The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032867	Bacillus subtilis subsp. subtilis strain N4-2 chromosome, complete genome	4119216	343833	400187	4119216	protease,tRNA,transposase,coat	Faustovirus(12.5%)	53	NA	NA
AYK77028.1|343833_344997_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
AYK77029.1|345113_346220_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
AYK77030.1|346206_347076_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
AYK77031.1|347029_348625_-	L-aspartate oxidase	NA	NA	NA	NA	NA
AYK77032.1|348727_349915_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A141ZJV0	Faustovirus	27.4	1.7e-33
AYK77033.1|349874_350417_+	transcription repressor NadR	NA	NA	NA	NA	NA
AYK77034.1|350441_351299_-	prephenate dehydratase	NA	NA	NA	NA	NA
AYK77035.1|351315_351759_-	ACT domain-containing protein	NA	NA	NA	NA	NA
AYK77036.1|351819_353106_-	GTPase ObgE	NA	NA	NA	NA	NA
AYK77037.1|353139_353718_-	sporulation initiation phosphotransferase B	NA	NA	NA	NA	NA
AYK77038.1|353795_353918_+	hypothetical protein	NA	NA	NA	NA	NA
AYK77039.1|354038_354323_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
AYK77040.1|354335_354674_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
AYK77041.1|354676_354985_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AYK77042.1|355131_355998_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
AYK77043.1|355990_356785_-	stage IV sporulation protein FA	NA	NA	NA	NA	NA
AYK77044.1|356934_357741_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
AYK77045.1|357742_358423_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
AYK77046.1|358475_358994_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AYK77047.1|358990_359863_-	cell shape-determining protein MreC	NA	NA	NA	NA	NA
AYK77048.1|359893_360907_-	rod shape-determining protein	NA	NA	NA	NA	NA
AYK77049.1|360998_361694_-	JAB domain-containing protein	NA	NA	NA	NA	NA
AYK77050.1|361730_362300_-	septum formation protein Maf	NA	NA	NA	NA	NA
AYK77051.1|362452_363451_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
AYK77052.1|363584_364331_-	prepilin peptidase	NA	NA	NA	NA	NA
AYK77053.1|364470_365763_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AYK77054.1|365822_368465_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	3.7e-161
AYK77055.1|368912_369104_+	hypothetical protein	NA	NA	NA	NA	NA
AYK77056.1|369122_370148_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
AYK77057.1|370180_371902_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AYK77058.1|372032_373325_-	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
AYK77059.1|373354_374329_-	porphobilinogen synthase	NA	NA	NA	NA	NA
AYK77060.1|374325_375114_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AYK77061.1|375103_376048_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AYK77062.1|376080_376911_-	protein HemX	NA	NA	NA	NA	NA
AYK77063.1|376918_378286_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
AYK77064.1|378515_379013_+	hypothetical protein	NA	NA	NA	NA	NA
AYK77065.1|379034_379622_-	GTP-binding protein	NA	NA	NA	NA	NA
AYK77066.1|379618_381943_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	2.6e-182
AYK77067.1|382123_383782_-|protease	Lon protease 2	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
AYK77068.1|383935_385198_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
AYK77069.1|385469_386744_-	trigger factor	NA	NA	NA	NA	NA
AYK77070.1|386971_387976_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AYK77071.1|388096_388696_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AYK77072.1|388708_390127_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AYK77073.1|390176_391274_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AYK77074.1|391294_392851_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	39.4	6.0e-10
AYK77075.1|392837_393866_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AYK77076.1|393889_394408_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
AYK77077.1|394404_396129_-	acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.2	2.4e-60
AYK77078.1|396941_397277_+	hypothetical protein	NA	NA	NA	NA	NA
AYK77079.1|398078_398903_+	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
AYK77080.1|399037_400187_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
>prophage 2
CP032867	Bacillus subtilis subsp. subtilis strain N4-2 chromosome, complete genome	4119216	983195	1033564	4119216	holin,tail,protease,portal,terminase,capsid,head	Bacillus_phage(72.5%)	63	NA	NA
AYK77612.1|983195_984779_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	59.7	4.2e-75
AYK77613.1|984793_985183_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80635.1|985525_986128_+	hypothetical protein	NA	NA	NA	NA	NA
AYK77614.1|986167_987109_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	77.1	3.0e-97
AYK77615.1|987150_987573_-|holin	holin family protein	holin	D6R405	Bacillus_phage	85.7	3.0e-57
AYK77616.1|987626_987797_-	XkdX family protein	NA	NA	NA	NA	NA
AYK77617.1|987793_988093_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	1.5e-39
AYK77618.1|988108_989332_-	DUF2479 domain-containing protein	NA	M4ZRP1	Bacillus_phage	79.9	6.5e-177
AYK77619.1|989368_990943_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	88.7	1.1e-264
AYK77620.1|990979_992686_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	81.8	9.4e-267
AYK77621.1|992697_993537_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	83.2	8.5e-136
AYK77622.1|993536_997415_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	81.0	0.0e+00
AYK77623.1|997427_997607_-	hypothetical protein	NA	D6R3Z7	Bacillus_phage	68.5	1.6e-12
AYK77624.1|997609_997948_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	70.5	3.0e-39
AYK77625.1|998002_998614_-|tail	phage tail protein	tail	Q9ZXE9	Bacillus_phage	89.7	7.9e-99
AYK77626.1|998614_998995_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	66.1	2.6e-39
AYK77627.1|998991_999375_-	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	86.6	2.9e-59
AYK77628.1|999367_999739_-|head,tail	head-tail adaptor protein	head,tail	Q9ZXF2	Bacillus_phage	68.3	3.5e-41
AYK77629.1|999671_1000019_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	87.0	2.0e-51
AYK77630.1|1000034_1000526_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	69.1	1.3e-27
AYK77631.1|1000554_1000869_-	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	68.8	6.8e-30
AYK77632.1|1000884_1002087_-|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	71.5	3.3e-157
AYK77633.1|1002123_1002750_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	92.8	1.8e-106
AYK77634.1|1002739_1003987_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	86.5	1.3e-217
AYK77635.1|1003992_1004208_-	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	80.6	1.3e-24
AYK77636.1|1004220_1005930_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	92.3	0.0e+00
AYK77637.1|1005929_1006463_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	82.5	1.0e-70
AYK80636.1|1006842_1007217_-	HNH endonuclease	NA	Q38456	Bacillus_phage	82.3	7.5e-60
AYK77638.1|1007266_1008013_-	hypothetical protein	NA	NA	NA	NA	NA
AYK77639.1|1008403_1009177_-	hypothetical protein	NA	NA	NA	NA	NA
AYK77640.1|1009327_1009711_-	hypothetical protein	NA	NA	NA	NA	NA
AYK77641.1|1010900_1011353_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	56.6	3.4e-38
AYK77642.1|1011606_1011807_-	hypothetical protein	NA	NA	NA	NA	NA
AYK77643.1|1011803_1012223_-	hypothetical protein	NA	A0A2I6UHP7	Bacillus_phage	61.2	1.6e-42
AYK77644.1|1012219_1012552_-	hypothetical protein	NA	F8WQ59	Bacillus_phage	53.3	8.3e-18
AYK77645.1|1012551_1013208_-	dUTPase	NA	R9TQ23	Paenibacillus_phage	46.0	9.9e-39
AYK77646.1|1013325_1013583_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	41.7	6.6e-07
AYK77647.1|1013579_1013987_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	45.8	1.3e-25
AYK77648.1|1013983_1014301_-	hypothetical protein	NA	NA	NA	NA	NA
AYK77649.1|1014297_1014660_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AYK77650.1|1014702_1014900_-	hypothetical protein	NA	NA	NA	NA	NA
AYK77651.1|1015146_1015287_-	BH0509 family protein	NA	NA	NA	NA	NA
AYK77652.1|1015394_1015943_-	hypothetical protein	NA	NA	NA	NA	NA
AYK77653.1|1016257_1017085_-	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	35.9	3.7e-35
AYK77654.1|1017068_1017950_-	replication protein	NA	V9QKF6	Oenococcus_phage	33.1	6.8e-27
AYK77655.1|1017942_1018161_-	hypothetical protein	NA	NA	NA	NA	NA
AYK77656.1|1018185_1018377_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	59.0	1.0e-12
AYK77657.1|1018428_1018632_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYK77658.1|1018866_1019265_+	XRE family transcriptional regulator	NA	S5M5X8	Brevibacillus_phage	33.7	4.3e-05
AYK77659.1|1019697_1020798_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYK77660.1|1022722_1023193_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.4	3.2e-47
AYK77661.1|1023337_1025677_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	42.9	2.4e-87
AYK77662.1|1025695_1026436_-	carboxylesterase	NA	NA	NA	NA	NA
AYK77663.1|1026567_1026798_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AYK77664.1|1026946_1027720_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYK77665.1|1027753_1027987_-	transcriptional regulator	NA	NA	NA	NA	NA
AYK77666.1|1028138_1028546_+	transcriptional regulator	NA	S6C481	Thermus_phage	64.8	1.9e-16
AYK77667.1|1028575_1028995_+	XRE family transcriptional regulator	NA	S6C481	Thermus_phage	62.7	5.4e-14
AYK77668.1|1029086_1029413_+	HxlR family transcriptional regulator	NA	NA	NA	NA	NA
AYK77669.1|1029540_1031241_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	8.0e-24
AYK77670.1|1031281_1031962_-	ABC transporter permease	NA	NA	NA	NA	NA
AYK77671.1|1031978_1032899_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYK77672.1|1032910_1033564_-|holin	choline ABC transporter permease	holin	NA	NA	NA	NA
>prophage 3
CP032867	Bacillus subtilis subsp. subtilis strain N4-2 chromosome, complete genome	4119216	1113347	1137019	4119216	holin,integrase,tail,portal,plate,capsid	Bacillus_phage(30.43%)	30	1120436:1120451	1138778:1138793
AYK77744.1|1113347_1113581_-	helix-turn-helix domain-containing protein	NA	B3RH35	Bacillus_virus	62.0	4.3e-21
AYK77745.1|1113859_1114138_+	hypothetical protein	NA	NA	NA	NA	NA
AYK77746.1|1114150_1115335_+	DNA translocase FtsK	NA	Q0H250	Geobacillus_phage	53.4	1.3e-108
AYK77747.1|1115321_1115954_+	hypothetical protein	NA	Q0H249	Geobacillus_phage	57.1	7.2e-63
AYK77748.1|1115995_1116298_-	hypothetical protein	NA	NA	NA	NA	NA
AYK77749.1|1116419_1116677_-|holin	holin	holin	A0A0U4JE55	Bacillus_phage	57.6	5.6e-22
AYK77750.1|1116696_1117644_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	62.7	2.5e-91
AYK77751.1|1117716_1117920_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	46.5	1.9e-09
AYK77752.1|1117944_1118115_-	XkdX family protein	NA	M4ZS22	Bacillus_phage	68.1	1.1e-10
AYK77753.1|1118115_1118409_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	80.2	1.6e-41
AYK77754.1|1118424_1119648_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	74.9	4.1e-163
AYK77755.1|1119684_1121262_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	86.8	3.3e-258
1120436:1120451	attL	GCTTGATTTACGGTTA	NA	NA	NA	NA
AYK77756.1|1121274_1122669_-	endopeptidase	NA	A6M966	Geobacillus_virus	30.3	3.0e-37
AYK77757.1|1122683_1124102_-|tail	phage tail protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	42.4	1.3e-56
AYK77758.1|1124105_1126928_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	36.4	6.7e-68
AYK77759.1|1126932_1127154_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80640.1|1127249_1127606_-	hypothetical protein	NA	NA	NA	NA	NA
AYK77760.1|1127692_1128262_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	63.0	1.0e-52
AYK77761.1|1128302_1128677_-	hypothetical protein	NA	NA	NA	NA	NA
AYK77762.1|1128681_1129089_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	55.5	2.1e-31
AYK77763.1|1129085_1129424_-	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	47.3	8.1e-21
AYK77764.1|1129424_1129817_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.5	7.5e-18
AYK77765.1|1129834_1130026_-	hypothetical protein	NA	NA	NA	NA	NA
AYK77766.1|1130082_1130991_-|capsid	phage major capsid protein	capsid	A0A0N9S7T7	Paenibacillus_phage	52.5	1.4e-80
AYK77767.1|1131022_1131583_-	ribonucleoside-triphosphate reductase	NA	NA	NA	NA	NA
AYK77768.1|1131688_1132501_-|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	52.7	8.1e-75
AYK77769.1|1132500_1134171_-|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	55.3	1.5e-155
AYK77770.1|1134175_1134610_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	49.3	1.5e-27
AYK77771.1|1134626_1136387_-	hypothetical protein	NA	A0A142F1L6	Bacillus_phage	44.8	8.3e-133
AYK77772.1|1136470_1137019_+|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	51.6	7.0e-38
1138778:1138793	attR	GCTTGATTTACGGTTA	NA	NA	NA	NA
>prophage 4
CP032867	Bacillus subtilis subsp. subtilis strain N4-2 chromosome, complete genome	4119216	1445645	1465667	4119216	protease,tRNA,bacteriocin	Staphylococcus_phage(50.0%)	22	NA	NA
AYK78072.1|1445645_1447316_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
AYK78073.1|1447312_1447741_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
AYK78074.1|1448053_1448185_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
AYK78075.1|1448141_1448294_+|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
AYK78076.1|1448318_1449665_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
AYK78077.1|1449677_1449839_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
AYK78078.1|1449835_1450555_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	1.6e-18
AYK78079.1|1450547_1451858_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
AYK80650.1|1451847_1453008_+	insulinase family protein	NA	NA	NA	NA	NA
AYK78080.1|1453012_1454293_+	insulinase family protein	NA	NA	NA	NA	NA
AYK78081.1|1454289_1454991_+|bacteriocin	bacteriocin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
AYK78082.1|1454996_1456373_-	YncE family protein	NA	NA	NA	NA	NA
AYK78083.1|1456411_1457767_-	YncE family protein	NA	NA	NA	NA	NA
AYK78084.1|1457996_1459142_+	transcriptional regulator	NA	A0A1P8CWN8	Bacillus_phage	43.5	1.7e-78
AYK78085.1|1459125_1459245_+	phosphatase RapF inhibitor	NA	NA	NA	NA	NA
AYK78086.1|1459342_1459900_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
AYK78087.1|1459834_1460707_-	agmatinase	NA	NA	NA	NA	NA
AYK78088.1|1460767_1461598_-	spermidine synthase	NA	NA	NA	NA	NA
AYK78089.1|1461799_1463875_+	penicillin-binding protein	NA	NA	NA	NA	NA
AYK78090.1|1463902_1464337_-	hypothetical protein	NA	NA	NA	NA	NA
AYK78091.1|1464475_1464994_-	hypothetical protein	NA	NA	NA	NA	NA
AYK78092.1|1465007_1465667_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 5
CP032867	Bacillus subtilis subsp. subtilis strain N4-2 chromosome, complete genome	4119216	1495285	1545393	4119216	holin,coat	Enterobacteria_phage(25.0%)	51	NA	NA
AYK78120.1|1495285_1495741_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK78121.1|1495733_1496585_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.9	1.3e-38
AYK78122.1|1496598_1497546_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
AYK78123.1|1497545_1498286_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	41.9	4.5e-48
AYK78124.1|1498310_1499330_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK78125.1|1499332_1500055_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK78126.1|1500047_1501169_-|coat	spore coat biosynthesis protein SpsE	coat	NA	NA	NA	NA
AYK78127.1|1501168_1502038_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK78128.1|1502038_1503208_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	28.1	1.2e-15
AYK78129.1|1503228_1504653_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
AYK78130.1|1504657_1505428_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	28.6	4.4e-06
AYK78131.1|1505420_1505600_-	hypothetical protein	NA	NA	NA	NA	NA
AYK78132.1|1505747_1506293_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
AYK78133.1|1506336_1506708_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
AYK78134.1|1506769_1508092_-	purine permease	NA	NA	NA	NA	NA
AYK78135.1|1508111_1508429_-	hypothetical protein	NA	NA	NA	NA	NA
AYK78136.1|1508596_1509967_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AYK78137.1|1509991_1510669_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	46.1	8.3e-49
AYK78138.1|1510682_1511489_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AYK78139.1|1511680_1512496_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AYK78140.1|1512586_1512835_-	hypothetical protein	NA	NA	NA	NA	NA
AYK78141.1|1512928_1514368_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.8	3.7e-22
AYK78142.1|1514364_1515750_-	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
AYK78143.1|1516051_1516822_+	transporter	NA	NA	NA	NA	NA
AYK80652.1|1517731_1518034_-	hypothetical protein	NA	NA	NA	NA	NA
AYK78144.1|1518563_1520984_+	peptidase S8	NA	A0A217EQY2	Bacillus_phage	38.2	5.3e-21
AYK78145.1|1521021_1522023_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AYK78146.1|1522196_1522946_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
AYK78147.1|1523051_1524233_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
AYK78148.1|1524441_1525587_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK78149.1|1525815_1526079_+	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
AYK78150.1|1526120_1526495_-	quinol oxidase subunit 4	NA	NA	NA	NA	NA
AYK78151.1|1526496_1527111_-	Quinol oxidase subunit 3	NA	NA	NA	NA	NA
AYK78152.1|1527124_1529074_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AYK80653.1|1529101_1530067_-	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
AYK80654.1|1530582_1530828_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AYK78153.1|1530898_1532440_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
AYK78154.1|1532443_1533616_-	galactokinase	NA	NA	NA	NA	NA
AYK78155.1|1533693_1534077_-	GtrA family protein	NA	NA	NA	NA	NA
AYK78156.1|1534094_1534766_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYK78157.1|1535120_1535279_+	DNA-binding anti-repressor SinI	NA	NA	NA	NA	NA
AYK78158.1|1535721_1536030_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
AYK78159.1|1536026_1537568_+	cation acetate symporter	NA	NA	NA	NA	NA
AYK78160.1|1537597_1538200_-	DsbA family protein	NA	NA	NA	NA	NA
AYK78161.1|1538482_1539733_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
AYK78162.1|1539751_1540909_-	Efem/EfeO family lipoprotein	NA	NA	NA	NA	NA
AYK78163.1|1540905_1542348_-	iron transporter	NA	NA	NA	NA	NA
AYK78164.1|1542504_1543173_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
AYK78165.1|1543169_1543988_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AYK78166.1|1543995_1544901_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYK78167.1|1545006_1545393_+|holin	holin-like protein CidA	holin	NA	NA	NA	NA
>prophage 6
CP032867	Bacillus subtilis subsp. subtilis strain N4-2 chromosome, complete genome	4119216	1707104	1759073	4119216	holin,transposase,bacteriocin	Bacillus_phage(20.0%)	46	NA	NA
AYK78312.1|1707104_1708229_-|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
AYK78313.1|1708522_1709278_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AYK78314.1|1709331_1710264_+	aldo/keto reductase	NA	NA	NA	NA	NA
AYK78315.1|1710493_1710808_+	DUF2628 domain-containing protein	NA	L7TIP7	Escherichia_phage	47.0	1.6e-10
AYK78316.1|1710911_1711382_-	hypothetical protein	NA	NA	NA	NA	NA
AYK78317.1|1712138_1712651_+	HPP family protein	NA	NA	NA	NA	NA
AYK78318.1|1714196_1716077_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	33.4	1.1e-93
AYK78319.1|1716244_1716496_-	hypothetical protein	NA	NA	NA	NA	NA
AYK78320.1|1717687_1717888_+	transcriptional regulator	NA	NA	NA	NA	NA
AYK78321.1|1717905_1718307_+	hypothetical protein	NA	NA	NA	NA	NA
AYK78322.1|1718510_1718729_-|bacteriocin	bacteriocin leader domain-containing protein	bacteriocin	NA	NA	NA	NA
AYK78323.1|1718773_1718995_-	hypothetical protein	NA	NA	NA	NA	NA
AYK78324.1|1719316_1720441_+|transposase	IS4 family transposase IS4Bsu1	transposase	NA	NA	NA	NA
AYK78325.1|1720718_1720973_+	hypothetical protein	NA	NA	NA	NA	NA
AYK78326.1|1721136_1723320_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	30.8	1.7e-50
AYK78327.1|1723320_1724790_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYK78328.1|1724891_1725080_+	hypothetical protein	NA	NA	NA	NA	NA
AYK78329.1|1725198_1726233_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AYK78330.1|1726326_1726902_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYK78331.1|1727032_1728103_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYK78332.1|1728161_1728593_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYK78333.1|1728819_1729224_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
AYK78334.1|1729193_1729886_+	LrgB family protein	NA	NA	NA	NA	NA
AYK78335.1|1729925_1730957_-	general stress protein 30	NA	NA	NA	NA	NA
AYK78336.1|1731049_1732198_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.3	1.4e-48
AYK78337.1|1732393_1733125_+	gluconate operon transcriptional regulator	NA	NA	NA	NA	NA
AYK78338.1|1733117_1734659_+	gluconokinase	NA	NA	NA	NA	NA
AYK78339.1|1734687_1736034_+	gluconate permease	NA	NA	NA	NA	NA
AYK78340.1|1736056_1737463_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	E3SJC4	Synechococcus_phage	30.6	1.7e-32
AYK78341.1|1737928_1738492_+	peroxiredoxin	NA	NA	NA	NA	NA
AYK78342.1|1738505_1740035_+	alkyl hydroperoxide reductase subunit F	NA	A0A1V0SIN1	Klosneuvirus	29.3	1.0e-33
AYK78343.1|1740145_1741585_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AYK78344.1|1742151_1742862_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYK78345.1|1742952_1743675_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
AYK78346.1|1743695_1744325_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
AYK78347.1|1744805_1746731_+	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
AYK78348.1|1747181_1747532_-	hypothetical protein	NA	NA	NA	NA	NA
AYK78349.1|1748012_1748453_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	34.4	3.4e-11
AYK78350.1|1748453_1748633_+	hypothetical protein	NA	NA	NA	NA	NA
AYK78351.1|1748872_1749631_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
AYK80657.1|1749627_1751175_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AYK78352.1|1751304_1751691_-	hypothetical protein	NA	NA	NA	NA	NA
AYK78353.1|1752102_1753566_+	hypothetical protein	NA	A0A0S2MYH0	Enterococcus_phage	36.0	1.0e-11
AYK78354.1|1753800_1755684_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	21.8	6.6e-19
AYK78355.1|1755664_1757698_-	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
AYK78356.1|1758755_1759073_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
CP032867	Bacillus subtilis subsp. subtilis strain N4-2 chromosome, complete genome	4119216	2535654	2544020	4119216		Synechococcus_phage(50.0%)	8	NA	NA
AYK79051.1|2535654_2536950_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	5.9e-19
AYK79052.1|2537023_2537749_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	1.2e-45
AYK79053.1|2537741_2537996_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AYK79054.1|2537992_2538676_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AYK79055.1|2538659_2540888_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	3.8e-159
AYK79056.1|2540863_2542294_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
AYK79057.1|2542395_2543436_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	1.7e-64
AYK79058.1|2543432_2544020_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	2.4e-28
>prophage 8
CP032867	Bacillus subtilis subsp. subtilis strain N4-2 chromosome, complete genome	4119216	3039162	3087521	4119216	tRNA,transposase,coat	Planktothrix_phage(22.22%)	56	NA	NA
AYK79505.1|3039162_3040313_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
AYK79506.1|3040490_3040670_+	YjzC family protein	NA	NA	NA	NA	NA
AYK79507.1|3040715_3040901_-	DUF2929 domain-containing protein	NA	NA	NA	NA	NA
AYK79508.1|3041149_3041884_+	hypothetical protein	NA	NA	NA	NA	NA
AYK79509.1|3041965_3042523_+	hypothetical protein	NA	NA	NA	NA	NA
AYK79510.1|3042613_3043567_+	transcriptional activator protein med	NA	NA	NA	NA	NA
AYK79511.1|3043581_3043773_+	ComG operon repressor	NA	NA	NA	NA	NA
AYK79512.1|3043802_3044030_-	hypothetical protein	NA	NA	NA	NA	NA
AYK79513.1|3044194_3045133_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
AYK79514.1|3045155_3046397_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AYK79515.1|3046472_3047258_+	hypothetical protein	NA	NA	NA	NA	NA
AYK79516.1|3047449_3048436_+	oligopeptide transport ATP-binding protein AppD	NA	G9BWD6	Planktothrix_phage	32.9	5.7e-22
AYK79517.1|3048432_3049422_+	dipeptide ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	26.1	6.7e-07
AYK79518.1|3049509_3051141_+	peptide-binding protein	NA	NA	NA	NA	NA
AYK79519.1|3051216_3052167_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AYK79520.1|3052183_3053095_+	ABC transporter permease	NA	NA	NA	NA	NA
AYK80698.1|3053300_3054053_+	DUF3603 family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	5.4e-49
AYK80699.1|3054087_3055080_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AYK79521.1|3055823_3057461_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYK79522.1|3057568_3058504_+	ABC transporter permease	NA	NA	NA	NA	NA
AYK79523.1|3058507_3059425_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AYK79524.1|3059429_3060506_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	2.1e-17
AYK79525.1|3060507_3061425_+	oligopeptide transport ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.2e-05
AYK80700.1|3061532_3062750_+	MFS transporter	NA	NA	NA	NA	NA
AYK79526.1|3062913_3063492_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYK79527.1|3063672_3064068_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AYK79528.1|3064110_3064767_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	38.0	1.1e-29
AYK79529.1|3064936_3065077_+	hypothetical protein	NA	NA	NA	NA	NA
AYK79530.1|3065043_3065700_+	adaptor protein MecA	NA	NA	NA	NA	NA
AYK79531.1|3065694_3065817_-	hypothetical protein	NA	NA	NA	NA	NA
AYK79532.1|3065860_3067012_+	competence protein CoiA	NA	NA	NA	NA	NA
AYK79533.1|3067058_3069071_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AYK79534.1|3069108_3069276_-	hypothetical protein	NA	NA	NA	NA	NA
AYK79535.1|3069371_3069572_-	hypothetical protein	NA	NA	NA	NA	NA
AYK79536.1|3069590_3070490_-	DsbA family protein	NA	NA	NA	NA	NA
AYK79537.1|3070486_3070885_-	group 2 truncated hemoglobin YjbI	NA	NA	NA	NA	NA
AYK80701.1|3071139_3071685_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	73.7	5.1e-41
AYK79538.1|3071888_3072461_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AYK79539.1|3072585_3072954_+	hypothetical protein	NA	NA	NA	NA	NA
AYK79540.1|3072982_3073618_+	GTP pyrophosphokinase YjbM	NA	NA	NA	NA	NA
AYK79541.1|3073636_3074437_+	NAD(+) kinase	NA	NA	NA	NA	NA
AYK80702.1|3074499_3075351_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AYK79542.1|3075363_3076098_-	bis(5'-nucleosyl)-tetraphosphatase PrpE [asymmetrical]	NA	A8E2N0	Enterococcus_phage	24.8	7.2e-06
AYK79543.1|3076332_3078177_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AYK79544.1|3078425_3079136_+	thiaminase II	NA	NA	NA	NA	NA
AYK79545.1|3079710_3080820_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
AYK80703.1|3080819_3081020_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AYK79546.1|3081016_3081787_+	thiazole synthase	NA	NA	NA	NA	NA
AYK79547.1|3081783_3082794_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
AYK79548.1|3082812_3083628_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AYK79549.1|3083763_3084540_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AYK79550.1|3084640_3085324_+|coat	spore coat protein	coat	NA	NA	NA	NA
AYK79551.1|3085416_3085866_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK79552.1|3085993_3086482_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK79553.1|3086633_3087116_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK79554.1|3087200_3087521_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 9
CP032867	Bacillus subtilis subsp. subtilis strain N4-2 chromosome, complete genome	4119216	3130416	3216814	4119216	tRNA,holin,coat,tail,protease,portal,terminase,plate,transposase	uncultured_Caudovirales_phage(26.83%)	95	NA	NA
AYK79597.1|3130416_3131628_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	26.8	2.2e-23
AYK79598.1|3131758_3132265_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYK79599.1|3132483_3132879_-	hypothetical protein	NA	NA	NA	NA	NA
AYK79600.1|3133107_3133587_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AYK79601.1|3133626_3133821_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
AYK79602.1|3133952_3134282_-	DUF4306 domain-containing protein	NA	NA	NA	NA	NA
AYK79603.1|3134572_3134812_+	hypothetical protein	NA	NA	NA	NA	NA
AYK79604.1|3134830_3135811_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AYK79605.1|3135943_3136177_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK79606.1|3136430_3137834_+	DUF4163 domain-containing protein	NA	NA	NA	NA	NA
AYK79607.1|3137873_3138347_-	DUF2690 domain-containing protein	NA	NA	NA	NA	NA
AYK79608.1|3138470_3138638_-	putative motility protein	NA	NA	NA	NA	NA
AYK79609.1|3138764_3139664_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80706.1|3139673_3140072_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
AYK79610.1|3140172_3140748_-	DUF4309 domain-containing protein	NA	NA	NA	NA	NA
AYK79611.1|3143843_3144404_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
AYK79612.1|3144600_3145245_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
AYK79613.1|3145319_3145946_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AYK79614.1|3145976_3146255_-	hypothetical protein	NA	NA	NA	NA	NA
AYK79615.1|3146645_3147836_+	cytochrome P450	NA	NA	NA	NA	NA
AYK79616.1|3147858_3149037_+	UDP-glucosyltransferase	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	28.3	9.5e-08
AYK79617.1|3149077_3149266_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	77.6	3.4e-21
AYK79618.1|3149439_3150252_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AYK79619.1|3150297_3151050_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AYK79620.1|3151049_3151802_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	6.4e-18
AYK79621.1|3151921_3152896_-	multidrug resistance efflux transporter family protein	NA	NA	NA	NA	NA
AYK79622.1|3153911_3154334_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
AYK79623.1|3154373_3155552_+	NADH dehydrogenase	NA	NA	NA	NA	NA
AYK79624.1|3155749_3157171_+	glucuronate isomerase	NA	NA	NA	NA	NA
AYK79625.1|3157238_3158618_+	MFS transporter	NA	NA	NA	NA	NA
AYK79626.1|3158722_3159736_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
AYK79627.1|3159741_3160761_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AYK79628.1|3160785_3161865_+	mannonate dehydratase	NA	NA	NA	NA	NA
AYK79629.1|3161861_3162698_+	SDR family NAD(P)-dependent oxidoreductase	NA	M1NMS3	Moumouvirus	30.4	2.7e-09
AYK79630.1|3162745_3164014_+	hexuronate transporter	NA	NA	NA	NA	NA
AYK79631.1|3164101_3165103_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AYK79632.1|3165177_3166620_+	tagaturonate reductase	NA	NA	NA	NA	NA
AYK79633.1|3166616_3168110_+	altronate dehydratase	NA	NA	NA	NA	NA
AYK79634.1|3168148_3168913_-	anion permease	NA	NA	NA	NA	NA
AYK79635.1|3169131_3169596_-	hypothetical protein	NA	NA	NA	NA	NA
AYK79636.1|3170886_3172037_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
AYK79637.1|3172449_3173586_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.4	4.9e-94
AYK79638.1|3173575_3173710_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
AYK79639.1|3174107_3175061_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	73.8	1.6e-66
AYK79640.1|3175100_3175478_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	7.9e-17
AYK79641.1|3175582_3176185_+	hypothetical protein	NA	F8WQ53	Bacillus_phage	48.7	1.4e-44
AYK79642.1|3176261_3177098_+	manganese catalase family protein	NA	NA	NA	NA	NA
AYK79643.1|3177141_3177738_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
AYK79644.1|3177900_3178242_-	transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
AYK79645.1|3178420_3178600_+	hypothetical protein	NA	NA	NA	NA	NA
AYK79646.1|3178586_3179423_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	27.8	6.7e-24
AYK79647.1|3179322_3180123_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	1.1e-60
AYK79648.1|3180122_3180290_+	hypothetical protein	NA	NA	NA	NA	NA
AYK79649.1|3180374_3180725_+|portal	phage portal protein	portal	NA	NA	NA	NA
AYK79650.1|3180721_3180928_+	phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	2.1e-11
AYK79651.1|3181043_3181553_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	39.2	6.5e-22
AYK79652.1|3181668_3182466_+|terminase	PBSX phage terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	50.2	8.0e-59
AYK79653.1|3182462_3183764_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.0	9.1e-153
AYK79654.1|3183767_3185255_+	phage-like element PBSX protein XkdE	NA	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
AYK79655.1|3185274_3186102_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	59.2	1.6e-54
AYK79656.1|3186127_3187063_+	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
AYK79657.1|3187084_3187468_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.5	1.4e-13
AYK79658.1|3187464_3187821_+	phage-like element PBSX protein XkdH	NA	NA	NA	NA	NA
AYK79659.1|3187817_3188303_+	phage-like element PBSX protein XkdI	NA	A0A249XXA4	Clostridium_phage	47.0	2.1e-38
AYK79660.1|3188315_3188756_+|portal	phage portal protein	portal	NA	NA	NA	NA
AYK79661.1|3188759_3188978_+	hypothetical protein	NA	NA	NA	NA	NA
AYK79662.1|3188974_3190375_+|tail	phage tail sheath protein	tail	A0A0A7S087	Clostridium_phage	39.3	3.0e-77
AYK79663.1|3190376_3190820_+	phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	44.5	1.9e-25
AYK79664.1|3190911_3191358_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	36.8	1.0e-10
AYK79665.1|3191399_3191540_+	hypothetical protein	NA	NA	NA	NA	NA
AYK79666.1|3191540_3196544_+|portal	phage portal protein	portal	A0A2H4JA91	uncultured_Caudovirales_phage	44.8	6.4e-37
AYK79667.1|3196536_3197196_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A8WJR4	Clostridium_phage	33.2	1.1e-24
AYK79668.1|3197211_3198189_+	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
AYK79669.1|3198188_3198455_+	phage-like element PBSX protein XkdR	NA	S6C459	Thermus_phage	36.4	1.7e-05
AYK79670.1|3198512_3198938_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	3.0e-12
AYK79671.1|3198930_3199977_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	1.3e-72
AYK79672.1|3199960_3200539_+	phage-like element PBSX protein XkdU	NA	A0A2H4J717	uncultured_Caudovirales_phage	34.2	3.9e-15
AYK79673.1|3200535_3200808_+	hypothetical protein	NA	NA	NA	NA	NA
AYK79674.1|3200810_3202874_+|terminase	terminase	terminase	A0A2H4J4R1	uncultured_Caudovirales_phage	34.5	2.6e-29
AYK79675.1|3202885_3203215_+|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	40.7	1.3e-15
AYK79676.1|3203211_3203376_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	1.9e-15
AYK79677.1|3203422_3204262_+|portal	phage portal protein	portal	NA	NA	NA	NA
AYK79678.1|3204314_3204584_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	1.4e-23
AYK79679.1|3204596_3204860_+|holin	holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	64.4	6.1e-24
AYK79680.1|3204872_3205766_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	69.2	5.2e-83
AYK79681.1|3205803_3205941_-	hypothetical protein	NA	NA	NA	NA	NA
AYK79682.1|3206026_3206197_-	type II toxin-antitoxin system SpoIISB family antitoxin	NA	NA	NA	NA	NA
AYK79683.1|3206196_3206943_-	type II toxin-antitoxin system SpoIISA family toxin	NA	NA	NA	NA	NA
AYK79684.1|3207052_3208054_-	low-affinity inorganic phosphate transporter	NA	NA	NA	NA	NA
AYK79685.1|3208066_3208684_-	DUF47 domain-containing protein	NA	NA	NA	NA	NA
AYK79686.1|3208959_3210276_-	amino acid permease	NA	NA	NA	NA	NA
AYK79687.1|3210664_3211615_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
AYK80707.1|3211831_3213982_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
AYK79688.1|3213993_3214965_+	glycosyltransferase	NA	I1TED8	Salmonella_phage	41.3	2.5e-62
AYK79689.1|3215464_3216814_-|protease	serine protease HtrA	protease	A0A1B1IT49	uncultured_Mediterranean_phage	34.1	3.4e-25
>prophage 10
CP032867	Bacillus subtilis subsp. subtilis strain N4-2 chromosome, complete genome	4119216	3642151	3739257	4119216	tRNA,integrase,holin,coat,tail,protease,portal,terminase,plate,capsid,transposase,head	Bacillus_phage(57.41%)	110	3644115:3644174	3708893:3709058
AYK80099.1|3642151_3642685_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	82.5	1.0e-70
AYK80100.1|3642972_3644184_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	26.8	2.2e-23
3644115:3644174	attL	ACTGTTCGATAATCTTGTTAGCTAATTCTACGGAGTTCGGATCTCTTTTCAATTTCCCCA	NA	NA	NA	NA
AYK80101.1|3645230_3645686_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80102.1|3645840_3646398_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80103.1|3646518_3647133_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYK80104.1|3647271_3647628_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80105.1|3647706_3648531_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYK80106.1|3648641_3649970_-|protease	serine protease	protease	A0A1B0T6A2	Bacillus_phage	33.6	1.2e-27
AYK80107.1|3650194_3650428_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80108.1|3650707_3651415_+	hypothetical protein	NA	F8WQ53	Bacillus_phage	56.9	3.2e-51
AYK80109.1|3651484_3651937_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AYK80110.1|3651950_3652304_-	multidrug resistance protein EbrB	NA	NA	NA	NA	NA
AYK80111.1|3652317_3652635_-	multidrug resistance protein EbrA	NA	NA	NA	NA	NA
AYK80112.1|3652769_3653048_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80113.1|3653136_3653550_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80114.1|3653649_3654594_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AYK80115.1|3654633_3654855_+	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AYK80116.1|3655049_3655322_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80117.1|3655403_3655634_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80118.1|3655876_3656269_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
AYK80119.1|3656228_3658331_+	ribonucleotide-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
AYK80120.1|3658348_3659338_+	ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
AYK80121.1|3659387_3660008_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
AYK80122.1|3660071_3660839_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.5	1.2e-51
AYK80123.1|3661479_3662448_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
AYK80124.1|3662580_3663843_+	GTPase HflX	NA	NA	NA	NA	NA
AYK80125.1|3663860_3665126_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AYK80126.1|3665235_3665643_+	transcriptional repressor GlnR	NA	NA	NA	NA	NA
AYK80127.1|3665701_3667036_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
AYK80128.1|3667148_3668306_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	38.9	8.3e-65
AYK80129.1|3668321_3669377_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0F6N3H6	Staphylococcus_phage	24.2	1.7e-08
AYK80130.1|3669360_3669747_-	XRE family transcriptional regulator	NA	R9W020	Paenibacillus_phage	31.4	9.0e-08
AYK80131.1|3669871_3670090_+	XRE family transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	63.2	2.1e-17
AYK80132.1|3670204_3670969_+	Rha family transcriptional regulator	NA	A8ATN0	Listeria_phage	49.1	1.0e-47
AYK80133.1|3670984_3671296_+	DNA-binding protein	NA	NA	NA	NA	NA
AYK80723.1|3671356_3671548_+	hypothetical protein	NA	Q9ZXD0	Bacillus_phage	53.1	7.1e-06
AYK80134.1|3671544_3671820_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	47.1	1.2e-19
AYK80135.1|3672015_3672570_+	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	96.2	3.1e-94
AYK80136.1|3672573_3673509_+	hypothetical protein	NA	Q9ZXC7	Bacillus_phage	96.5	2.0e-170
AYK80137.1|3673498_3673813_+	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	99.0	1.5e-53
AYK80138.1|3673833_3674271_+	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	97.2	1.3e-79
AYK80139.1|3674331_3676749_+	DNA primase	NA	D6R422	Bacillus_phage	88.7	0.0e+00
AYK80140.1|3676948_3677386_+	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	91.7	4.8e-74
AYK80141.1|3677382_3677922_+	nuclease	NA	Q9ZXC2	Bacillus_phage	96.1	1.8e-94
AYK80142.1|3677956_3678472_+	hypothetical protein	NA	D6R425	Bacillus_phage	93.0	8.7e-91
AYK80724.1|3678725_3679139_+	ArpU family transcriptional regulator	NA	D6R428	Bacillus_phage	97.0	2.1e-63
AYK80725.1|3679510_3679894_+	HNH endonuclease	NA	A0A075M5R4	Enterococcus_phage	43.3	1.2e-17
AYK80143.1|3679896_3680103_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80144.1|3680341_3680827_+|terminase	phage terminase small subunit P27 family	terminase	A0A1Q1PVW3	Staphylococcus_phage	36.0	4.2e-18
AYK80145.1|3680816_3682550_+|terminase	terminase large subunit	terminase	A0A2H4JCI4	uncultured_Caudovirales_phage	48.9	2.1e-144
AYK80146.1|3682566_3682773_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80147.1|3682777_3684004_+|portal	phage portal protein	portal	A0A1J0MFU3	Staphylococcus_phage	39.4	2.4e-70
AYK80148.1|3683996_3684593_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0MFL1	Staphylococcus_phage	53.8	3.3e-49
AYK80149.1|3684640_3685849_+|capsid	phage major capsid protein	capsid	A0A2H4J824	uncultured_Caudovirales_phage	49.8	4.9e-76
AYK80150.1|3685876_3686260_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	56.8	1.4e-05
AYK80151.1|3686314_3686608_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	33.0	2.6e-07
AYK80152.1|3686597_3686924_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AYK80153.1|3686923_3687316_+|tail	phage tail protein	tail	A0A0M5M1E5	Enterococcus_phage	37.9	3.0e-11
AYK80154.1|3687312_3687720_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80155.1|3687725_3688310_+|tail	major tail protein	tail	U5U3Z7	Lactobacillus_phage	36.5	9.1e-28
AYK80156.1|3688369_3688732_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80157.1|3688743_3688926_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80158.1|3688988_3692729_+	hypothetical protein	NA	A0A0S2SXL7	Bacillus_phage	60.4	9.1e-105
AYK80159.1|3692741_3693575_+|tail	phage tail family protein	tail	M4ZS20	Bacillus_phage	34.1	3.5e-33
AYK80160.1|3693588_3695463_+	autolysin	NA	D6R400	Bacillus_phage	27.8	5.5e-50
AYK80161.1|3697087_3698209_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	92.5	9.8e-196
AYK80162.1|3698224_3698524_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	2.0e-39
AYK80163.1|3698520_3698691_+	XkdX family protein	NA	NA	NA	NA	NA
AYK80164.1|3698742_3698955_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	59.4	1.9e-15
AYK80165.1|3698969_3699233_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	66.7	2.7e-24
AYK80166.1|3699288_3700266_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	71.4	2.0e-64
AYK80167.1|3700311_3700776_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AYK80168.1|3700794_3702558_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	52.3	3.3e-121
AYK80726.1|3702727_3702799_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80169.1|3702814_3703900_-	DUF4917 family protein	NA	NA	NA	NA	NA
AYK80170.1|3703936_3704137_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80171.1|3704733_3705024_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80172.1|3705262_3705754_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80173.1|3705934_3706786_+	toxin	NA	O64021	Bacillus_phage	60.3	1.4e-85
AYK80174.1|3707084_3707336_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80727.1|3707519_3707954_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AYK80175.1|3708996_3709755_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
3708893:3709058	attR	TGGGGAAATTGAAAAGAGATCCGAACTCCGTAGAATTAGCTAACAAGATTATCGAACAGTTGTAGACGTCAAGTCAAAATTTACATTTTTTGCTTATTTGCTTTTTACACTTCTGCTGAAAATACACTTTTTCGATGTTTCATTCGATAGCTATCTCCATCCATAT	NA	NA	NA	NA
AYK80728.1|3709751_3711299_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AYK80176.1|3711461_3712616_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.4e-24
AYK80177.1|3712612_3713512_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYK80178.1|3713589_3713970_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80179.1|3714511_3714742_+	XRE family transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	75.0	2.1e-20
AYK80180.1|3716253_3716418_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80181.1|3716557_3717028_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80182.1|3717824_3719216_+	MFS transporter	NA	NA	NA	NA	NA
AYK80183.1|3719288_3719606_+|transposase	transposase	transposase	NA	NA	NA	NA
AYK80184.1|3719602_3720517_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
AYK80185.1|3720655_3722257_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
AYK80186.1|3722394_3723549_-	ROK family protein	NA	NA	NA	NA	NA
AYK80187.1|3723786_3725124_+	xylose isomerase	NA	NA	NA	NA	NA
AYK80188.1|3725274_3726774_+	xylulokinase	NA	NA	NA	NA	NA
AYK80189.1|3727258_3728506_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
AYK80190.1|3728635_3729271_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	68.5	7.7e-73
AYK80191.1|3729683_3731099_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
AYK80192.1|3731200_3732385_-	alanine racemase 2	NA	NA	NA	NA	NA
AYK80193.1|3732795_3733221_-	endonuclease	NA	NA	NA	NA	NA
AYK80194.1|3734139_3734574_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A0A1P8CX51	Bacillus_phage	92.3	5.8e-72
AYK80195.1|3735174_3735438_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80196.1|3735489_3735714_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80197.1|3735844_3736009_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80198.1|3736283_3737123_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	98.2	5.6e-164
AYK80199.1|3737245_3737533_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80200.1|3737575_3738295_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80201.1|3738454_3738811_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80202.1|3739056_3739257_-|coat	spore coat protein CotC	coat	NA	NA	NA	NA
>prophage 11
CP032867	Bacillus subtilis subsp. subtilis strain N4-2 chromosome, complete genome	4119216	3810631	3846628	4119216	transposase,integrase	Bacillus_phage(41.67%)	37	3810538:3810597	3837103:3838388
3810538:3810597	attL	GGGACTGACCCCATAAGATGAGACAAATAAAAACACCTTCAAGTTTGAATACGGATGATT	NA	NA	NA	NA
AYK80264.1|3810631_3811781_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
AYK80265.1|3812027_3812573_-|integrase	integrase	integrase	A0A1B0T6D2	Bacillus_phage	51.4	3.6e-42
AYK80266.1|3812889_3813120_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYK80267.1|3813304_3815068_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AYK80268.1|3815229_3816087_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	35.0	4.5e-07
AYK80269.1|3816214_3817204_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
AYK80270.1|3817259_3818741_-	glutamate synthase	NA	NA	NA	NA	NA
AYK80271.1|3818757_3823320_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
AYK80272.1|3823465_3824368_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYK80273.1|3826460_3826829_-	replication termination protein	NA	A0A0K2CP62	Brevibacillus_phage	41.8	9.2e-18
AYK80274.1|3827127_3827844_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	78.0	9.7e-48
AYK80275.1|3827994_3828303_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
AYK80276.1|3828369_3829140_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80277.1|3829183_3829717_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYK80278.1|3829856_3830849_-	ABC transporter permease	NA	NA	NA	NA	NA
AYK80279.1|3830842_3831589_-	ABC transporter permease	NA	NA	NA	NA	NA
AYK80280.1|3831598_3832537_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.7	6.1e-26
AYK80281.1|3832552_3833104_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYK80282.1|3833499_3834744_-	MFS transporter	NA	NA	NA	NA	NA
AYK80283.1|3834842_3836090_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
AYK80284.1|3836091_3836388_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80285.1|3836540_3836837_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80286.1|3836878_3837073_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80287.1|3837196_3838346_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
AYK80288.1|3838387_3838627_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
3837103:3838388	attR	GGGACTGACCCCATAAGATGAGACAAATAAAAACACCTTCAAGTTTGAATACGGATGATTGTTATCCGAAATTAGACTTGGAGGTGTTTTTTCTATGGGGACAAGAGTGAGTTATCCGGTTGAAGTGAAACAGAAGGCTGTAGAAATGAGATTGGCAGGCGTACCTATGAAAGAGATCATGCAGGAGTTGAATATCAAAAATAATACGCAGATTAAGACATGGGTCAGATGGTATAAGGCTGGTGATACACATCGATTTGAACAGCCTGTTGGTAAGCAATACACTTATGGAAAAGGTCCGGAGTATTCTTCCGAATTAGAGAAACTGCAGGCAGAGAATCGATATCTGAGACAACAGAATGAAGTGTTAAAAAAGTACAACGAATTGGAAAGGAAGTTGATAGCCAAACGTCAGTCGAACTTGTAGAAGAATTGCACAGCACAATGACCGTGCAGGATATCTGTATTCATTTAGGTATCTCTCGCTCGTCTTATTATCGTTGGAAGAAGAATCTGAAGAAAGATCATCCCAAGCGCCATTTAGAAAAACAAATCGGCACGTTGTGCCGAGAGCACCAGTATCGATATGGATATCGAAAAATCACAGCTATATTAAAAAAGAGAATGTGTATTAACCATAAAACGGTTCAGCGTATTATGCAGAAAAATCAGTGGCAGTGCCGGGTTAAGGTGAAAAAGCGCAAGAAGAATGGGCAGCCATATGCCGTGGTCGACAATATATTAGATAGGAACTTTCAGTCTGATCATCCTCTTGAAAAACTAGTAACAGACATCACGTATTTGCCTTATGGACAGAAACAATTGTACCTTTCCAGTATATTGGATGTATATAATGGAGAAGTGATTGCTTTTACGATTGGAGATAAGCAGGACACAGACTTTGTCTTACACACACTTGATCAACTGCCAACACTGCCTGAGAACTGCGTGTTACATAGTGACCAAGGATCTGTGTATACATCTTACGAGTATCAGAAAGCTGTTAAAACAAAAGGCATTACCATGAGCATGTCCCGCAAAGGGACACCCGCTGATAATGCCTCCATCGAATCGTTTCATTCCTCACTAAAGTCTGAAACGTTCTATCTTAACAGCATTGATCGAACCACGACCGCCATCGTAGAACGCACTGTCATAGAATACATTCATTATTATAACAATATTCGTATTCAAACGAAACTAAACAACCAATCACCGATAAATTATCGGCAATTGGCTGTTTAAAAGGTGTTTTGATCCCTGTCTCAAAAACGGGGGTCAGTCCC	NA	NA	NA	NA
AYK80289.1|3838663_3838897_-	3-ketosteroid-delta-1-dehydrogenase	NA	NA	NA	NA	NA
AYK80290.1|3838983_3839295_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80291.1|3839356_3840604_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
AYK80292.1|3840676_3840820_-	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	92.5	9.6e-16
AYK80293.1|3841056_3841308_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	96.4	1.0e-36
AYK80731.1|3841676_3843104_-	serine hydrolase	NA	NA	NA	NA	NA
AYK80294.1|3843237_3843468_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80295.1|3843477_3843870_-	UPF0715 family protein	NA	O64087	Bacillus_phage	81.4	3.7e-49
AYK80296.1|3843914_3844139_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80732.1|3844173_3844527_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80297.1|3844645_3845290_-	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
AYK80298.1|3845503_3846628_+|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
>prophage 12
CP032867	Bacillus subtilis subsp. subtilis strain N4-2 chromosome, complete genome	4119216	3850295	3860985	4119216	holin,transposase	Bacillus_phage(75.0%)	10	NA	NA
AYK80302.1|3850295_3851543_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
AYK80303.1|3853749_3854109_-	hypothetical protein	NA	A0A1P8CWJ9	Bacillus_phage	98.3	2.2e-61
AYK80304.1|3854368_3854452_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AYK80305.1|3854740_3855274_-	N-acetyltransferase	NA	O64026	Bacillus_phage	97.2	2.9e-97
AYK80306.1|3855333_3855888_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	91.3	4.3e-96
AYK80307.1|3855943_3856402_-	SMI1/KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	85.5	2.8e-72
AYK80308.1|3856494_3856953_-	antitoxin YobK	NA	NA	NA	NA	NA
AYK80309.1|3856962_3858765_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	87.0	1.3e-218
AYK80733.1|3858863_3859421_-	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	95.7	7.0e-102
AYK80310.1|3859548_3860985_+	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	30.6	2.6e-07
>prophage 13
CP032867	Bacillus subtilis subsp. subtilis strain N4-2 chromosome, complete genome	4119216	4073425	4079520	4119216		Staphylococcus_phage(66.67%)	8	NA	NA
AYK80541.1|4073425_4074019_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.6e-14
AYK80744.1|4074008_4074764_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	5.5e-09
AYK80542.1|4075043_4075568_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
AYK80543.1|4075581_4075956_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK80544.1|4076068_4076533_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
AYK80545.1|4076565_4077762_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	4.1e-115
AYK80546.1|4077776_4078424_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	8.5e-43
AYK80547.1|4078434_4079520_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	6.6e-56
>prophage 1
CP032868	Bacillus subtilis subsp. subtilis strain N4-2 plasmid unnamed1, complete sequence	64614	0	10679	64614	integrase	Listeria_phage(50.0%)	14	7431:7446	15350:15365
AYK80750.1|639_1449_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80751.1|1783_2023_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80752.1|2205_2649_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80753.1|2648_3881_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80754.1|3911_4382_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80755.1|4456_5836_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
AYK80756.1|6098_6611_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80757.1|6828_7176_+	hypothetical protein	NA	NA	NA	NA	NA
7431:7446	attL	GGGAGGTCTATTTTTT	NA	NA	NA	NA
AYK80758.1|7859_8258_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80759.1|8426_8720_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80760.1|8713_9184_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	63.8	9.8e-49
AYK80761.1|9208_9658_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80762.1|9772_9988_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80763.1|10109_10679_+|integrase	site-specific integrase	integrase	A3F636	Streptococcus_phage	42.1	7.5e-35
15350:15365	attR	AAAAAATAGACCTCCC	NA	NA	NA	NA
>prophage 2
CP032868	Bacillus subtilis subsp. subtilis strain N4-2 plasmid unnamed1, complete sequence	64614	13974	19650	64614		Bacillus_phage(66.67%)	7	NA	NA
AYK80769.1|13974_14787_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	73.6	4.8e-120
AYK80770.1|15810_16278_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80771.1|16274_17072_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80772.1|17076_17604_-	thermonuclease	NA	A0A1P8CWK6	Bacillus_phage	47.7	2.9e-25
AYK80773.1|17597_17891_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80774.1|18450_18708_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80775.1|18807_19650_-	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	40.7	1.9e-42
>prophage 3
CP032868	Bacillus subtilis subsp. subtilis strain N4-2 plasmid unnamed1, complete sequence	64614	26559	32287	64614		Bacillus_phage(100.0%)	8	NA	NA
AYK80788.1|26559_26814_-	hypothetical protein	NA	F8WPQ5	Bacillus_phage	43.8	7.5e-11
AYK80789.1|26843_27134_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80790.1|27130_27583_-	hypothetical protein	NA	NA	NA	NA	NA
AYK80791.1|27891_28122_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80792.1|28844_29486_+	hypothetical protein	NA	NA	NA	NA	NA
AYK80793.1|29620_29953_+	YolD-like family protein	NA	O64030	Bacillus_phage	33.0	2.0e-08
AYK80794.1|29945_31211_+	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	67.0	1.4e-161
AYK80795.1|31951_32287_+	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	59.1	2.9e-26
>prophage 4
CP032868	Bacillus subtilis subsp. subtilis strain N4-2 plasmid unnamed1, complete sequence	64614	38580	39687	64614		Bacillus_phage(100.0%)	1	NA	NA
AYK80804.1|38580_39687_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	28.2	4.2e-42
>prophage 5
CP032868	Bacillus subtilis subsp. subtilis strain N4-2 plasmid unnamed1, complete sequence	64614	43494	43779	64614		Bacillus_phage(100.0%)	1	NA	NA
AYK80809.1|43494_43779_+	DUF5052 domain-containing protein	NA	F8WQ63	Bacillus_phage	68.5	1.7e-27
