillus_phage	53.8	4.0e-05
>prophage 107
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1358853	1361243	4122398		Bacillus_phage(50.0%)	2	NA	NA
AYK93047.1|1358853_1360182_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.7	1.1e-07
AYK90404.1|1360181_1361243_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.1	2.0e-17
>prophage 108
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1364325	1366778	4122398		Bacillus_phage(100.0%)	2	NA	NA
AYK90408.1|1364325_1366068_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.2	1.3e-16
AYK93048.1|1366064_1366778_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.5	7.9e-34
>prophage 109
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1371059	1373906	4122398		Planktothrix_phage(50.0%)	3	NA	NA
AYK90414.1|1371059_1371749_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	9.4e-40
AYK90415.1|1371732_1372926_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYK90416.1|1373096_1373906_-	Fe(3+)-dicitrate ABC transporter ATP-binding protein	NA	A0A1J0FA64	Only_Syngen_Nebraska_virus	26.9	1.1e-10
>prophage 110
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1379480	1385288	4122398		Bacillus_phage(33.33%)	6	NA	NA
AYK90422.1|1379480_1379963_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	31.4	1.3e-08
AYK90423.1|1380062_1381916_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	35.3	3.6e-86
AYK93050.1|1381943_1382870_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYK90424.1|1382980_1383763_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYK90425.1|1383734_1384427_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AYK90426.1|1384457_1385288_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	56.4	5.0e-80
>prophage 111
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1397487	1402168	4122398		Streptococcus_phage(50.0%)	2	NA	NA
AYK90436.1|1397487_1399596_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.2	6.7e-113
AYK90437.1|1399756_1402168_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.8	1.3e-120
>prophage 112
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1409646	1461528	4122398	capsid,terminase,portal,tail,head,protease,holin	Bacillus_phage(69.05%)	65	NA	NA
AYK93051.1|1409646_1409835_+	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	53.3	1.4e-11
AYK90445.1|1409996_1411580_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	59.7	4.2e-75
AYK90446.1|1411594_1411984_+	hypothetical protein	NA	NA	NA	NA	NA
AYK93052.1|1412326_1412929_+	hypothetical protein	NA	NA	NA	NA	NA
AYK90447.1|1412968_1413910_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	77.1	3.0e-97
AYK90448.1|1413951_1414374_-|holin	holin family protein	holin	D6R405	Bacillus_phage	85.7	3.0e-57
AYK90449.1|1414427_1414598_-	XkdX family protein	NA	NA	NA	NA	NA
AYK90450.1|1414594_1414894_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	1.5e-39
AYK90451.1|1414909_1416133_-	DUF2479 domain-containing protein	NA	M4ZRP1	Bacillus_phage	79.9	6.5e-177
AYK90452.1|1416169_1417744_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	88.7	1.1e-264
AYK90453.1|1417780_1419487_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	81.8	9.4e-267
AYK90454.1|1419498_1420338_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	83.2	8.5e-136
AYK90455.1|1420337_1424216_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	81.0	0.0e+00
AYK90456.1|1424228_1424408_-	hypothetical protein	NA	D6R3Z7	Bacillus_phage	68.5	1.6e-12
AYK90457.1|1424410_1424749_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	70.5	3.0e-39
AYK90458.1|1424803_1425415_-|tail	phage tail protein	tail	Q9ZXE9	Bacillus_phage	89.7	7.9e-99
AYK90459.1|1425415_1425796_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	66.1	2.6e-39
AYK90460.1|1425792_1426176_-	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	86.6	2.9e-59
AYK90461.1|1426168_1426540_-|head,tail	head-tail adaptor protein	head,tail	Q9ZXF2	Bacillus_phage	68.3	3.5e-41
AYK90462.1|1426472_1426820_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	87.0	2.0e-51
AYK90463.1|1426835_1427327_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	69.1	1.3e-27
AYK90464.1|1427355_1427670_-	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	68.8	6.8e-30
AYK90465.1|1427685_1428888_-|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	71.5	3.3e-157
AYK90466.1|1428924_1429551_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	92.8	1.8e-106
AYK90467.1|1429540_1430788_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	86.5	1.3e-217
AYK90468.1|1430793_1431009_-	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	80.6	1.3e-24
AYK90469.1|1431021_1432731_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	92.3	0.0e+00
AYK90470.1|1432730_1433264_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	82.5	1.0e-70
AYK93053.1|1433643_1434018_-	HNH endonuclease	NA	Q38456	Bacillus_phage	82.3	7.5e-60
AYK90471.1|1434067_1434814_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90472.1|1435204_1435978_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90473.1|1436128_1436512_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90474.1|1437702_1438155_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	56.6	3.4e-38
AYK90475.1|1438408_1438609_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90476.1|1438605_1439025_-	hypothetical protein	NA	A0A2I6UHP7	Bacillus_phage	61.2	1.6e-42
AYK90477.1|1439021_1439354_-	hypothetical protein	NA	F8WQ59	Bacillus_phage	53.3	8.3e-18
AYK90478.1|1439353_1440010_-	dUTPase	NA	R9TQ23	Paenibacillus_phage	46.0	9.9e-39
AYK90479.1|1440127_1440385_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	41.7	6.6e-07
AYK90480.1|1440381_1440789_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	45.8	1.3e-25
AYK90481.1|1440785_1441103_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90482.1|1441099_1441462_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AYK90483.1|1441504_1441702_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90484.1|1441948_1442089_-	BH0509 family protein	NA	NA	NA	NA	NA
AYK90485.1|1442196_1442745_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90486.1|1443059_1443887_-	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	35.9	3.7e-35
AYK90487.1|1443870_1444752_-	replication protein	NA	V9QKF6	Oenococcus_phage	33.1	6.8e-27
AYK90488.1|1444744_1444963_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90489.1|1444987_1445179_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	59.0	1.0e-12
AYK90490.1|1445230_1445434_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYK90491.1|1445668_1446067_+	XRE family transcriptional regulator	NA	S5M5X8	Brevibacillus_phage	33.7	4.3e-05
AYK90492.1|1446499_1447600_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYK90493.1|1449524_1449995_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.4	3.2e-47
AYK90494.1|1450139_1452479_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	42.9	2.4e-87
AYK90495.1|1452497_1453238_-	carboxylesterase	NA	NA	NA	NA	NA
AYK90496.1|1453369_1453600_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AYK90497.1|1453748_1454522_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYK90498.1|1454555_1454789_-	transcriptional regulator	NA	NA	NA	NA	NA
AYK90499.1|1454940_1455348_+	transcriptional regulator	NA	S6C481	Thermus_phage	64.8	1.9e-16
AYK90500.1|1455377_1455797_+	XRE family transcriptional regulator	NA	S6C481	Thermus_phage	62.7	5.4e-14
AYK90501.1|1455888_1456215_+	HxlR family transcriptional regulator	NA	NA	NA	NA	NA
AYK90502.1|1456342_1458043_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	8.0e-24
AYK90503.1|1458083_1458764_-	ABC transporter permease	NA	NA	NA	NA	NA
AYK90504.1|1458780_1459701_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYK90505.1|1459712_1460366_-|holin	choline ABC transporter permease	holin	NA	NA	NA	NA
AYK90506.1|1460382_1461528_-	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.7	6.0e-15
>prophage 113
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1464675	1465818	4122398		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AYK90510.1|1464675_1465818_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	29.6	2.8e-12
>prophage 114
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1471373	1472666	4122398		Streptococcus_phage(100.0%)	1	NA	NA
AYK90517.1|1471373_1472666_-	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	71.5	6.4e-175
>prophage 115
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1493165	1496438	4122398		Lactobacillus_prophage(66.67%)	4	NA	NA
AYK90535.1|1493165_1494071_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	1.0e-22
AYK90536.1|1494470_1494989_+	AAA family ATPase	NA	NA	NA	NA	NA
AYK90537.1|1495006_1496041_+	N-acetyltransferase	NA	Q6SE88	Lactobacillus_prophage	39.8	9.1e-63
AYK90538.1|1496018_1496438_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	5.3e-30
>prophage 116
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1505779	1506778	4122398		Enterobacteria_phage(100.0%)	1	NA	NA
AYK90546.1|1505779_1506778_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	22.3	8.0e-08
>prophage 117
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1512189	1513356	4122398		Tupanvirus(100.0%)	1	NA	NA
AYK90551.1|1512189_1513356_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	32.8	8.7e-30
>prophage 118
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1521538	1529225	4122398		Catovirus(33.33%)	7	NA	NA
AYK90560.1|1521538_1522375_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	39.6	2.2e-14
AYK90561.1|1522371_1523517_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AYK90562.1|1523528_1525325_-	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	30.6	2.6e-25
AYK90563.1|1525583_1526267_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
AYK90564.1|1526272_1526977_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90565.1|1527222_1527681_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYK90566.1|1527755_1529225_+	carboxylesterase/lipase family protein	NA	A0A0M4JT58	Mollivirus	33.1	2.1e-36
>prophage 119
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1534628	1536179	4122398		Bacillus_phage(100.0%)	1	NA	NA
AYK90573.1|1534628_1536179_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	42.5	3.8e-97
>prophage 120
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1540150	1563822	4122398	capsid,portal,plate,tail,integrase,holin	Bacillus_phage(30.43%)	30	1547239:1547254	1565581:1565596
AYK90577.1|1540150_1540384_-	helix-turn-helix domain-containing protein	NA	B3RH35	Bacillus_virus	62.0	4.3e-21
AYK90578.1|1540662_1540941_+	hypothetical protein	NA	NA	NA	NA	NA
AYK90579.1|1540953_1542138_+	DNA translocase FtsK	NA	Q0H250	Geobacillus_phage	53.4	1.3e-108
AYK90580.1|1542124_1542757_+	hypothetical protein	NA	Q0H249	Geobacillus_phage	57.1	7.2e-63
AYK90581.1|1542798_1543101_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90582.1|1543222_1543480_-|holin	holin	holin	A0A0U4JE55	Bacillus_phage	57.6	5.6e-22
AYK90583.1|1543499_1544447_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	62.7	2.5e-91
AYK90584.1|1544519_1544723_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	46.5	1.9e-09
AYK90585.1|1544747_1544918_-	XkdX family protein	NA	M4ZS22	Bacillus_phage	68.1	1.1e-10
AYK90586.1|1544918_1545212_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	80.2	1.6e-41
AYK90587.1|1545227_1546451_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	74.9	4.1e-163
AYK90588.1|1546487_1548065_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	86.8	3.3e-258
1547239:1547254	attL	GCTTGATTTACGGTTA	NA	NA	NA	NA
AYK90589.1|1548077_1549472_-	endopeptidase	NA	A6M966	Geobacillus_virus	30.3	3.0e-37
AYK90590.1|1549486_1550905_-|tail	phage tail protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	42.4	1.3e-56
AYK90591.1|1550908_1553731_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	36.4	6.7e-68
AYK90592.1|1553735_1553957_-	hypothetical protein	NA	NA	NA	NA	NA
AYK93057.1|1554052_1554409_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90593.1|1554495_1555065_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	63.0	1.0e-52
AYK90594.1|1555105_1555480_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90595.1|1555484_1555892_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	55.5	2.1e-31
AYK90596.1|1555888_1556227_-	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	47.3	8.1e-21
AYK90597.1|1556227_1556620_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.5	7.5e-18
AYK90598.1|1556637_1556829_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90599.1|1556885_1557794_-|capsid	phage major capsid protein	capsid	A0A0N9S7T7	Paenibacillus_phage	52.5	1.4e-80
AYK90600.1|1557825_1558386_-	ribonucleoside-triphosphate reductase	NA	NA	NA	NA	NA
AYK90601.1|1558491_1559304_-|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	52.7	8.1e-75
AYK90602.1|1559303_1560974_-|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	55.3	1.5e-155
AYK90603.1|1560978_1561413_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	49.3	1.5e-27
AYK90604.1|1561429_1563190_-	hypothetical protein	NA	A0A142F1L6	Bacillus_phage	44.8	8.3e-133
AYK90605.1|1563273_1563822_+|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	51.6	7.0e-38
1565581:1565596	attR	GCTTGATTTACGGTTA	NA	NA	NA	NA
>prophage 121
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1572867	1578470	4122398	protease	Bacillus_phage(40.0%)	8	NA	NA
AYK90618.1|1572867_1573083_+	XRE family transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	50.8	1.7e-08
AYK90619.1|1573284_1573620_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90620.1|1574208_1574442_+	transcriptional regulator	NA	NA	NA	NA	NA
AYK90621.1|1574501_1574684_+	hypothetical protein	NA	NA	NA	NA	NA
AYK90622.1|1574714_1575446_-	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	32.7	6.7e-20
AYK90623.1|1575604_1576594_-	DNA integration/recombination/inversion protein	NA	A0A0U4IBS1	Pseudomonas_phage	28.1	2.7e-08
AYK90624.1|1577139_1577733_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	55.8	2.6e-54
AYK90625.1|1577795_1578470_-	beta-phosphoglucomutase	NA	A7ITQ4	Paramecium_bursaria_Chlorella_virus	26.3	5.4e-08
>prophage 122
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1589856	1592489	4122398		Catovirus(50.0%)	2	NA	NA
AYK90634.1|1589856_1590432_-	LOG family protein YvdD	NA	A0A1V0S9E9	Catovirus	27.1	3.8e-10
AYK90635.1|1590896_1592489_-	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	28.4	1.2e-45
>prophage 123
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1596412	1597192	4122398		Planktothrix_phage(100.0%)	1	NA	NA
AYK90639.1|1596412_1597192_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.9	3.5e-27
>prophage 124
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1600488	1610419	4122398		Streptococcus_phage(33.33%)	8	NA	NA
AYK90644.1|1600488_1601439_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.4	4.3e-51
AYK93058.1|1601461_1602415_-	gluconeogenesis factor	NA	A1IMD5	Streptococcus_phage	41.1	4.0e-65
AYK90645.1|1602416_1603304_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.0	8.7e-06
AYK90646.1|1603328_1603805_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AYK90647.1|1604144_1605074_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	54.5	1.5e-88
AYK90648.1|1605279_1606689_-	peptidase C40	NA	A0A0A0RVE6	Bacillus_phage	52.6	1.6e-25
AYK90649.1|1607069_1608524_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AYK90650.1|1608649_1610419_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	59.3	6.3e-165
>prophage 125
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1622283	1623433	4122398	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
AYK90664.1|1622283_1623433_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
>prophage 126
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1634387	1635740	4122398	transposase	Streptococcus_phage(100.0%)	1	NA	NA
AYK90674.1|1634387_1635740_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 127
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1639679	1642553	4122398		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AYK90681.1|1639679_1642553_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.4	0.0e+00
>prophage 128
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1651969	1655121	4122398	protease	Moraxella_phage(50.0%)	3	NA	NA
AYK90689.1|1651969_1653412_-|protease	carboxy-terminal processing protease CtpB	protease	A0A0R6PIZ1	Moraxella_phage	27.8	6.3e-22
AYK93059.1|1653551_1654442_-	ABC transporter permease	NA	NA	NA	NA	NA
AYK90690.1|1654434_1655121_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.0	2.9e-25
>prophage 129
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1665663	1665888	4122398		Vibrio_phage(100.0%)	1	NA	NA
AYK90702.1|1665663_1665888_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	50.0	2.6e-07
>prophage 130
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1671783	1677024	4122398		Streptococcus_phage(66.67%)	5	NA	NA
AYK90712.1|1671783_1673175_-	DNA/RNA helicase	NA	A0A1X9I5S6	Streptococcus_phage	37.3	4.8e-67
AYK90713.1|1673281_1674127_-	fatty acid-binding protein DegV	NA	A0A0N9SI50	Staphylococcus_phage	34.6	5.7e-15
AYK90714.1|1674224_1674914_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYK90715.1|1674996_1676154_-	signal transduction histidine kinase	NA	NA	NA	NA	NA
AYK90716.1|1676370_1677024_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.7	8.9e-40
>prophage 131
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1682562	1683222	4122398		Staphylococcus_phage(100.0%)	1	NA	NA
AYK90724.1|1682562_1683222_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.7	6.9e-32
>prophage 132
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1686280	1687039	4122398		Catovirus(100.0%)	1	NA	NA
AYK90727.1|1686280_1687039_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	36.5	7.9e-16
>prophage 133
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1690114	1691449	4122398		Bacillus_phage(100.0%)	1	NA	NA
AYK90730.1|1690114_1691449_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.5	1.0e-87
>prophage 134
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1695190	1759108	4122398	coat,transposase	Streptococcus_phage(23.08%)	53	NA	NA
AYK90734.1|1695190_1696315_+|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
AYK90735.1|1696609_1698097_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	40.6	1.7e-25
AYK90736.1|1698181_1700326_-	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	28.9	2.7e-16
AYK90737.1|1700354_1700675_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90738.1|1701915_1703268_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.4	2.6e-86
AYK90739.1|1703273_1703456_+	hypothetical protein	NA	NA	NA	NA	NA
AYK90740.1|1703495_1704848_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
AYK90741.1|1704976_1706119_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A2P1ELS7	Moumouvirus	29.9	3.8e-30
AYK90742.1|1706448_1707327_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	53.4	5.7e-82
AYK90743.1|1708564_1709476_-	teichoic acids export ABC transporter ATP-binding subunit TagH	NA	NA	NA	NA	NA
AYK90744.1|1709496_1710324_-	ABC transporter permease	NA	NA	NA	NA	NA
AYK90745.1|1712025_1714602_-	glycosyltransferase	NA	NA	NA	NA	NA
AYK90746.1|1714913_1717049_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
AYK90747.1|1717192_1717582_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	41.9	2.4e-16
AYK90748.1|1717944_1718727_+	glycosyltransferase	NA	NA	NA	NA	NA
AYK90749.1|1718746_1719910_+	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
AYK90750.1|1719938_1722581_-	beta-N-acetylglucosaminidase	NA	Q4ZC50	Staphylococcus_virus	44.9	1.8e-38
AYK90751.1|1722710_1723661_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
AYK90752.1|1723930_1725382_+	spore germination protein	NA	NA	NA	NA	NA
AYK90753.1|1725387_1726494_+	spore gernimation protein	NA	NA	NA	NA	NA
AYK90754.1|1726490_1727615_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
AYK90755.1|1729299_1730286_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AYK90756.1|1730433_1731294_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AYK93061.1|1731327_1732569_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	S5MM68	Bacillus_phage	41.1	1.8e-17
AYK90757.1|1732709_1732877_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90758.1|1732891_1734034_-	PGA biosynthesis protein CapA	NA	NA	NA	NA	NA
AYK90759.1|1734052_1734502_-	poly-gamma-glutamate biosynthesis protein PgsC	NA	NA	NA	NA	NA
AYK90760.1|1734516_1735698_-	poly-gamma-glutamate synthase PgsB	NA	NA	NA	NA	NA
AYK90761.1|1735758_1735953_+	hypothetical protein	NA	NA	NA	NA	NA
AYK90762.1|1736479_1737469_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AYK90763.1|1737461_1738343_+	ribokinase	NA	NA	NA	NA	NA
AYK90764.1|1738339_1738735_+	D-ribose pyranase	NA	NA	NA	NA	NA
AYK90765.1|1738750_1740232_+	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.0	1.5e-13
AYK90766.1|1740233_1741202_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
AYK90767.1|1741214_1742132_+	ribose ABC transporter substrate-binding protein RbsB	NA	NA	NA	NA	NA
AYK90768.1|1742213_1742750_+	cell wall-binding protein	NA	NA	NA	NA	NA
AYK90769.1|1742905_1743202_+	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
AYK90770.1|1743241_1743769_-	flavodoxin family protein	NA	NA	NA	NA	NA
AYK90771.1|1743866_1744634_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
AYK90772.1|1744695_1746408_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
AYK90773.1|1746565_1747474_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.6	6.8e-14
AYK90774.1|1747684_1749013_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	28.9	6.4e-45
AYK90775.1|1749069_1749747_-	DUF2642 domain-containing protein	NA	NA	NA	NA	NA
AYK90776.1|1749806_1750934_-|coat	spore coat protein CotH	coat	NA	NA	NA	NA
AYK90777.1|1751062_1752151_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK90778.1|1752292_1752916_+	spore gernimation protein GerQ	NA	NA	NA	NA	NA
AYK90779.1|1753089_1753707_+	flavin reductase family protein	NA	NA	NA	NA	NA
AYK90780.1|1753884_1754220_+	DUF4181 domain-containing protein	NA	NA	NA	NA	NA
AYK90781.1|1754224_1755802_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AYK90782.1|1756015_1756492_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AYK90783.1|1756505_1757099_+	chromate transporter	NA	NA	NA	NA	NA
AYK90784.1|1757095_1757632_+	chromate transporter	NA	NA	NA	NA	NA
AYK90785.1|1757755_1759108_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 135
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1764157	1779111	4122398		Bacillus_phage(40.0%)	15	NA	NA
AYK90792.1|1764157_1765969_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	36.4	5.5e-39
AYK90793.1|1765987_1766248_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90794.1|1766257_1766680_-	DUF5082 domain-containing protein	NA	NA	NA	NA	NA
AYK90795.1|1766869_1767007_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90796.1|1768052_1769375_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	39.1	1.5e-86
AYK90797.1|1769569_1770334_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
AYK90798.1|1770382_1771099_-	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	38.7	1.5e-27
AYK90799.1|1771088_1771835_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYK90800.1|1772068_1772212_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90801.1|1772415_1774026_+	SWIM zinc finger family protein	NA	NA	NA	NA	NA
AYK90802.1|1774012_1776781_+	DEAD/DEAH box helicase	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	27.5	1.3e-39
AYK90803.1|1776693_1776900_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90804.1|1776906_1777764_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AYK90805.1|1777769_1778546_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AYK90806.1|1778769_1779111_-	single-stranded DNA-binding protein B	NA	A8ASP5	Listeria_phage	65.1	7.6e-35
>prophage 136
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1786986	1787268	4122398		Clostridium_phage(100.0%)	1	NA	NA
AYK90815.1|1786986_1787268_-	stage III sporulation protein D	NA	M9Q261	Clostridium_phage	50.7	9.4e-15
>prophage 137
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1798260	1799133	4122398		Clostridium_phage(100.0%)	1	NA	NA
AYK90827.1|1798260_1799133_-	M23 family metallopeptidase	NA	I3PV24	Clostridium_phage	36.1	1.1e-05
>prophage 138
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1811409	1812543	4122398		Bacillus_phage(100.0%)	1	NA	NA
AYK90840.1|1811409_1812543_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	45.2	6.4e-86
>prophage 139
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1817119	1818151	4122398		Pseudomonas_phage(100.0%)	1	NA	NA
AYK90848.1|1817119_1818151_-	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	37.2	3.8e-37
>prophage 140
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1829594	1834414	4122398		Aeromonas_phage(50.0%)	6	NA	NA
AYK90863.1|1829594_1830842_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.7	1.5e-99
AYK90864.1|1831048_1831591_-	TIGR01440 family protein	NA	NA	NA	NA	NA
AYK90865.1|1831603_1832053_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
AYK90866.1|1832209_1832662_-	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
AYK90867.1|1832737_1833295_-	manganese efflux pump	NA	NA	NA	NA	NA
AYK90868.1|1833373_1834414_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	42.6	2.2e-61
>prophage 141
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1837489	1838560	4122398		Pseudomonas_phage(100.0%)	1	NA	NA
AYK90874.1|1837489_1838560_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	40.0	3.1e-05
>prophage 142
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1842808	1843396	4122398		Bacillus_virus(100.0%)	1	NA	NA
AYK90879.1|1842808_1843396_-	thymidine kinase	NA	G3MBK1	Bacillus_virus	45.9	3.1e-36
>prophage 143
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1848156	1852703	4122398		Synechococcus_phage(33.33%)	5	NA	NA
AYK90885.1|1848156_1848795_-	fructose-6-phosphate aldolase	NA	A0A0E3FQP8	Synechococcus_phage	45.0	7.3e-47
AYK90886.1|1848914_1849772_-	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AYK90887.1|1849952_1850327_-	response regulator	NA	W8CYM9	Bacillus_phage	36.5	2.9e-11
AYK90888.1|1850492_1851014_+	DUF2529 family protein	NA	NA	NA	NA	NA
AYK90889.1|1851095_1852703_-	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.1	1.0e-153
>prophage 144
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1858250	1859213	4122398		Bacillus_phage(100.0%)	1	NA	NA
AYK90894.1|1858250_1859213_+	UV DNA damage repair endonuclease UvsE	NA	A0A127AW32	Bacillus_phage	34.6	1.3e-39
>prophage 145
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1865181	1866645	4122398		Escherichia_phage(100.0%)	1	NA	NA
AYK90900.1|1865181_1866645_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	43.6	4.2e-21
>prophage 146
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1874025	1896842	4122398	tRNA,protease,bacteriocin	Staphylococcus_phage(33.33%)	25	NA	NA
AYK90905.1|1874025_1875696_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
AYK90906.1|1875692_1876121_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
AYK90907.1|1876433_1876565_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
AYK90908.1|1876521_1876674_+|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
AYK90909.1|1876698_1878045_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
AYK90910.1|1878057_1878219_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
AYK90911.1|1878215_1878935_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	1.6e-18
AYK90912.1|1878927_1880238_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
AYK93068.1|1880227_1881388_+	insulinase family protein	NA	NA	NA	NA	NA
AYK90913.1|1881392_1882673_+	insulinase family protein	NA	NA	NA	NA	NA
AYK90914.1|1882669_1883371_+|bacteriocin	bacteriocin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
AYK90915.1|1883376_1884753_-	YncE family protein	NA	NA	NA	NA	NA
AYK90916.1|1884791_1886147_-	YncE family protein	NA	NA	NA	NA	NA
AYK90917.1|1886376_1887522_+	transcriptional regulator	NA	A0A1P8CWN8	Bacillus_phage	43.5	1.7e-78
AYK90918.1|1887505_1887625_+	phosphatase RapF inhibitor	NA	NA	NA	NA	NA
AYK90919.1|1887722_1888280_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
AYK90920.1|1888214_1889087_-	agmatinase	NA	NA	NA	NA	NA
AYK90921.1|1889147_1889978_-	spermidine synthase	NA	NA	NA	NA	NA
AYK90922.1|1890179_1892255_+	penicillin-binding protein	NA	NA	NA	NA	NA
AYK90923.1|1892282_1892717_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90924.1|1892855_1893374_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90925.1|1893387_1894047_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AYK90926.1|1894155_1894344_+	2-hydroxymuconate tautomerase	NA	NA	NA	NA	NA
AYK90927.1|1894386_1894806_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYK90928.1|1894925_1896842_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	43.4	1.9e-143
>prophage 147
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1900204	1905879	4122398		Cafeteria_roenbergensis_virus(33.33%)	6	NA	NA
AYK90933.1|1900204_1901506_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
AYK90934.1|1901667_1901892_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
AYK90935.1|1902106_1902883_+	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
AYK90936.1|1903026_1903917_-	DMT family transporter	NA	NA	NA	NA	NA
AYK90937.1|1904085_1904931_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
AYK90938.1|1904979_1905879_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
>prophage 148
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1912790	1913552	4122398		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AYK93069.1|1912790_1913552_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	2.8e-21
>prophage 149
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1923665	1977193	4122398	coat,lysis,holin	Enterobacteria_phage(22.22%)	54	NA	NA
AYK90953.1|1923665_1924121_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK90954.1|1924113_1924965_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.9	1.3e-38
AYK90955.1|1924978_1925926_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
AYK90956.1|1925925_1926666_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	41.9	4.5e-48
AYK90957.1|1926690_1927710_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK90958.1|1927712_1928435_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK90959.1|1928427_1929549_-|coat	spore coat biosynthesis protein SpsE	coat	NA	NA	NA	NA
AYK90960.1|1929548_1930418_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK90961.1|1930418_1931588_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	28.1	1.2e-15
AYK90962.1|1931608_1933033_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
AYK90963.1|1933037_1933808_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	28.6	4.4e-06
AYK90964.1|1933800_1933980_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90965.1|1934127_1934673_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
AYK90966.1|1934716_1935088_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
AYK90967.1|1935149_1936472_-	purine permease	NA	NA	NA	NA	NA
AYK90968.1|1936491_1936809_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90969.1|1936976_1938347_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AYK90970.1|1938371_1939049_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	46.1	8.3e-49
AYK90971.1|1939062_1939869_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AYK90972.1|1940060_1940876_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AYK90973.1|1940966_1941215_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90974.1|1941308_1942748_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.8	3.7e-22
AYK90975.1|1942744_1944130_-	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
AYK90976.1|1944431_1945202_+	transporter	NA	NA	NA	NA	NA
AYK93070.1|1946111_1946414_-	hypothetical protein	NA	NA	NA	NA	NA
AYK90977.1|1946943_1949364_+	peptidase S8	NA	A0A217EQY2	Bacillus_phage	38.2	5.3e-21
AYK90978.1|1949401_1950403_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AYK90979.1|1950576_1951326_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
AYK90980.1|1951431_1952613_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
AYK90981.1|1952821_1953967_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK90982.1|1954195_1954459_+	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
AYK90983.1|1954500_1954875_-	quinol oxidase subunit 4	NA	NA	NA	NA	NA
AYK90984.1|1954876_1955491_-	Quinol oxidase subunit 3	NA	NA	NA	NA	NA
AYK90985.1|1955504_1957454_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AYK93071.1|1957481_1958447_-	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
AYK93072.1|1958962_1959208_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AYK90986.1|1959278_1960820_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
AYK90987.1|1960823_1961996_-	galactokinase	NA	NA	NA	NA	NA
AYK90988.1|1962073_1962457_-	GtrA family protein	NA	NA	NA	NA	NA
AYK90989.1|1962474_1963146_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYK90990.1|1964102_1964411_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
AYK90991.1|1964407_1965949_+	cation acetate symporter	NA	NA	NA	NA	NA
AYK90992.1|1965978_1966581_-	DsbA family protein	NA	NA	NA	NA	NA
AYK90993.1|1966863_1968114_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
AYK90994.1|1968132_1969290_-	Efem/EfeO family lipoprotein	NA	NA	NA	NA	NA
AYK90995.1|1969286_1970729_-	iron transporter	NA	NA	NA	NA	NA
AYK90996.1|1970885_1971554_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
AYK90997.1|1971550_1972369_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AYK90998.1|1972376_1973282_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYK90999.1|1973387_1973774_+|holin	holin-like protein CidA	holin	NA	NA	NA	NA
AYK91000.1|1973755_1974433_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
AYK91001.1|1974537_1975740_+	MFS transporter	NA	NA	NA	NA	NA
AYK91002.1|1975773_1975971_+	YwbE family protein	NA	NA	NA	NA	NA
AYK91003.1|1976005_1977193_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.0	1.2e-74
>prophage 150
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1984742	1985603	4122398		Tetraselmis_virus(100.0%)	1	NA	NA
AYK91009.1|1984742_1985603_-	glycosyltransferase family 8 protein	NA	A0A2P0VP84	Tetraselmis_virus	26.4	1.9e-05
>prophage 151
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	1990979	1996469	4122398	transposase	Shigella_phage(33.33%)	6	NA	NA
AYK91015.1|1990979_1992168_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	36.6	1.6e-31
AYK91016.1|1992224_1993160_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AYK91017.1|1993322_1993457_-	hypothetical protein	NA	NA	NA	NA	NA
AYK91018.1|1993606_1993756_+	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
AYK91019.1|1993773_1995285_+	D-alanine--poly(phosphoribitol) ligase subunit 1	NA	A0A2K9KZV5	Tupanvirus	29.6	1.6e-47
AYK91020.1|1995281_1996469_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.9	5.2e-22
>prophage 152
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2006494	2011101	4122398		Tupanvirus(50.0%)	4	NA	NA
AYK91031.1|2006494_2008138_+	catalase	NA	A0A2K9L572	Tupanvirus	45.2	1.4e-97
AYK91032.1|2008241_2009444_+	MFS transporter	NA	NA	NA	NA	NA
AYK91033.1|2009440_2010217_-	ABC transporter permease	NA	NA	NA	NA	NA
AYK91034.1|2010213_2011101_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.0	5.3e-27
>prophage 153
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2014860	2018288	4122398		Bacillus_phage(50.0%)	2	NA	NA
AYK91041.1|2014860_2016588_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	24.6	1.1e-23
AYK91042.1|2016584_2018288_-	thiol reductant ABC exporter subunit CydD	NA	A0A2H4UU96	Bodo_saltans_virus	20.5	2.4e-12
>prophage 154
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2025628	2031615	4122398		Planktothrix_phage(33.33%)	7	NA	NA
AYK91049.1|2025628_2026726_-	maltodextrin import ATP-binding protein MsmX	NA	G9BWD6	Planktothrix_phage	31.2	2.4e-21
AYK91050.1|2026846_2027740_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
AYK91051.1|2027923_2029381_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
AYK91052.1|2029422_2030259_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	33.6	1.0e-40
AYK91053.1|2030191_2030407_-	hypothetical protein	NA	NA	NA	NA	NA
AYK91054.1|2030423_2030618_-	hypothetical protein	NA	NA	NA	NA	NA
AYK91055.1|2030595_2031615_-	UDP-glucose 4-epimerase	NA	A0A2K9L1R4	Tupanvirus	51.7	3.8e-98
>prophage 155
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2037152	2039675	4122398		uncultured_virus(100.0%)	2	NA	NA
AYK91062.1|2037152_2038286_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	46.2	3.6e-89
AYK91063.1|2038538_2039675_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	45.8	1.5e-87
>prophage 156
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2047326	2049387	4122398		Tupanvirus(100.0%)	1	NA	NA
AYK91072.1|2047326_2049387_-	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	52.7	7.6e-154
>prophage 157
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2055171	2056611	4122398		Catovirus(100.0%)	1	NA	NA
AYK91079.1|2055171_2056611_-	ATP-dependent RNA helicase DbpA	NA	A0A1V0SBR7	Catovirus	34.1	2.9e-59
>prophage 158
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2089263	2092398	4122398		Paenibacillus_phage(100.0%)	1	NA	NA
AYK91107.1|2089263_2092398_+	DUF3427 domain-containing protein	NA	A0A2I7SC38	Paenibacillus_phage	25.3	2.4e-26
>prophage 159
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2099690	2100992	4122398		Geobacillus_virus(100.0%)	1	NA	NA
AYK91111.1|2099690_2100992_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	61.5	1.6e-133
>prophage 160
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2108710	2109460	4122398		Brazilian_cedratvirus(100.0%)	1	NA	NA
AYK91119.1|2108710_2109460_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.7	4.6e-16
>prophage 161
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2113255	2114242	4122398		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AYK91124.1|2113255_2114242_-	linear amide C-N hydrolase	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	30.4	8.2e-29
>prophage 162
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2135485	2198858	4122398	transposase,holin,bacteriocin	Bacillus_phage(25.0%)	58	NA	NA
AYK91145.1|2135485_2136610_-|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
AYK91146.1|2136903_2137659_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AYK91147.1|2137712_2138645_+	aldo/keto reductase	NA	NA	NA	NA	NA
AYK91148.1|2138874_2139189_+	DUF2628 domain-containing protein	NA	L7TIP7	Escherichia_phage	47.0	1.6e-10
AYK91149.1|2139292_2139763_-	hypothetical protein	NA	NA	NA	NA	NA
AYK91150.1|2140519_2141032_+	HPP family protein	NA	NA	NA	NA	NA
AYK91151.1|2142577_2144458_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	33.4	1.1e-93
AYK91152.1|2144625_2144877_-	hypothetical protein	NA	NA	NA	NA	NA
AYK91153.1|2146069_2146270_+	transcriptional regulator	NA	NA	NA	NA	NA
AYK91154.1|2146287_2146689_+	hypothetical protein	NA	NA	NA	NA	NA
AYK91155.1|2146892_2147111_-|bacteriocin	bacteriocin leader domain-containing protein	bacteriocin	NA	NA	NA	NA
AYK91156.1|2147155_2147377_-	hypothetical protein	NA	NA	NA	NA	NA
AYK91157.1|2147698_2148823_+|transposase	IS4 family transposase IS4Bsu1	transposase	NA	NA	NA	NA
AYK91158.1|2149100_2149355_+	hypothetical protein	NA	NA	NA	NA	NA
AYK91159.1|2149518_2151702_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	30.8	1.7e-50
AYK91160.1|2151702_2153172_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYK91161.1|2153273_2153462_+	hypothetical protein	NA	NA	NA	NA	NA
AYK91162.1|2153580_2154615_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AYK91163.1|2154708_2155284_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYK91164.1|2155414_2156485_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYK91165.1|2156543_2156975_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYK91166.1|2157201_2157606_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
AYK91167.1|2157575_2158268_+	LrgB family protein	NA	NA	NA	NA	NA
AYK91168.1|2158307_2159339_-	general stress protein 30	NA	NA	NA	NA	NA
AYK91169.1|2159431_2160580_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.3	1.4e-48
AYK91170.1|2160775_2161507_+	gluconate operon transcriptional regulator	NA	NA	NA	NA	NA
AYK91171.1|2161499_2163041_+	gluconokinase	NA	NA	NA	NA	NA
AYK91172.1|2163069_2164416_+	gluconate permease	NA	NA	NA	NA	NA
AYK91173.1|2164438_2165845_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	E3SJC4	Synechococcus_phage	30.6	1.7e-32
AYK91174.1|2166310_2166874_+	peroxiredoxin	NA	NA	NA	NA	NA
AYK91175.1|2166887_2168417_+	alkyl hydroperoxide reductase subunit F	NA	A0A1V0SIN1	Klosneuvirus	29.3	1.0e-33
AYK91176.1|2168527_2169967_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AYK91177.1|2170533_2171244_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYK91178.1|2171334_2172057_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
AYK91179.1|2172077_2172707_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
AYK91180.1|2173187_2175113_+	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
AYK91181.1|2175563_2175914_-	hypothetical protein	NA	NA	NA	NA	NA
AYK91182.1|2176394_2176835_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	34.4	3.4e-11
AYK91183.1|2176835_2177015_+	hypothetical protein	NA	NA	NA	NA	NA
AYK91184.1|2177254_2178013_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
AYK93075.1|2178009_2179557_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AYK91185.1|2179686_2180073_-	hypothetical protein	NA	NA	NA	NA	NA
AYK91186.1|2180484_2181948_+	hypothetical protein	NA	A0A0S2MYH0	Enterococcus_phage	36.0	1.0e-11
AYK91187.1|2182182_2184066_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	21.8	6.6e-19
AYK91188.1|2184046_2186080_-	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
AYK91189.1|2187137_2187455_+|transposase	transposase	transposase	NA	NA	NA	NA
AYK91190.1|2187451_2188366_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	4.0e-06
AYK91191.1|2188446_2188893_-	hypothetical protein	NA	A0A1P8CWQ3	Bacillus_phage	97.5	3.2e-57
AYK91192.1|2188877_2189156_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	100.0	7.3e-44
AYK93076.1|2189854_2190118_-	hypothetical protein	NA	NA	NA	NA	NA
AYK91193.1|2190501_2191416_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	4.0e-06
AYK91194.1|2191412_2191730_-|transposase	transposase	transposase	NA	NA	NA	NA
AYK91195.1|2191994_2195117_-	DEAD/DEAH box helicase	NA	A7WKM3	Acidianus_filamentous_virus	26.4	6.6e-08
AYK91196.1|2195073_2195982_-	hypothetical protein	NA	NA	NA	NA	NA
AYK91197.1|2196269_2196749_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AYK91198.1|2196829_2197000_-	CxxH/CxxC protein	NA	NA	NA	NA	NA
AYK91199.1|2197184_2197598_+	hypothetical protein	NA	NA	NA	NA	NA
AYK91200.1|2197631_2198858_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	29.3	1.1e-11
>prophage 163
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2202087	2207333	4122398		Klosneuvirus(66.67%)	5	NA	NA
AYK91206.1|2202087_2203185_+	transcriptional regulator	NA	D6R410	Bacillus_phage	39.3	6.0e-73
AYK91207.1|2203185_2203302_+	phosphatase RapG inhibitor	NA	NA	NA	NA	NA
AYK91208.1|2203538_2204429_-	arginase	NA	A0A1V0SJM8	Klosneuvirus	29.1	2.0e-26
AYK91209.1|2204501_2205905_-	amino-acid permease RocE	NA	NA	NA	NA	NA
AYK91210.1|2206127_2207333_-	ornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.5	2.0e-29
>prophage 164
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2210639	2224119	4122398	protease	Bacillus_phage(28.57%)	11	NA	NA
AYK93077.1|2210639_2210924_-	ArsR family transcriptional regulator	NA	A0A218MNF3	uncultured_virus	41.3	2.8e-06
AYK91215.1|2211150_2212536_+	arginine utilization regulatory protein RocR	NA	NA	NA	NA	NA
AYK91216.1|2212850_2214053_-|protease	serine protease	protease	W5SAB9	Pithovirus	40.4	5.9e-13
AYK91217.1|2214134_2214929_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.6	9.8e-41
AYK91218.1|2214950_2215793_-	two-component system YycFG regulatory protein	NA	NA	NA	NA	NA
AYK93078.1|2215779_2217147_-	hypothetical protein	NA	NA	NA	NA	NA
AYK91219.1|2217136_2218972_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.5	4.4e-36
AYK93079.1|2218979_2219687_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	41.2	3.4e-45
AYK91220.1|2220717_2222010_-	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	35.9	2.4e-68
AYK91221.1|2222215_2222635_-	VOC family protein	NA	NA	NA	NA	NA
AYK91222.1|2222754_2224119_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	54.8	3.6e-128
>prophage 165
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2242726	2245935	4122398		Streptococcus_phage(50.0%)	5	NA	NA
AYK91244.1|2242726_2243248_-	GNAT family N-acetyltransferase	NA	A0A1B0RXL7	Streptococcus_phage	47.8	7.3e-45
AYK91245.1|2243656_2244013_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AYK91246.1|2244172_2244739_+	dihydrofolate reductase	NA	NA	NA	NA	NA
AYK91247.1|2245009_2245195_+	DUF255 domain-containing protein	NA	NA	NA	NA	NA
AYK91248.1|2245485_2245935_-	transcriptional regulator	NA	A0A1P8CX48	Bacillus_phage	79.2	3.2e-65
>prophage 166
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2252594	2257856	4122398	protease	Cronobacter_phage(33.33%)	5	NA	NA
AYK91254.1|2252594_2253626_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	35.8	3.7e-24
AYK91255.1|2253603_2254878_+	MFS transporter	NA	NA	NA	NA	NA
AYK91256.1|2256231_2256990_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	46.3	2.1e-61
AYK91257.1|2257054_2257294_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
AYK91258.1|2257337_2257856_-	single-stranded DNA-binding protein A	NA	M5ABV5	Bacillus_phage	69.8	2.3e-51
>prophage 167
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2263351	2267201	4122398	protease	Bacillus_virus(25.0%)	5	NA	NA
AYK91264.1|2263351_2263969_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	32.7	2.0e-17
AYK91265.1|2264008_2264857_-	stage 0 sporulation protein J	NA	I3NLC2	Bifidobacterium_phage	38.9	2.0e-20
AYK91266.1|2264849_2265611_-	sporulation initiation inhibitor protein Soj	NA	Q8JL10	Natrialba_phage	31.1	6.5e-26
AYK91267.1|2265858_2266299_+	hypothetical protein	NA	NA	NA	NA	NA
AYK91268.1|2266349_2267201_-	nucleoid occlusion protein	NA	S5VTK0	Leptospira_phage	37.4	1.6e-17
>prophage 168
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2275996	2283517	4122398		Bacillus_virus(66.67%)	6	NA	NA
AYK91277.1|2275996_2277133_+	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	32.9	1.8e-16
AYK91278.1|2277263_2277479_+	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
AYK91279.1|2277494_2278607_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AYK91280.1|2278624_2278870_+	DUF370 domain-containing protein	NA	NA	NA	NA	NA
AYK91281.1|2278924_2280841_+	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	48.8	9.9e-156
AYK91282.1|2281051_2283517_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	36.9	7.1e-114
>prophage 169
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2289907	2297762	4122398	tRNA	Klosneuvirus(20.0%)	7	NA	NA
AYK91284.1|2289907_2291374_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.7	5.5e-98
AYK91285.1|2291526_2292858_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	28.4	5.7e-25
AYK91286.1|2293054_2293939_+	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
AYK91287.1|2293960_2294551_+	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
AYK91288.1|2294872_2296150_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.9	1.3e-95
AYK91289.1|2296488_2297142_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	33.5	3.7e-22
AYK91290.1|2297138_2297762_-	deoxynucleoside kinase	NA	A0A1G5SAJ8	Enterococcus_phage	24.3	9.1e-10
>prophage 170
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2300806	2302498	4122398		Bacteriophage(100.0%)	1	NA	NA
AYK91293.1|2300806_2302498_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	35.5	5.1e-55
>prophage 171
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2310395	2323861	4122398	tRNA	Streptococcus_phage(42.86%)	15	NA	NA
AYK91300.1|2310395_2311556_+	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	31.0	4.8e-36
AYK91301.1|2311637_2313080_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AYK91302.1|2313076_2313715_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	55.9	4.1e-58
AYK91303.1|2313788_2314118_+	hypothetical protein	NA	NA	NA	NA	NA
AYK91304.1|2314130_2314571_+	DUF327 family protein	NA	NA	NA	NA	NA
AYK91305.1|2314582_2315572_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.1	1.1e-33
AYK91306.1|2315574_2316402_+	stage 0 sporulation protein YaaT	NA	NA	NA	NA	NA
AYK91307.1|2316416_2316776_+	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
AYK91308.1|2316834_2317578_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYK91309.1|2317564_2317864_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
AYK91310.1|2317838_2318717_+	rRNA (cytidine-2'-O-)-methyltransferase	NA	M1PLC5	Streptococcus_phage	48.3	2.7e-68
AYK91311.1|2318765_2319056_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	54.3	8.0e-17
AYK91312.1|2319550_2321545_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	5.2e-99
AYK91313.1|2321624_2322392_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
AYK91314.1|2322547_2323861_+	DUF348 domain-containing protein	NA	U5PSR6	Bacillus_phage	66.7	8.9e-31
>prophage 172
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2330271	2332618	4122398		Tupanvirus(100.0%)	2	NA	NA
AYK91323.1|2330271_2331642_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	34.8	3.8e-32
AYK91324.1|2331664_2332618_+	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	35.9	3.0e-44
>prophage 173
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2338018	2338555	4122398		Paenibacillus_phage(100.0%)	1	NA	NA
AYK91329.1|2338018_2338555_+	stage V sporulation protein T	NA	A0A2I7SC16	Paenibacillus_phage	70.6	4.2e-11
>prophage 174
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2350903	2358794	4122398	protease	Micromonas_pusilla_virus(25.0%)	7	NA	NA
AYK91341.1|2350903_2352817_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	42.0	1.1e-114
AYK91342.1|2353011_2353788_+	type III pantothenate kinase	NA	NA	NA	NA	NA
AYK91343.1|2353799_2354675_+	redox-regulated molecular chaperone HslO	NA	NA	NA	NA	NA
AYK91344.1|2354721_2355615_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AYK91345.1|2355690_2356617_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.2	5.2e-110
AYK91346.1|2356783_2358196_+	anthranilate synthase component I family protein	NA	S4VT78	Pandoravirus	31.2	2.9e-35
AYK91347.1|2358209_2358794_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	58.5	9.3e-65
>prophage 175
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2362646	2364146	4122398	tRNA	Tupanvirus(100.0%)	1	NA	NA
AYK91354.1|2362646_2364146_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	39.4	6.2e-97
>prophage 176
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2377574	2380007	4122398	protease	Enterobacteria_phage(100.0%)	1	NA	NA
AYK91358.1|2377574_2380007_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpC	protease	H6X3M6	Enterobacteria_phage	35.4	1.1e-132
>prophage 177
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2387452	2388853	4122398	tRNA	Catovirus(100.0%)	1	NA	NA
AYK91367.1|2387452_2388853_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.4	6.1e-62
>prophage 178
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2391892	2392426	4122398		Bacillus_virus(100.0%)	1	NA	NA
AYK91374.1|2391892_2392426_+	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	30.8	9.2e-11
>prophage 179
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2395921	2406765	4122398		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
AYK91380.1|2395921_2399503_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.7	1.2e-48
AYK91381.1|2399564_2403164_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	25.1	2.8e-66
AYK91382.1|2403342_2403591_+	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
AYK91383.1|2403704_2404121_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
AYK91384.1|2404162_2404633_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
AYK91385.1|2404686_2406765_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.2	5.7e-64
>prophage 180
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2424446	2426137	4122398		Planktothrix_phage(50.0%)	2	NA	NA
AYK91418.1|2424446_2425292_+	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	30.5	2.0e-20
AYK91419.1|2425267_2426137_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	4.0e-11
>prophage 181
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2430609	2431323	4122398		Bacillus_phage(100.0%)	1	NA	NA
AYK91427.1|2430609_2431323_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N6W8I1	Bacillus_phage	30.5	4.8e-15
>prophage 182
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2450919	2452356	4122398		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYK91432.1|2450919_2452356_+	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.5	1.0e-141
>prophage 183
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2474112	2478707	4122398		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
AYK91453.1|2474112_2475915_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	39.8	4.1e-103
AYK91454.1|2475961_2476102_+	hypothetical protein	NA	NA	NA	NA	NA
AYK91455.1|2477545_2478181_+	bifunctional transcriptional activator/DNA repair protein AdaA	NA	NA	NA	NA	NA
AYK91456.1|2478167_2478707_+	methylated-DNA--protein-cysteine methyltransferase inducible	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	46.7	5.3e-22
>prophage 184
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2486466	2487237	4122398		Orpheovirus(100.0%)	1	NA	NA
AYK91463.1|2486466_2487237_-	serine/threonine protein kinase	NA	A0A2I2L4H4	Orpheovirus	32.7	1.9e-09
>prophage 185
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2496247	2497129	4122398		Staphylococcus_phage(100.0%)	1	NA	NA
AYK91471.1|2496247_2497129_-	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	39.3	9.8e-42
>prophage 186
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2508694	2511004	4122398	holin	Geobacillus_phage(50.0%)	2	NA	NA
AYK91481.1|2508694_2508937_+|holin	phage holin	holin	W8ECW0	Geobacillus_phage	57.1	3.5e-18
AYK91482.1|2509333_2511004_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A172JIA8	Bacillus_phage	44.4	6.0e-32
>prophage 187
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2524176	2526072	4122398		Vibrio_phage(100.0%)	1	NA	NA
AYK91496.1|2524176_2526072_-	PTS glucose transporter subunit IICBA	NA	A0A2I7SAJ6	Vibrio_phage	42.3	4.0e-08
>prophage 188
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2547639	2550273	4122398		Bacillus_phage(50.0%)	2	NA	NA
AYK93087.1|2547639_2548320_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.2	9.3e-32
AYK91515.1|2549349_2550273_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.0	7.9e-42
>prophage 189
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2555310	2556039	4122398		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AYK91522.1|2555310_2556039_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	25.0	5.8e-16
>prophage 190
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2573044	2589689	4122398	transposase	Caulobacter_phage(33.33%)	14	NA	NA
AYK91536.1|2573044_2573548_-	M15 family peptidase	NA	A0A2H4J4U2	uncultured_Caudovirales_phage	50.8	3.8e-30
AYK91537.1|2574899_2575676_+	glucose 1-dehydrogenase	NA	A0A0G2Y8L6	Acanthamoeba_polyphaga_mimivirus	32.6	2.6e-06
AYK91538.1|2575699_2577385_+	alpha-glucosidase	NA	NA	NA	NA	NA
AYK91539.1|2577571_2578531_+	zinc uptake system-binding-protein ZnuA	NA	NA	NA	NA	NA
AYK91540.1|2578585_2579281_+	zinc uptake system ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.1	3.5e-18
AYK91541.1|2579238_2580081_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AYK91542.1|2580218_2581571_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
AYK91543.1|2582978_2583578_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	31.0	3.1e-23
AYK91544.1|2583599_2584181_+	general stress protein 16U	NA	K4JRX3	Caulobacter_phage	41.7	6.7e-31
AYK91545.1|2584215_2584794_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	38.8	1.3e-29
AYK91546.1|2584845_2585619_+	DUF475 domain-containing protein	NA	A0A068EP98	Bacillus_phage	64.6	8.5e-82
AYK91547.1|2585702_2587316_+	hypothetical protein	NA	NA	NA	NA	NA
AYK91548.1|2587331_2588423_+	toxic anion resistance protein	NA	NA	NA	NA	NA
AYK91549.1|2588539_2589689_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
>prophage 191
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2593053	2594310	4122398		Bacillus_virus(100.0%)	1	NA	NA
AYK91553.1|2593053_2594310_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	41.1	3.1e-33
>prophage 192
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2607681	2608500	4122398		Bacillus_virus(100.0%)	1	NA	NA
AYK91561.1|2607681_2608500_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	61.1	1.6e-91
>prophage 193
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2614282	2616165	4122398		Pseudomonas_phage(50.0%)	2	NA	NA
AYK91567.1|2614282_2615065_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	44.9	1.7e-45
AYK93093.1|2615253_2616165_+	Proline dehydrogenase 2	NA	A0A2H4PQT6	Staphylococcus_phage	42.6	1.6e-66
>prophage 194
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2623555	2624566	4122398		Tupanvirus(100.0%)	1	NA	NA
AYK91574.1|2623555_2624566_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K9L4X0	Tupanvirus	27.4	1.9e-17
>prophage 195
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2628999	2631132	4122398		Escherichia_phage(100.0%)	1	NA	NA
AYK91578.1|2628999_2631132_-	assimilatory nitrate reductase catalytic subunit	NA	A0A077SK27	Escherichia_phage	22.9	1.1e-17
>prophage 196
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2642467	2644812	4122398		Pandoravirus(50.0%)	3	NA	NA
AYK91589.1|2642467_2643901_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	30.5	9.3e-50
AYK91590.1|2643937_2644336_-	peptidase S24	NA	NA	NA	NA	NA
AYK91591.1|2644362_2644812_-	DNA-entry nuclease	NA	F8WPS9	Bacillus_phage	67.8	2.9e-42
>prophage 197
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2649170	2659934	4122398		Tupanvirus(100.0%)	1	NA	NA
AYK91595.1|2649170_2659934_+	surfactin non-ribosomal peptide synthetase SrfAA	NA	A0A2K9KZV5	Tupanvirus	26.8	8.6e-164
>prophage 198
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2670735	2674563	4122398		Tupanvirus(100.0%)	1	NA	NA
AYK91596.1|2670735_2674563_+	surfactin non-ribosomal peptide synthetase SrfAC	NA	A0A2K9KZV5	Tupanvirus	26.4	2.2e-90
>prophage 199
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2678335	2682155	4122398		Streptococcus_phage(50.0%)	4	NA	NA
AYK91601.1|2678335_2679670_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	37.9	1.0e-66
AYK91602.1|2679664_2680339_-	4'-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
AYK91603.1|2680443_2681091_-	YitT family protein	NA	NA	NA	NA	NA
AYK91604.1|2681411_2682155_-	polar amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	5.4e-33
>prophage 200
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2688437	2691940	4122398		Acinetobacter_phage(50.0%)	2	NA	NA
AYK91612.1|2688437_2689916_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	38.6	2.1e-81
AYK91613.1|2690185_2691940_+	hypothetical protein	NA	U5PSS0	Bacillus_phage	41.5	9.8e-126
>prophage 201
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2696399	2707210	4122398		Bacillus_phage(50.0%)	12	NA	NA
AYK91618.1|2696399_2697080_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	26.4	7.4e-05
AYK91619.1|2697095_2698556_-	ABC transporter permease	NA	NA	NA	NA	NA
AYK93095.1|2698768_2699452_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	40.4	3.6e-44
AYK91620.1|2699438_2700860_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	35.0	6.0e-41
AYK91621.1|2701022_2702171_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	44.6	2.2e-78
AYK91622.1|2702154_2702277_+	phosphatase RapC inhibitor	NA	NA	NA	NA	NA
AYK91623.1|2702375_2702465_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
AYK91624.1|2702546_2702660_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
AYK91625.1|2702812_2704177_-	aspartate kinase	NA	NA	NA	NA	NA
AYK91626.1|2704567_2705518_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	54.8	2.4e-94
AYK91627.1|2705510_2706458_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AYK91628.1|2706451_2707210_+	ATP-binding cassette domain-containing protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	30.6	1.5e-19
>prophage 202
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2714928	2719487	4122398		Klosneuvirus(50.0%)	4	NA	NA
AYK91636.1|2714928_2716239_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	24.2	8.9e-23
AYK91637.1|2716307_2717696_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYK91638.1|2717818_2718682_+	glucose uptake protein GlcU	NA	NA	NA	NA	NA
AYK91639.1|2718701_2719487_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.3	2.2e-24
>prophage 203
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2742787	2745930	4122398		Staphylococcus_phage(50.0%)	3	NA	NA
AYK91662.1|2742787_2744299_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.5	9.9e-42
AYK93099.1|2744318_2744864_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYK91663.1|2745069_2745930_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	45.3	2.8e-57
>prophage 204
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2749921	2754458	4122398		Streptococcus_phage(33.33%)	3	NA	NA
AYK91670.1|2749921_2752105_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.0	9.2e-41
AYK91671.1|2752217_2752667_+	NUDIX hydrolase	NA	E5EYY7	Acinetobacter_phage	50.0	8.3e-05
AYK91672.1|2752733_2754458_+	pyruvate oxidase	NA	G8DDL3	Micromonas_pusilla_virus	25.8	1.2e-35
>prophage 205
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2769214	2770141	4122398		Staphylococcus_phage(100.0%)	1	NA	NA
AYK91691.1|2769214_2770141_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.0	5.9e-37
>prophage 206
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2774059	2774380	4122398		Staphylococcus_phage(100.0%)	1	NA	NA
AYK91698.1|2774059_2774380_-	thiol reductase thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	33.3	2.2e-07
>prophage 207
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2777463	2778948	4122398		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AYK91700.1|2777463_2778948_+	ATP-dependent RNA helicase CshA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.3	7.6e-63
>prophage 208
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2785179	2785530	4122398		Lactobacillus_phage(100.0%)	1	NA	NA
AYK91707.1|2785179_2785530_+	mRNA interferase EndoA	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	5.8e-14
>prophage 209
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2789106	2789895	4122398		Bacillus_phage(100.0%)	1	NA	NA
AYK91714.1|2789106_2789895_+	RNA polymerase sigma factor SigB	NA	A0A0Y0AU18	Bacillus_phage	35.2	2.2e-24
>prophage 210
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2794372	2802602	4122398	integrase	Listeria_phage(33.33%)	12	2788665:2788680	2810774:2810789
2788665:2788680	attL	AATAATGCTGATTACA	NA	NA	NA	NA
AYK91722.1|2794372_2794825_+	SprT family protein	NA	U5J9G1	Bacillus_phage	29.8	3.8e-05
AYK91723.1|2795756_2796863_-|integrase	site-specific integrase	integrase	A0A0A8WF08	Clostridium_phage	34.2	4.8e-38
AYK91724.1|2796875_2797385_-	metallopeptidase ImmA	NA	NA	NA	NA	NA
AYK91725.1|2797381_2797765_-	XRE family transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	36.9	1.2e-12
AYK91726.1|2798038_2798233_+	ICEBs1 excisionase	NA	NA	NA	NA	NA
AYK91727.1|2798229_2798490_+	hypothetical protein	NA	NA	NA	NA	NA
AYK91728.1|2798543_2798804_+	hypothetical protein	NA	NA	NA	NA	NA
AYK91729.1|2799006_2799135_+	hypothetical protein	NA	NA	NA	NA	NA
AYK91730.1|2799170_2799551_+	DUF961 domain-containing protein	NA	NA	NA	NA	NA
AYK91731.1|2799586_2801029_+	Ftsk domain-containing protein YdcQ	NA	A0A1S5SFB5	Streptococcus_phage	50.9	4.3e-119
AYK91732.1|2801021_2802080_+	DNA relaxase NicK	NA	A0A1S5SEX3	Streptococcus_phage	40.6	1.6e-62
AYK91733.1|2802350_2802602_+	DUF3850 domain-containing protein	NA	A0A059T699	Listeria_phage	55.7	6.9e-17
2810774:2810789	attR	TGTAATCAGCATTATT	NA	NA	NA	NA
>prophage 211
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2811236	2814580	4122398		Streptococcus_phage(50.0%)	4	NA	NA
AYK91744.1|2811236_2812226_+	endopeptidase	NA	A0A1S5SEZ8	Streptococcus_phage	43.2	5.4e-65
AYK91745.1|2812240_2812747_+	hypothetical protein	NA	NA	NA	NA	NA
AYK93102.1|2812809_2813190_+	DUF4467 domain-containing protein	NA	NA	NA	NA	NA
AYK91746.1|2813404_2814580_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	34.2	3.2e-56
>prophage 212
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2823799	2830309	4122398		Bacillus_phage(66.67%)	8	NA	NA
AYK91755.1|2823799_2825521_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	56.8	2.5e-134
AYK93104.1|2826001_2826235_+	transcriptional regulator	NA	NA	NA	NA	NA
AYK91756.1|2826231_2826585_+	DUF2178 domain-containing protein	NA	NA	NA	NA	NA
AYK91757.1|2827405_2827582_+	hypothetical protein	NA	NA	NA	NA	NA
AYK91758.1|2827606_2828293_+	hypothetical protein	NA	O64048	Bacillus_phage	98.2	2.7e-124
AYK91759.1|2828717_2828903_+	hypothetical protein	NA	NA	NA	NA	NA
AYK91760.1|2829252_2829846_+	glutamine amidotransferase	NA	NA	NA	NA	NA
AYK91761.1|2830108_2830309_+	cold shock protein CspC	NA	Q9AZD3	Lactococcus_phage	75.8	9.6e-22
>prophage 213
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2835249	2836134	4122398		Streptococcus_phage(100.0%)	1	NA	NA
AYK91765.1|2835249_2836134_-	AraC family transcriptional regulator	NA	D0R0F8	Streptococcus_phage	32.6	1.3e-33
>prophage 214
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2847993	2851095	4122398		Streptococcus_phage(50.0%)	3	NA	NA
AYK91775.1|2847993_2848866_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	33.0	8.2e-33
AYK91776.1|2849439_2849775_+	transcriptional regulator	NA	NA	NA	NA	NA
AYK91777.1|2849787_2851095_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	67.1	7.5e-155
>prophage 215
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2860366	2861008	4122398		Feldmannia_irregularis_virus(100.0%)	1	NA	NA
AYK91788.1|2860366_2861008_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.5	5.7e-07
>prophage 216
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2870615	2871968	4122398	transposase	Streptococcus_phage(100.0%)	1	NA	NA
AYK91798.1|2870615_2871968_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 217
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2877673	2879320	4122398		Streptococcus_phage(100.0%)	1	NA	NA
AYK91808.1|2877673_2879320_-	ABC transporter ATP-binding protein	NA	Q6DMX7	Streptococcus_phage	32.3	4.2e-54
>prophage 218
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2885133	2885763	4122398		Clostridioides_phage(100.0%)	1	NA	NA
AYK91813.1|2885133_2885763_-	nitroreductase family protein	NA	A0A1V0E011	Clostridioides_phage	53.1	6.2e-06
>prophage 219
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2891041	2892229	4122398		Lambdina_fiscellaria_nucleopolyhedrovirus(100.0%)	1	NA	NA
AYK91818.1|2891041_2892229_+	UDP-glucosyltransferase	NA	A0A0E3URP0	Lambdina_fiscellaria_nucleopolyhedrovirus	29.1	2.3e-09
>prophage 220
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2901531	2902929	4122398		Pandoravirus(100.0%)	1	NA	NA
AYK91827.1|2901531_2902929_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.1	2.1e-46
>prophage 221
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2915830	2924628	4122398	tRNA,protease	uncultured_virus(40.0%)	12	NA	NA
AYK91835.1|2915830_2916871_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.9	8.8e-66
AYK91836.1|2916954_2917158_+	hypothetical protein	NA	NA	NA	NA	NA
AYK91837.1|2917096_2919025_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	5.3e-56
AYK91838.1|2919150_2919663_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
AYK91839.1|2919659_2920307_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
AYK91840.1|2920328_2920502_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
AYK91841.1|2920508_2921273_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.8	1.5e-22
AYK91842.1|2921238_2921445_+	hypothetical protein	NA	NA	NA	NA	NA
AYK91843.1|2921504_2921696_-	lipoprotein	NA	NA	NA	NA	NA
AYK91844.1|2921692_2922427_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYK91845.1|2922665_2922950_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	51.6	2.2e-19
AYK91846.1|2922996_2924628_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.7	3.7e-159
>prophage 222
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2943981	2946700	4122398	transposase	Staphylococcus_phage(50.0%)	4	NA	NA
AYK91861.1|2943981_2945132_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
AYK91862.1|2945244_2945403_-	hypothetical protein	NA	NA	NA	NA	NA
AYK91863.1|2945592_2945802_-	hypothetical protein	NA	NA	NA	NA	NA
AYK91864.1|2945884_2946700_-	alpha/beta hydrolase	NA	H9NCP0	Mycobacterium_phage	30.8	2.4e-10
>prophage 223
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2956874	2975525	4122398		Synechococcus_phage(30.0%)	18	NA	NA
AYK93109.1|2956874_2958416_+	GMP synthase (glutamine-hydrolyzing)	NA	A0A1V0SH76	Hokovirus	30.5	5.7e-21
AYK91872.1|2958647_2959427_+	hypothetical protein	NA	NA	NA	NA	NA
AYK91873.1|2960054_2961377_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.2	5.2e-39
AYK91874.1|2961587_2962391_+	hypothetical protein	NA	NA	NA	NA	NA
AYK91875.1|2962549_2962717_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
AYK91876.1|2962930_2963485_+	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
AYK91877.1|2963484_2963682_+	NETI motif-containing protein	NA	NA	NA	NA	NA
AYK91878.1|2964004_2964493_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.9	8.7e-24
AYK91879.1|2964485_2965628_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AYK91880.1|2965624_2966920_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	5.9e-19
AYK91881.1|2966993_2967719_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	1.2e-45
AYK91882.1|2967711_2967966_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AYK91883.1|2967962_2968646_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AYK91884.1|2968629_2970858_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	3.8e-159
AYK91885.1|2970833_2972264_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
AYK91886.1|2972365_2973406_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	1.7e-64
AYK91887.1|2973402_2973990_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	2.4e-28
AYK91888.1|2973986_2975525_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.6	3.0e-78
>prophage 224
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2984763	2993418	4122398	transposase	Bacillus_phage(25.0%)	6	NA	NA
AYK91897.1|2984763_2986983_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.9	3.2e-134
AYK91898.1|2987006_2989013_+	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.3	3.1e-128
AYK91899.1|2989028_2990219_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
AYK91900.1|2990335_2991485_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
AYK91901.1|2991671_2992682_+	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
AYK91902.1|2992719_2993418_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.9	2.7e-18
>prophage 225
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	2999639	3005546	4122398		Leptospira_phage(33.33%)	3	NA	NA
AYK91908.1|2999639_3002798_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.5	5.0e-64
AYK91909.1|3002948_3003860_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	29.7	1.2e-21
AYK91910.1|3004169_3005546_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	46.6	3.6e-115
>prophage 226
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3012030	3016547	4122398		Bacillus_phage(100.0%)	2	NA	NA
AYK91915.1|3012030_3014040_-	TIGR01741 family protein	NA	A0A1P8CWI7	Bacillus_phage	57.4	3.7e-145
AYK91916.1|3015416_3016547_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	45.9	9.8e-87
>prophage 227
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3022027	3023761	4122398		Enterobacteria_phage(100.0%)	1	NA	NA
AYK91926.1|3022027_3023761_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.5	6.9e-23
>prophage 228
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3052552	3064214	4122398	transposase	uncultured_Caudovirales_phage(20.0%)	8	NA	NA
AYK91950.1|3052552_3054025_+	hypothetical protein	NA	A0A2H4JCX8	uncultured_Caudovirales_phage	34.0	3.2e-05
AYK91951.1|3054111_3055359_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
AYK91952.1|3055468_3056542_-	DUF3900 domain-containing protein	NA	NA	NA	NA	NA
AYK91953.1|3056686_3059872_+	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	37.5	3.0e-80
AYK91954.1|3060005_3060320_-	hypothetical protein	NA	NA	NA	NA	NA
AYK93110.1|3060318_3062238_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	43.5	1.0e-128
AYK91955.1|3062474_3063239_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYK91956.1|3063245_3064214_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	29.3	1.1e-30
>prophage 229
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3072567	3082437	4122398	transposase	uncultured_Caudovirales_phage(20.0%)	8	NA	NA
AYK91964.1|3072567_3073428_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.0	2.2e-09
AYK91965.1|3073562_3075452_+	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	31.9	6.1e-41
AYK91966.1|3075574_3076021_+	hypothetical protein	NA	NA	NA	NA	NA
AYK91967.1|3076145_3076568_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AYK91968.1|3076633_3077824_+	multidrug efflux protein YfmO	NA	NA	NA	NA	NA
AYK91969.1|3078361_3079511_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
AYK91970.1|3079577_3081134_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	9.5e-56
AYK91971.1|3081306_3082437_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	30.9	2.8e-41
>prophage 230
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3093645	3093783	4122398		Bacillus_virus(100.0%)	1	NA	NA
AYK91982.1|3093645_3093783_-	DUF2639 domain-containing protein	NA	G3MBD1	Bacillus_virus	58.1	1.1e-05
>prophage 231
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3096899	3098849	4122398		Streptococcus_phage(100.0%)	1	NA	NA
AYK91986.1|3096899_3098849_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	43.2	2.2e-134
>prophage 232
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3111946	3113096	4122398	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
AYK91997.1|3111946_3113096_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
>prophage 233
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3126275	3127676	4122398		Erysipelothrix_phage(100.0%)	1	NA	NA
AYK92013.1|3126275_3127676_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	39.6	2.9e-88
>prophage 234
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3138724	3139051	4122398		uncultured_virus(100.0%)	1	NA	NA
AYK92024.1|3138724_3139051_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	41.5	1.6e-13
>prophage 235
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3146802	3153080	4122398		Bacillus_phage(100.0%)	3	NA	NA
AYK92032.1|3146802_3149136_+	peptidase G2	NA	Q9ZXE2	Bacillus_phage	38.1	7.9e-131
AYK92033.1|3149550_3151272_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	1.1e-52
AYK92034.1|3151265_3153080_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.6	1.7e-56
>prophage 236
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3169640	3170177	4122398		Paenibacillus_phage(100.0%)	1	NA	NA
AYK92049.1|3169640_3170177_+	putative metal-dependent hydrolase	NA	D0R7I3	Paenibacillus_phage	46.0	2.9e-20
>prophage 237
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3185443	3187524	4122398		Mycobacterium_phage(50.0%)	2	NA	NA
AYK92066.1|3185443_3186304_+	alpha/beta hydrolase	NA	A0A0S2MV32	Mycobacterium_phage	27.4	5.0e-06
AYK92067.1|3186534_3187524_+	glycosyltransferase	NA	V5USA4	Oenococcus_phage	42.4	1.5e-59
>prophage 238
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3195066	3196809	4122398		Bacillus_phage(100.0%)	1	NA	NA
AYK92076.1|3195066_3196809_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	1.5e-46
>prophage 239
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3214132	3216758	4122398		Tupanvirus(50.0%)	2	NA	NA
AYK92089.1|3214132_3215584_-	catalase	NA	A0A2K9L0T1	Tupanvirus	41.3	9.0e-109
AYK92090.1|3215990_3216758_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.9	5.5e-33
>prophage 240
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3227749	3231003	4122398		Thermus_phage(50.0%)	2	NA	NA
AYK92104.1|3227749_3229645_+	protein PrkA	NA	A0MN77	Thermus_phage	36.5	1.4e-101
AYK92105.1|3229824_3231003_+	sporulation protein YhbH	NA	X2JIL8	Bacillus_phage	45.3	6.5e-25
>prophage 241
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3236197	3250530	4122398	integrase	Bacillus_phage(37.5%)	19	3232073:3232089	3253148:3253164
3232073:3232089	attL	AGAAACAGATATTGCGG	NA	NA	NA	NA
AYK92114.1|3236197_3236896_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	1.8e-22
AYK92115.1|3236912_3237830_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.0	1.6e-39
AYK92116.1|3237822_3238764_+	ABC transporter permease	NA	NA	NA	NA	NA
AYK92117.1|3238855_3239059_-	cold-shock protein CspB	NA	Q9AZD3	Lactococcus_phage	61.5	1.2e-16
AYK92118.1|3239057_3239264_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92119.1|3239494_3240325_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYK92120.1|3240327_3241407_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.0	5.8e-20
AYK92121.1|3241579_3242971_+	L-cystine uptake protein TcyP	NA	NA	NA	NA	NA
AYK92122.1|3243297_3244917_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	61.3	7.8e-77
AYK92123.1|3244928_3245345_+	hypothetical protein	NA	A0A2H4J4V0	uncultured_Caudovirales_phage	44.3	7.9e-26
AYK92124.1|3245392_3246022_-	hypothetical protein	NA	NA	NA	NA	NA
AYK92125.1|3246133_3246616_-	hypothetical protein	NA	NA	NA	NA	NA
AYK92126.1|3246694_3246904_-	hypothetical protein	NA	NA	NA	NA	NA
AYK92127.1|3247030_3247735_-|integrase	site-specific integrase	integrase	A0A0A8WF08	Clostridium_phage	33.6	1.6e-23
AYK92128.1|3247861_3247999_+	Replication initiation factor	NA	NA	NA	NA	NA
AYK92129.1|3248217_3249114_-	hypothetical protein	NA	NA	NA	NA	NA
AYK92130.1|3249270_3249570_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92131.1|3249746_3250130_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92132.1|3250227_3250530_+	hypothetical protein	NA	A0A172JIG2	Bacillus_phage	63.4	4.1e-16
3253148:3253164	attR	AGAAACAGATATTGCGG	NA	NA	NA	NA
>prophage 242
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3258198	3262505	4122398		Streptococcus_phage(50.0%)	5	NA	NA
AYK92138.1|3258198_3259188_+	endopeptidase	NA	A0A1S5SEZ8	Streptococcus_phage	41.9	1.6e-64
AYK92139.1|3259202_3259709_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92140.1|3259771_3260155_+	cystatin-like fold lipoprotein	NA	NA	NA	NA	NA
AYK92141.1|3260252_3261041_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
AYK92142.1|3261332_3262505_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	34.3	2.1e-52
>prophage 243
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3269944	3272708	4122398		Bodo_saltans_virus(33.33%)	4	NA	NA
AYK92147.1|3269944_3270853_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	25.3	1.1e-06
AYK92148.1|3270963_3271359_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92149.1|3271495_3271918_+	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	35.0	6.0e-13
AYK92150.1|3272045_3272708_+	HAD family hydrolase	NA	A0A1D8KNV9	Synechococcus_phage	26.6	5.9e-07
>prophage 244
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3276819	3277644	4122398		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AYK92154.1|3276819_3277644_+	aquaporin family protein	NA	M1IAZ4	Acanthocystis_turfacea_Chlorella_virus	34.6	1.1e-31
>prophage 245
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3281092	3282838	4122398		Streptococcus_phage(100.0%)	1	NA	NA
AYK92157.1|3281092_3282838_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	49.3	5.5e-161
>prophage 246
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3286113	3287574	4122398		Clostridioides_phage(100.0%)	1	NA	NA
AYK92163.1|3286113_3287574_-	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	41.7	3.8e-14
>prophage 247
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3293312	3297415	4122398		Bacillus_virus(50.0%)	4	NA	NA
AYK92168.1|3293312_3294317_+	peptidoglycan endopeptidase LytE	NA	M1HNA7	Bacillus_virus	43.8	3.4e-14
AYK92169.1|3294387_3295263_-	transcriptional regulator	NA	NA	NA	NA	NA
AYK92170.1|3295371_3296472_+	citrate synthase/methylcitrate synthase	NA	NA	NA	NA	NA
AYK92171.1|3296545_3297415_+	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	45.1	3.3e-58
>prophage 248
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3311623	3315154	4122398		Staphylococcus_phage(33.33%)	5	NA	NA
AYK92184.1|3311623_3312019_-	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	36.5	8.9e-11
AYK92185.1|3312005_3312737_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	29.5	5.9e-16
AYK92186.1|3312970_3313078_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92187.1|3313225_3314341_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AYK92188.1|3314410_3315154_+	NAD-dependent protein deacylase	NA	A0A068EPD4	Bacillus_phage	31.2	1.4e-20
>prophage 249
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3319634	3326216	4122398	transposase	Bacillus_phage(75.0%)	6	NA	NA
AYK92194.1|3319634_3321392_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.9	5.9e-54
AYK92195.1|3321388_3323410_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	5.9e-42
AYK92196.1|3323459_3324080_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYK92197.1|3324118_3324244_-	hypothetical protein	NA	NA	NA	NA	NA
AYK92198.1|3324348_3324552_-	small, acid-soluble spore protein B	NA	Q77YX0	Bacillus_phage	76.6	4.5e-19
AYK92199.1|3324863_3326216_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 250
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3330644	3330998	4122398		Streptococcus_phage(100.0%)	1	NA	NA
AYK92204.1|3330644_3330998_+	YlbF family regulator	NA	A0A1X9I5Y8	Streptococcus_phage	27.9	4.5e-06
>prophage 251
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3338487	3339384	4122398		Staphylococcus_phage(100.0%)	1	NA	NA
AYK92211.1|3338487_3339384_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.7e-25
>prophage 252
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3351190	3354085	4122398		Streptococcus_phage(50.0%)	3	NA	NA
AYK92225.1|3351190_3352270_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	44.7	1.8e-82
AYK92226.1|3352416_3352854_-	HIT family protein	NA	NA	NA	NA	NA
AYK92227.1|3353341_3354085_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	9.2e-25
>prophage 253
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3376888	3381477	4122398		Staphylococcus_phage(50.0%)	4	NA	NA
AYK92249.1|3376888_3378430_+	fatty acid--CoA ligase family protein	NA	A0A2H4PQM9	Staphylococcus_phage	28.0	1.7e-44
AYK92250.1|3378468_3378864_-	hypothetical protein	NA	NA	NA	NA	NA
AYK92251.1|3379012_3380293_+	M48 family peptidase	NA	NA	NA	NA	NA
AYK92252.1|3380331_3381477_-	subtilisin NAT	NA	A0A217EQY2	Bacillus_phage	48.8	9.4e-53
>prophage 254
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3386390	3394534	4122398		Trichoplusia_ni_ascovirus(50.0%)	7	NA	NA
AYK92258.1|3386390_3387830_-	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	3.6e-25
AYK92259.1|3387836_3388397_-	biotin transporter BioY	NA	NA	NA	NA	NA
AYK92260.1|3388531_3389830_-	globin-coupled sensor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	66.7	2.6e-06
AYK92261.1|3391600_3392458_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	46.1	7.8e-52
AYK92262.1|3392485_3392719_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
AYK92263.1|3393011_3393590_+	competence transcription factor	NA	NA	NA	NA	NA
AYK92264.1|3393634_3394534_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	51.6	8.7e-70
>prophage 255
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3404932	3406258	4122398		Tupanvirus(100.0%)	1	NA	NA
AYK92278.1|3404932_3406258_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.5	9.6e-25
>prophage 256
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3411996	3413349	4122398	transposase	Streptococcus_phage(100.0%)	1	NA	NA
AYK92283.1|3411996_3413349_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 257
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3418030	3426365	4122398		Bacillus_virus(100.0%)	3	NA	NA
AYK92288.1|3418030_3421729_+	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	23.4	6.6e-15
AYK92289.1|3421800_3422976_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
AYK92290.1|3422972_3426365_+	SMC family ATPase	NA	G3MAB6	Bacillus_virus	27.1	1.5e-10
>prophage 258
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3432013	3434698	4122398		Bacillus_phage(100.0%)	1	NA	NA
AYK92302.1|3432013_3434698_+	peptidase S8	NA	A0A217EQY2	Bacillus_phage	37.0	8.2e-31
>prophage 259
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3446505	3447312	4122398		Mycobacterium_phage(100.0%)	1	NA	NA
AYK92312.1|3446505_3447312_+	alpha/beta hydrolase	NA	A0A0A1ELD0	Mycobacterium_phage	26.5	3.3e-12
>prophage 260
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3452368	3453220	4122398		Staphylococcus_phage(100.0%)	1	NA	NA
AYK92318.1|3452368_3453220_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	32.1	1.6e-12
>prophage 261
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3457294	3457465	4122398		Bacteriophage(100.0%)	1	NA	NA
AYK92324.1|3457294_3457465_+	YqaE/Pmp3 family membrane protein	NA	A0A0C5AJ71	Bacteriophage	60.0	9.4e-10
>prophage 262
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3462767	3465057	4122398		Klosneuvirus(50.0%)	2	NA	NA
AYK92328.1|3462767_3463925_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.2	4.3e-29
AYK92329.1|3463995_3465057_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	40.1	6.0e-62
>prophage 263
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3468129	3525518	4122398	coat,transposase,tRNA	Bacillus_phage(25.0%)	69	NA	NA
AYK92331.1|3468129_3469089_+	ornithine carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	28.6	1.2e-21
AYK92332.1|3469136_3470287_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
AYK92333.1|3470464_3470644_+	YjzC family protein	NA	NA	NA	NA	NA
AYK92334.1|3470689_3470875_-	DUF2929 domain-containing protein	NA	NA	NA	NA	NA
AYK92335.1|3471123_3471858_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92336.1|3471939_3472497_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92337.1|3472587_3473541_+	transcriptional activator protein med	NA	NA	NA	NA	NA
AYK92338.1|3473555_3473747_+	ComG operon repressor	NA	NA	NA	NA	NA
AYK92339.1|3473776_3474004_-	hypothetical protein	NA	NA	NA	NA	NA
AYK92340.1|3474168_3475107_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
AYK92341.1|3475129_3476371_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AYK92342.1|3476446_3477232_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92343.1|3477423_3478410_+	oligopeptide transport ATP-binding protein AppD	NA	G9BWD6	Planktothrix_phage	32.9	5.7e-22
AYK92344.1|3478406_3479396_+	dipeptide ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	26.1	6.7e-07
AYK92345.1|3479483_3481115_+	peptide-binding protein	NA	NA	NA	NA	NA
AYK92346.1|3481190_3482141_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AYK92347.1|3482157_3483069_+	ABC transporter permease	NA	NA	NA	NA	NA
AYK93120.1|3483274_3484027_+	DUF3603 family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	5.4e-49
AYK93121.1|3484061_3485054_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AYK92348.1|3485797_3487435_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYK92349.1|3487542_3488478_+	ABC transporter permease	NA	NA	NA	NA	NA
AYK92350.1|3488481_3489399_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AYK92351.1|3489403_3490480_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	2.1e-17
AYK92352.1|3490481_3491399_+	oligopeptide transport ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.2e-05
AYK93122.1|3491506_3492724_+	MFS transporter	NA	NA	NA	NA	NA
AYK92353.1|3492887_3493466_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYK92354.1|3493646_3494042_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AYK92355.1|3494084_3494741_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	38.0	1.1e-29
AYK92356.1|3494910_3495051_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92357.1|3495017_3495674_+	adaptor protein MecA	NA	NA	NA	NA	NA
AYK92358.1|3495668_3495791_-	hypothetical protein	NA	NA	NA	NA	NA
AYK92359.1|3495834_3496986_+	competence protein CoiA	NA	NA	NA	NA	NA
AYK92360.1|3497032_3499045_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AYK92361.1|3499082_3499250_-	hypothetical protein	NA	NA	NA	NA	NA
AYK92362.1|3499345_3499546_-	hypothetical protein	NA	NA	NA	NA	NA
AYK92363.1|3499564_3500464_-	DsbA family protein	NA	NA	NA	NA	NA
AYK92364.1|3500460_3500859_-	group 2 truncated hemoglobin YjbI	NA	NA	NA	NA	NA
AYK93123.1|3501113_3501659_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	73.7	5.1e-41
AYK92365.1|3501862_3502435_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AYK92366.1|3502559_3502928_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92367.1|3502956_3503592_+	GTP pyrophosphokinase YjbM	NA	NA	NA	NA	NA
AYK92368.1|3503610_3504411_+	NAD(+) kinase	NA	NA	NA	NA	NA
AYK93124.1|3504473_3505325_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AYK92369.1|3505337_3506072_-	bis(5'-nucleosyl)-tetraphosphatase PrpE [asymmetrical]	NA	A8E2N0	Enterococcus_phage	24.8	7.2e-06
AYK92370.1|3506306_3508151_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AYK92371.1|3508399_3509110_+	thiaminase II	NA	NA	NA	NA	NA
AYK92372.1|3509084_3509702_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
AYK92373.1|3509685_3510795_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
AYK93125.1|3510794_3510995_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AYK92374.1|3510991_3511762_+	thiazole synthase	NA	NA	NA	NA	NA
AYK92375.1|3511758_3512769_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
AYK92376.1|3512787_3513603_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AYK92377.1|3513738_3514515_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AYK92378.1|3514615_3515299_+|coat	spore coat protein	coat	NA	NA	NA	NA
AYK92379.1|3515391_3515841_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK92380.1|3515968_3516457_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK92381.1|3516608_3517091_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK92382.1|3517175_3517496_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK92383.1|3517535_3517922_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK92384.1|3518081_3518438_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
AYK92385.1|3518719_3518926_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92386.1|3519007_3519157_+	sporulation protein YjcZ	NA	NA	NA	NA	NA
AYK92387.1|3519289_3519544_+	sporulation-specific transcription factor SpoVIF	NA	NA	NA	NA	NA
AYK92388.1|3519617_3521897_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	34.9	3.5e-91
AYK92389.1|3522013_3522268_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92390.1|3522340_3522763_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK92391.1|3522766_3523282_-	hypothetical protein	NA	NA	NA	NA	NA
AYK92392.1|3523318_3524041_-	esterase family protein	NA	NA	NA	NA	NA
AYK93126.1|3524396_3525518_+	cystathionine gamma-synthase/O-acetylhomoserine thiolyase	NA	A0A0B5JD48	Pandoravirus	26.3	3.7e-17
>prophage 264
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3530558	3534724	4122398		Bacillus_phage(66.67%)	5	NA	NA
AYK92397.1|3530558_3530906_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	67.6	8.6e-18
AYK92398.1|3530918_3531440_-	hypothetical protein	NA	NA	NA	NA	NA
AYK92399.1|3531802_3532174_-	helix-turn-helix domain-containing protein	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	46.8	5.1e-16
AYK93127.1|3532339_3532615_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYK92400.1|3533554_3534724_+	hypothetical protein	NA	M4ZSB3	Bacillus_phage	41.8	2.0e-87
>prophage 265
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3542153	3547233	4122398	transposase	Bacillus_phage(66.67%)	4	NA	NA
AYK92406.1|3542153_3543269_-	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	71.9	2.4e-146
AYK92407.1|3543616_3545392_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	57.3	5.8e-126
AYK92408.1|3545394_3545853_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AYK92409.1|3545985_3547233_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
>prophage 266
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3560391	3646790	4122398	terminase,holin,transposase,portal,coat,tRNA,tail,protease,plate	uncultured_Caudovirales_phage(26.83%)	94	NA	NA
AYK92425.1|3560391_3561603_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	26.8	2.2e-23
AYK92426.1|3561733_3562240_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYK92427.1|3562458_3562854_-	hypothetical protein	NA	NA	NA	NA	NA
AYK92428.1|3563082_3563562_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AYK92429.1|3563601_3563796_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
AYK92430.1|3563927_3564257_-	DUF4306 domain-containing protein	NA	NA	NA	NA	NA
AYK92431.1|3564547_3564787_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92432.1|3564805_3565786_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AYK92433.1|3565918_3566152_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK92434.1|3566405_3567809_+	DUF4163 domain-containing protein	NA	NA	NA	NA	NA
AYK92435.1|3567848_3568322_-	DUF2690 domain-containing protein	NA	NA	NA	NA	NA
AYK92436.1|3568445_3568613_-	putative motility protein	NA	NA	NA	NA	NA
AYK92437.1|3568739_3569639_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92438.1|3569648_3570047_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
AYK92439.1|3570147_3570723_-	DUF4309 domain-containing protein	NA	NA	NA	NA	NA
AYK92440.1|3573818_3574379_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
AYK92441.1|3574575_3575220_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
AYK92442.1|3575294_3575921_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AYK92443.1|3575951_3576230_-	hypothetical protein	NA	NA	NA	NA	NA
AYK92444.1|3577834_3579013_+	UDP-glucosyltransferase	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	28.3	9.5e-08
AYK92445.1|3579053_3579242_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	77.6	3.4e-21
AYK92446.1|3579415_3580228_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AYK92447.1|3580273_3581026_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AYK92448.1|3581025_3581778_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	6.4e-18
AYK92449.1|3581897_3582872_-	multidrug resistance efflux transporter family protein	NA	NA	NA	NA	NA
AYK92450.1|3583887_3584310_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
AYK92451.1|3584349_3585528_+	NADH dehydrogenase	NA	NA	NA	NA	NA
AYK92452.1|3585725_3587147_+	glucuronate isomerase	NA	NA	NA	NA	NA
AYK92453.1|3587214_3588594_+	MFS transporter	NA	NA	NA	NA	NA
AYK92454.1|3588698_3589712_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
AYK92455.1|3589717_3590737_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AYK92456.1|3590761_3591841_+	mannonate dehydratase	NA	NA	NA	NA	NA
AYK92457.1|3591837_3592674_+	SDR family NAD(P)-dependent oxidoreductase	NA	M1NMS3	Moumouvirus	30.4	2.7e-09
AYK92458.1|3592721_3593990_+	hexuronate transporter	NA	NA	NA	NA	NA
AYK92459.1|3594077_3595079_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AYK92460.1|3595153_3596596_+	tagaturonate reductase	NA	NA	NA	NA	NA
AYK92461.1|3596592_3598086_+	altronate dehydratase	NA	NA	NA	NA	NA
AYK92462.1|3598124_3598889_-	anion permease	NA	NA	NA	NA	NA
AYK92463.1|3599107_3599572_-	hypothetical protein	NA	NA	NA	NA	NA
AYK92464.1|3600862_3602013_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
AYK92465.1|3602425_3603562_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.4	4.9e-94
AYK92466.1|3603551_3603686_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
AYK92467.1|3604083_3605037_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	73.8	1.6e-66
AYK92468.1|3605076_3605454_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	7.9e-17
AYK92469.1|3605558_3606161_+	hypothetical protein	NA	F8WQ53	Bacillus_phage	48.7	1.4e-44
AYK92470.1|3606237_3607074_+	manganese catalase family protein	NA	NA	NA	NA	NA
AYK92471.1|3607117_3607714_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
AYK92472.1|3607876_3608218_-	transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
AYK92473.1|3608396_3608576_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92474.1|3608562_3609399_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	27.8	6.7e-24
AYK92475.1|3609298_3610099_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	1.1e-60
AYK92476.1|3610098_3610266_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92477.1|3610350_3610701_+|portal	phage portal protein	portal	NA	NA	NA	NA
AYK92478.1|3610697_3610904_+	phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	2.1e-11
AYK92479.1|3611019_3611529_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	39.2	6.5e-22
AYK92480.1|3611644_3612442_+|terminase	PBSX phage terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	50.2	8.0e-59
AYK92481.1|3612438_3613740_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.0	9.1e-153
AYK92482.1|3613743_3615231_+	phage-like element PBSX protein XkdE	NA	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
AYK92483.1|3615250_3616078_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	59.2	1.6e-54
AYK92484.1|3616103_3617039_+	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
AYK92485.1|3617060_3617444_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.5	1.4e-13
AYK92486.1|3617440_3617797_+	phage-like element PBSX protein XkdH	NA	NA	NA	NA	NA
AYK92487.1|3617793_3618279_+	phage-like element PBSX protein XkdI	NA	A0A249XXA4	Clostridium_phage	47.0	2.1e-38
AYK92488.1|3618291_3618732_+|portal	phage portal protein	portal	NA	NA	NA	NA
AYK92489.1|3618735_3618954_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92490.1|3618950_3620351_+|tail	phage tail sheath protein	tail	A0A0A7S087	Clostridium_phage	39.3	3.0e-77
AYK92491.1|3620352_3620796_+	phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	44.5	1.9e-25
AYK92492.1|3620887_3621334_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	36.8	1.0e-10
AYK92493.1|3621375_3621516_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92494.1|3621516_3626520_+|portal	phage portal protein	portal	A0A2H4JA91	uncultured_Caudovirales_phage	44.8	6.4e-37
AYK92495.1|3626512_3627172_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A8WJR4	Clostridium_phage	33.2	1.1e-24
AYK92496.1|3627187_3628165_+	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
AYK92497.1|3628164_3628431_+	phage-like element PBSX protein XkdR	NA	S6C459	Thermus_phage	36.4	1.7e-05
AYK92498.1|3628488_3628914_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	3.0e-12
AYK92499.1|3628906_3629953_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	1.3e-72
AYK92500.1|3629936_3630515_+	phage-like element PBSX protein XkdU	NA	A0A2H4J717	uncultured_Caudovirales_phage	34.2	3.9e-15
AYK92501.1|3630511_3630784_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92502.1|3630786_3632850_+|terminase	terminase	terminase	A0A2H4J4R1	uncultured_Caudovirales_phage	34.5	2.6e-29
AYK92503.1|3632861_3633191_+|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	40.7	1.3e-15
AYK92504.1|3633187_3633352_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	1.9e-15
AYK92505.1|3633398_3634238_+|portal	phage portal protein	portal	NA	NA	NA	NA
AYK92506.1|3634290_3634560_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	1.4e-23
AYK92507.1|3634572_3634836_+|holin	holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	64.4	6.1e-24
AYK92508.1|3634848_3635742_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	69.2	5.2e-83
AYK92509.1|3635779_3635917_-	hypothetical protein	NA	NA	NA	NA	NA
AYK92510.1|3636002_3636173_-	type II toxin-antitoxin system SpoIISB family antitoxin	NA	NA	NA	NA	NA
AYK92511.1|3636172_3636919_-	type II toxin-antitoxin system SpoIISA family toxin	NA	NA	NA	NA	NA
AYK92512.1|3637028_3638030_-	low-affinity inorganic phosphate transporter	NA	NA	NA	NA	NA
AYK92513.1|3638042_3638660_-	DUF47 domain-containing protein	NA	NA	NA	NA	NA
AYK92514.1|3638935_3640252_-	amino acid permease	NA	NA	NA	NA	NA
AYK92515.1|3640640_3641591_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
AYK93128.1|3641807_3643958_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
AYK92516.1|3643969_3644941_+	glycosyltransferase	NA	I1TED8	Salmonella_phage	41.3	2.5e-62
AYK92517.1|3645440_3646790_-|protease	serine protease HtrA	protease	A0A1B1IT49	uncultured_Mediterranean_phage	34.1	3.4e-25
>prophage 267
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3650646	3651654	4122398		Planktothrix_phage(100.0%)	1	NA	NA
AYK92522.1|3650646_3651654_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	1.8e-15
>prophage 268
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3655445	3657338	4122398		Clostridium_phage(50.0%)	2	NA	NA
AYK92525.1|3655445_3656336_+	NlpC/P60 family protein	NA	A0A0A8WIF2	Clostridium_phage	45.8	5.3e-19
AYK92526.1|3656348_3657338_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.5	3.2e-17
>prophage 269
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3666002	3681516	4122398	tRNA,protease	Streptococcus_phage(33.33%)	15	NA	NA
AYK92536.1|3666002_3667100_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.1	4.3e-71
AYK92537.1|3667111_3668359_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.1	4.2e-99
AYK92538.1|3668484_3668910_+	organic hydroperoxide resistance protein OhrA	NA	NA	NA	NA	NA
AYK92539.1|3668940_3669384_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYK92540.1|3669525_3669936_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
AYK92541.1|3670183_3670654_-|tRNA	tRNA-specific adenosine deaminase	tRNA	S4VYZ2	Pandoravirus	45.8	1.8e-26
AYK92542.1|3670828_3673117_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AYK92543.1|3673532_3674492_-|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	49.5	5.6e-75
AYK92544.1|3674714_3675548_+	RsbT co-antagonist protein RsbRB	NA	NA	NA	NA	NA
AYK92545.1|3675578_3676343_-	thiamine permease	NA	NA	NA	NA	NA
AYK92546.1|3676317_3677961_-	heme ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.3e-18
AYK92547.1|3677947_3678547_-	thiamine permease	NA	NA	NA	NA	NA
AYK92548.1|3678548_3679151_-	thiamine-binding protein	NA	NA	NA	NA	NA
AYK92549.1|3679461_3680148_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYK92550.1|3680151_3681516_+	sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.0	7.1e-15
>prophage 270
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3690986	3694800	4122398		Salmonella_phage(50.0%)	3	NA	NA
AYK92563.1|3690986_3692000_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	41.3	5.4e-52
AYK92564.1|3692025_3693861_-	DNA ligase D	NA	NA	NA	NA	NA
AYK92565.1|3693864_3694800_-	Ku protein	NA	A0A218M9C0	Mycobacterium_phage	38.4	2.2e-44
>prophage 271
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3698161	3701502	4122398		Bacillus_phage(100.0%)	4	NA	NA
AYK92568.1|3698161_3699136_+	hypothetical protein	NA	A0A068EP98	Bacillus_phage	41.9	2.5e-30
AYK92569.1|3699399_3700155_+	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
AYK92570.1|3700151_3701297_+	anti-sigma-I factor RsgI	NA	NA	NA	NA	NA
AYK92571.1|3701307_3701502_-	small, acid-soluble spore protein D	NA	A0A217EQS5	Bacillus_phage	66.7	1.4e-14
>prophage 272
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3705048	3711020	4122398	transposase	Streptococcus_phage(33.33%)	6	NA	NA
AYK92575.1|3705048_3706401_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
AYK92576.1|3706645_3706801_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92577.1|3706803_3706980_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92578.1|3707034_3708057_-	acyltransferase family protein	NA	NA	NA	NA	NA
AYK92579.1|3708309_3710526_+	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.8	8.8e-23
AYK92580.1|3710522_3711020_+	methylated-DNA--protein-cysteine methyltransferase constitutive	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	50.5	5.9e-20
>prophage 273
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3724722	3743246	4122398	protease	Enterobacteria_phage(25.0%)	18	NA	NA
AYK92595.1|3724722_3726822_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	42.9	1.4e-131
AYK92596.1|3727189_3728233_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92597.1|3728545_3729205_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.1	6.2e-65
AYK92598.1|3729197_3729647_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
AYK92599.1|3729639_3730371_+	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	47.2	1.7e-55
AYK92600.1|3730388_3730886_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	74.1	1.4e-56
AYK92601.1|3731206_3731497_+	DUF3219 family protein	NA	NA	NA	NA	NA
AYK92602.1|3731618_3731804_-	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
AYK92603.1|3731969_3732164_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92604.1|3732462_3733089_+	cell wall hydrolase	NA	A0A141HRV8	Bacillus_phage	52.7	1.8e-26
AYK92605.1|3733206_3734544_+	sporulation protein YkvU	NA	NA	NA	NA	NA
AYK92606.1|3734594_3735092_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
AYK92607.1|3735327_3737241_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	40.7	1.4e-117
AYK92608.1|3737279_3737483_-	hypothetical protein	NA	NA	NA	NA	NA
AYK92609.1|3737648_3738743_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
AYK92610.1|3739024_3739990_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.9	9.8e-19
AYK92611.1|3740052_3740919_+	transcription antiterminator	NA	NA	NA	NA	NA
AYK92612.1|3741146_3743246_+	PTS glucose transporter subunit IICBA	NA	A0A2I7SAJ6	Vibrio_phage	50.0	2.0e-08
>prophage 274
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3747586	3759853	4122398	transposase	uncultured_Caudovirales_phage(20.0%)	9	NA	NA
AYK92618.1|3747586_3749554_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.4	1.8e-11
AYK92619.1|3749691_3750558_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYK92620.1|3750704_3751952_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
AYK92621.1|3752024_3752747_-	hypothetical protein	NA	U5Q0C0	Bacillus_phage	68.3	3.1e-33
AYK92622.1|3753083_3755204_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
AYK92623.1|3755367_3757197_+	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.6	1.1e-07
AYK92624.1|3757193_3758375_-	aminotransferase A	NA	NA	NA	NA	NA
AYK92625.1|3758576_3758738_-	hypothetical protein	NA	NA	NA	NA	NA
AYK92626.1|3758941_3759853_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	33.8	8.0e-47
>prophage 275
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3763408	3764173	4122398		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AYK92630.1|3763408_3764173_+	2,4-dienoyl-CoA reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	39.0	1.0e-39
>prophage 276
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3768999	3770830	4122398		Bacillus_phage(100.0%)	3	NA	NA
AYK92637.1|3768999_3769476_+	flavodoxin	NA	A7KUZ7	Bacillus_phage	35.7	3.2e-15
AYK92638.1|3769465_3770359_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
AYK92639.1|3770374_3770830_+	flavodoxin	NA	A7KUZ7	Bacillus_phage	33.9	1.3e-13
>prophage 277
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3774834	3777540	4122398	transposase	Bacillus_phage(50.0%)	3	NA	NA
AYK92645.1|3774834_3775281_+	TlpA family protein disulfide reductase	NA	A0A127AW88	Bacillus_phage	47.9	5.9e-35
AYK92646.1|3775746_3776322_+	transcriptional regulator Rok	NA	NA	NA	NA	NA
AYK92647.1|3776389_3777540_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
>prophage 278
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3784907	3789358	4122398		Bacillus_phage(50.0%)	4	NA	NA
AYK92655.1|3784907_3786722_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	7.2e-55
AYK92656.1|3786831_3787527_+	YIP1 family protein	NA	NA	NA	NA	NA
AYK92657.1|3787531_3788665_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYK92658.1|3788665_3789358_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.9	1.3e-36
>prophage 279
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3795622	3797245	4122398		Tupanvirus(100.0%)	1	NA	NA
AYK92665.1|3795622_3797245_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.0	7.6e-48
>prophage 280
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3801113	3802865	4122398		Paenibacillus_phage(50.0%)	2	NA	NA
AYK92669.1|3801113_3801392_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	47.3	7.4e-12
AYK92670.1|3801581_3802865_+	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	30.1	1.1e-20
>prophage 281
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3808631	3809996	4122398		Lactococcus_phage(50.0%)	2	NA	NA
AYK92675.1|3808631_3809405_+	Cof-type HAD-IIB family hydrolase	NA	Q0GXW5	Lactococcus_phage	22.6	2.0e-06
AYK92676.1|3809441_3809996_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.8	3.2e-14
>prophage 282
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3815117	3816530	4122398		Erysipelothrix_phage(100.0%)	1	NA	NA
AYK92681.1|3815117_3816530_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	7.5e-44
>prophage 283
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3830781	3835454	4122398		Streptococcus_phage(50.0%)	5	NA	NA
AYK92697.1|3830781_3832620_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	38.8	3.8e-19
AYK92698.1|3832676_3832994_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92699.1|3833049_3833259_-	DUF2197 domain-containing protein	NA	NA	NA	NA	NA
AYK92700.1|3833341_3833971_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
AYK92701.1|3834125_3835454_+	PhoH family protein	NA	A0A2I7SAD7	Vibrio_phage	34.5	6.2e-56
>prophage 284
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3851045	3855230	4122398		Bacillus_phage(50.0%)	7	NA	NA
AYK92716.1|3851045_3852086_+	hypothetical protein	NA	U5Q1E2	Bacillus_phage	39.5	9.9e-17
AYK92717.1|3852317_3852716_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92718.1|3852731_3852971_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92719.1|3853086_3853536_+	regulatory protein YlbF	NA	NA	NA	NA	NA
AYK93138.1|3853590_3853863_+	DUF2129 domain-containing protein	NA	NA	NA	NA	NA
AYK92720.1|3854185_3854740_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
AYK92721.1|3854744_3855230_+	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	40.5	3.2e-26
>prophage 285
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3883947	3892019	4122398		Bacillus_phage(75.0%)	5	NA	NA
AYK92749.1|3883947_3888249_+	bacillopeptidase F	NA	A0A217EQY2	Bacillus_phage	32.1	4.5e-23
AYK93140.1|3888443_3889373_+	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
AYK92750.1|3889435_3890155_+	RNA polymerase sporulation sigma factor SigE	NA	A0A0A0RV91	Bacillus_phage	28.3	8.1e-18
AYK92751.1|3890294_3891077_+	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.5	7.6e-46
AYK92752.1|3891224_3892019_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	2.8e-11
>prophage 286
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3898019	3908404	4122398	tRNA	Moumouvirus(25.0%)	8	NA	NA
AYK92760.1|3898019_3900785_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2P1ELB8	Moumouvirus	26.0	1.0e-81
AYK92761.1|3901406_3901865_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
AYK92762.1|3901866_3902778_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AYK92763.1|3902960_3903506_+	bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AYK92764.1|3903679_3904984_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	35.7	4.5e-59
AYK92765.1|3905128_3906043_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	36.0	1.3e-36
AYK92766.1|3906026_3907313_+	dihydroorotase	NA	NA	NA	NA	NA
AYK92767.1|3907309_3908404_+	carbamoyl-phosphate synthase pyrimidine-specific small chain	NA	R4TGJ8	Halovirus	38.2	1.5e-60
>prophage 287
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3913972	3918615	4122398		Pandoravirus(33.33%)	5	NA	NA
AYK92772.1|3913972_3914623_+	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	37.9	8.0e-33
AYK92773.1|3915034_3915736_+	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
AYK92774.1|3915747_3916812_+	sulfate permease CysP	NA	NA	NA	NA	NA
AYK92775.1|3916860_3918009_+	sulfate adenylyltransferase	NA	A0A2K9L4R9	Tupanvirus	29.2	1.0e-38
AYK92776.1|3918021_3918615_+	adenylyl-sulfate kinase	NA	A0A1B0XTK9	Freshwater_phage	41.9	3.3e-09
>prophage 288
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3922617	3932605	4122398	tRNA	Acanthocystis_turfacea_Chlorella_virus(20.0%)	9	NA	NA
AYK92781.1|3922617_3925290_+	calcium-translocating P-type ATPase, SERCA-type	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.5	6.8e-86
AYK92782.1|3925372_3926248_+	YicC family protein	NA	NA	NA	NA	NA
AYK92783.1|3926324_3926594_+	DUF370 domain-containing protein	NA	NA	NA	NA	NA
AYK92784.1|3926601_3927216_+	guanylate kinase	NA	S4W1R9	Pandoravirus	33.7	1.1e-12
AYK92785.1|3927219_3927423_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AYK92786.1|3927503_3928724_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.6	4.1e-46
AYK92787.1|3928720_3931138_+	primosomal protein N'	NA	NA	NA	NA	NA
AYK92788.1|3931149_3931647_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.0	3.6e-17
AYK92789.1|3931651_3932605_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	31.4	1.1e-09
>prophage 289
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3935794	3937741	4122398		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AYK92793.1|3935794_3937741_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	36.1	8.3e-25
>prophage 290
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3949165	3951112	4122398		Trichoplusia_ni_ascovirus(33.33%)	3	NA	NA
AYK92806.1|3949165_3949906_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.4	3.0e-20
AYK92807.1|3949989_3950223_+	acyl carrier protein	NA	M4M9G2	Vibrio_phage	44.9	7.1e-08
AYK92808.1|3950362_3951112_+	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	35.9	4.2e-25
>prophage 291
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3962103	3962871	4122398		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
AYK92821.1|3962103_3962871_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	41.7	6.6e-26
>prophage 292
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	3967232	3974732	4122398	tRNA	Thermus_phage(25.0%)	6	NA	NA
AYK92826.1|3967232_3968126_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	37.1	1.3e-28
AYK92827.1|3968313_3970389_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	39.9	4.7e-103
AYK92828.1|3970464_3971772_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
AYK92829.1|3971839_3972754_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	29.8	1.8e-30
AYK92830.1|3972766_3973312_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AYK92831.1|3973328_3974732_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	27.0	4.5e-41
>prophage 293
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	4001132	4001897	4122398		Bacillus_phage(100.0%)	1	NA	NA
AYK92861.1|4001132_4001897_+	RNA polymerase sigma-D factor	NA	A0A0A0PIT2	Bacillus_phage	26.0	1.8e-07
>prophage 294
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	4005853	4006636	4122398		Flavobacterium_phage(100.0%)	1	NA	NA
AYK92867.1|4005853_4006636_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.0	3.7e-24
>prophage 295
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	4011772	4023424	4122398	tRNA	Clostridium_phage(33.33%)	10	NA	NA
AYK92872.1|4011772_4016086_+	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	33.2	2.7e-23
AYK92873.1|4016415_4016886_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AYK92874.1|4016920_4018036_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AYK92875.1|4018049_4018325_+	YlxR family protein	NA	NA	NA	NA	NA
AYK92876.1|4018326_4018629_+	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
AYK92877.1|4018648_4020799_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.2	3.8e-23
AYK92878.1|4020795_4021074_+	DUF503 domain-containing protein	NA	NA	NA	NA	NA
AYK92879.1|4021090_4021444_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
AYK92880.1|4021525_4022455_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
AYK92881.1|4022473_4023424_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	28.5	2.6e-08
>prophage 296
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	4027255	4028485	4122398		Bacillus_virus(100.0%)	1	NA	NA
AYK92885.1|4027255_4028485_+	peptidase M16	NA	G3MBJ8	Bacillus_virus	32.1	8.8e-49
>prophage 297
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	4036916	4045025	4122398		Mycobacterium_phage(25.0%)	6	NA	NA
AYK92895.1|4036916_4039280_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.1	1.4e-87
AYK92896.1|4039423_4040149_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYK93143.1|4040287_4041499_+	MFS transporter	NA	NA	NA	NA	NA
AYK92897.1|4041678_4042959_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	29.1	1.3e-50
AYK92898.1|4042955_4044242_+	peptidase M16	NA	A0A2H4UVM3	Bodo_saltans_virus	27.9	6.1e-08
AYK92899.1|4044296_4045025_+	oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.4	4.2e-14
>prophage 298
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	4049288	4057337	4122398		Bacillus_phage(40.0%)	7	NA	NA
AYK92905.1|4049288_4050335_+	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	73.7	1.9e-137
AYK92906.1|4050501_4051677_+	class A beta-lactamase-related serine hydrolase	NA	A0A0B5A438	Mycobacterium_phage	24.3	5.5e-08
AYK92907.1|4051952_4053515_+	ribonuclease Y	NA	NA	NA	NA	NA
AYK92908.1|4053583_4054378_+	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
AYK92909.1|4054577_4054838_+	stage V sporulation protein S	NA	J9PTX7	Bacillus_phage	42.5	1.2e-08
AYK92910.1|4055102_4056146_+	L-threonine 3-dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.9	1.7e-21
AYK92911.1|4056158_4057337_+	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	32.8	1.7e-49
>prophage 299
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	4060386	4066220	4122398		Catovirus(33.33%)	3	NA	NA
AYK92915.1|4060386_4062963_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	27.7	2.4e-40
AYK92916.1|4062978_4064862_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.3	7.6e-68
AYK92917.1|4065971_4066220_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	44.9	4.6e-05
>prophage 300
CP032863	Bacillus subtilis subsp. subtilis strain N2-2 chromosome, complete genome	4122398	4071374	4118287	4122398	capsid,terminase,transposase,portal,tRNA,tail,integrase,head,protease	Bacillus_phage(54.05%)	61	4070508:4070523	4101270:4101285
4070508:4070523	attL	TTAAAGGAGGACCAAA	NA	NA	NA	NA
AYK92925.1|4071374_4071749_+	HNH endonuclease	NA	Q38456	Bacillus_phage	87.1	1.3e-64
AYK92926.1|4072128_4072662_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	82.5	1.0e-70
AYK92927.1|4072949_4074161_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	26.8	2.2e-23
AYK93144.1|4075207_4075663_-	hypothetical protein	NA	NA	NA	NA	NA
AYK92928.1|4075817_4076375_-	hypothetical protein	NA	NA	NA	NA	NA
AYK92929.1|4076495_4077110_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYK92930.1|4077248_4077605_-	hypothetical protein	NA	NA	NA	NA	NA
AYK92931.1|4077683_4078508_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYK92932.1|4078618_4079947_-|protease	serine protease	protease	A0A1B0T6A2	Bacillus_phage	33.6	1.2e-27
AYK92933.1|4080171_4080405_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92934.1|4080684_4081392_+	hypothetical protein	NA	F8WQ53	Bacillus_phage	56.9	3.2e-51
AYK92935.1|4081461_4081914_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AYK92936.1|4081927_4082281_-	multidrug resistance protein EbrB	NA	NA	NA	NA	NA
AYK92937.1|4082294_4082612_-	multidrug resistance protein EbrA	NA	NA	NA	NA	NA
AYK92938.1|4082746_4083025_-	hypothetical protein	NA	NA	NA	NA	NA
AYK92939.1|4083113_4083527_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92940.1|4083626_4084571_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AYK92941.1|4084610_4084832_+	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AYK92942.1|4085026_4085299_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92943.1|4085380_4085611_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92944.1|4085853_4086246_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
AYK92945.1|4086205_4088308_+	ribonucleotide-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
AYK92946.1|4088325_4089315_+	ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
AYK92947.1|4089364_4089985_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
AYK92948.1|4090048_4090816_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.5	1.2e-51
AYK92949.1|4091456_4092425_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
AYK92950.1|4092557_4093820_+	GTPase HflX	NA	NA	NA	NA	NA
AYK92951.1|4093837_4095103_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AYK92952.1|4095212_4095620_+	transcriptional repressor GlnR	NA	NA	NA	NA	NA
AYK92953.1|4095678_4097013_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
AYK92954.1|4097125_4098283_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	38.9	8.3e-65
AYK92955.1|4098298_4099354_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0F6N3H6	Staphylococcus_phage	24.2	1.7e-08
AYK92956.1|4099337_4099724_-	XRE family transcriptional regulator	NA	R9W020	Paenibacillus_phage	31.4	9.0e-08
AYK92957.1|4099848_4100067_+	XRE family transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	63.2	2.1e-17
AYK92958.1|4100181_4100946_+	Rha family transcriptional regulator	NA	A8ATN0	Listeria_phage	49.1	1.0e-47
AYK92959.1|4100961_4101273_+	DNA-binding protein	NA	NA	NA	NA	NA
AYK93145.1|4101333_4101525_+	hypothetical protein	NA	Q9ZXD0	Bacillus_phage	53.1	7.1e-06
4101270:4101285	attR	TTAAAGGAGGACCAAA	NA	NA	NA	NA
AYK92960.1|4101521_4101797_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	47.1	1.2e-19
AYK92961.1|4101992_4102547_+	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	96.2	3.1e-94
AYK92962.1|4102550_4103486_+	hypothetical protein	NA	Q9ZXC7	Bacillus_phage	96.5	2.0e-170
AYK92963.1|4103475_4103790_+	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	99.0	1.5e-53
AYK92964.1|4103810_4104248_+	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	97.2	1.3e-79
AYK92965.1|4104308_4106726_+	DNA primase	NA	D6R422	Bacillus_phage	88.7	0.0e+00
AYK92966.1|4106925_4107363_+	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	91.7	4.8e-74
AYK92967.1|4107359_4107899_+	nuclease	NA	Q9ZXC2	Bacillus_phage	96.1	1.8e-94
AYK92968.1|4107933_4108449_+	hypothetical protein	NA	D6R425	Bacillus_phage	93.0	8.7e-91
AYK93146.1|4108702_4109116_+	ArpU family transcriptional regulator	NA	D6R428	Bacillus_phage	97.0	2.1e-63
AYK93147.1|4109487_4109871_+	HNH endonuclease	NA	A0A075M5R4	Enterococcus_phage	43.3	1.2e-17
AYK92969.1|4109873_4110080_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92970.1|4110318_4110804_+|terminase	phage terminase small subunit P27 family	terminase	A0A1Q1PVW3	Staphylococcus_phage	36.0	4.2e-18
AYK92971.1|4110793_4112527_+|terminase	terminase large subunit	terminase	A0A2H4JCI4	uncultured_Caudovirales_phage	48.9	2.1e-144
AYK92972.1|4112543_4112750_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92973.1|4112754_4113981_+|portal	phage portal protein	portal	A0A1J0MFU3	Staphylococcus_phage	39.4	2.4e-70
AYK92974.1|4113973_4114570_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0MFL1	Staphylococcus_phage	53.8	3.3e-49
AYK92975.1|4114617_4115826_+|capsid	phage major capsid protein	capsid	A0A2H4J824	uncultured_Caudovirales_phage	49.8	4.9e-76
AYK92976.1|4115853_4116237_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	56.8	1.4e-05
AYK92977.1|4116291_4116585_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	33.0	2.6e-07
AYK92978.1|4116574_4116901_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AYK92979.1|4116900_4117293_+|tail	phage tail protein	tail	A0A0M5M1E5	Enterococcus_phage	37.9	3.0e-11
AYK92980.1|4117289_4117697_+	hypothetical protein	NA	NA	NA	NA	NA
AYK92981.1|4117702_4118287_+|tail	major tail protein	tail	U5U3Z7	Lactobacillus_phage	36.5	9.1e-28
