The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032851	Salmonella enterica subsp. enterica serovar Enteritidis strain NCM 61 chromosome, complete genome	4679739	1734638	1745144	4679739		Enterobacteria_phage(37.5%)	9	NA	NA
AYK10815.1|1734638_1736042_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
AYK10816.1|1736219_1737113_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYK10817.1|1737489_1738575_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	1.0e-101
AYK10818.1|1738574_1739474_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
AYK13486.1|1739521_1740400_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
AYK10819.1|1740400_1740952_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
AYK10820.1|1741946_1742720_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYK10821.1|1742724_1743804_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
AYK10822.1|1743830_1745144_+	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 2
CP032851	Salmonella enterica subsp. enterica serovar Enteritidis strain NCM 61 chromosome, complete genome	4679739	1859997	1905555	4679739	holin,plate,transposase,capsid,portal,head,terminase,tail,protease	Salmonella_phage(80.77%)	62	NA	NA
AYK10931.1|1859997_1860288_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	1.2e-07
AYK10932.1|1860659_1861457_-	protein MtfA	NA	NA	NA	NA	NA
AYK10933.1|1862740_1862983_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
AYK10934.1|1863007_1863577_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	99.5	9.3e-110
AYK10935.1|1863573_1864437_-	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	49.2	5.2e-64
AYK10936.1|1864433_1864727_-	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	100.0	1.5e-50
AYK10937.1|1864998_1865358_-	Eaf protein	NA	T1SA95	Salmonella_phage	89.9	1.0e-58
AYK10938.1|1865354_1865870_-	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	96.5	1.3e-94
AYK10939.1|1865866_1866097_-	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
AYK10940.1|1866167_1866707_-	HD family hydrolase	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
AYK10941.1|1866801_1867719_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	59.7	1.3e-97
AYK10942.1|1867750_1867972_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	93.0	3.3e-15
AYK10943.1|1868288_1868540_+	bssS family protein	NA	NA	NA	NA	NA
AYK10944.1|1868439_1868688_-	hypothetical protein	NA	NA	NA	NA	NA
AYK10945.1|1868615_1868801_-	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
AYK10946.1|1869006_1869702_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	2.7e-127
AYK13494.1|1869675_1869861_+	amino acid permease	NA	NA	NA	NA	NA
AYK10947.1|1869799_1870024_+	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
AYK10948.1|1870052_1870607_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	98.9	3.4e-101
AYK10949.1|1870603_1871761_+	peptidase	NA	Q8HA97	Salmonella_phage	98.4	2.8e-214
AYK10950.1|1871757_1871982_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
AYK10951.1|1871978_1872953_+	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	97.8	1.2e-165
AYK10952.1|1872949_1873423_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	94.6	3.9e-53
AYK10953.1|1873419_1874301_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	96.2	8.3e-166
AYK10954.1|1874309_1874699_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	99.2	1.9e-69
AYK10955.1|1874670_1875576_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	98.3	1.6e-159
AYK13495.1|1875583_1876573_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	1.9e-190
AYK10956.1|1876586_1877339_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	1.9e-134
AYK10957.1|1877388_1878462_+	hypothetical protein	NA	NA	NA	NA	NA
AYK10958.1|1878474_1879047_+	hypothetical protein	NA	NA	NA	NA	NA
AYK13496.1|1879510_1879792_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
AYK10959.1|1879791_1880409_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	78.9	3.2e-92
AYK10960.1|1880405_1880945_+	DUF2514 domain-containing protein	NA	A0A0A0P0G7	Enterobacteria_phage	37.2	5.3e-06
AYK10961.1|1880968_1881319_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.1e-63
AYK10962.1|1881465_1881903_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	63.7	1.6e-32
AYK10963.1|1881902_1883633_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	58.9	3.2e-198
AYK13497.1|1883904_1884999_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	82.7	7.3e-180
AYK10964.1|1884991_1885594_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	91.5	2.0e-99
AYK10965.1|1885603_1886833_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	90.9	1.8e-206
AYK10966.1|1886912_1887236_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	72.0	2.6e-40
AYK10967.1|1887232_1887637_+|head,tail	head-tail adaptor protein	head,tail	A0A192Y6C2	Salmonella_phage	96.3	1.5e-69
AYK10968.1|1887608_1888121_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	93.5	1.4e-85
AYK10969.1|1888117_1888678_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	99.5	3.0e-105
AYK10970.1|1888681_1888846_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
AYK10971.1|1888835_1890332_+|tail	phage tail protein	tail	Q8HAC5	Salmonella_phage	99.2	3.0e-277
AYK10972.1|1890331_1890688_+|tail	phage tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
AYK10973.1|1890684_1891011_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
AYK10974.1|1891095_1893024_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.5	0.0e+00
AYK10975.1|1893057_1894398_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.1	1.1e-249
AYK10976.1|1894394_1895453_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
AYK10977.1|1895452_1895986_+|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	99.4	2.1e-95
AYK10978.1|1895990_1896404_+	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
AYK10979.1|1896396_1897476_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.4	5.5e-204
AYK10980.1|1897478_1898066_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
AYK10981.1|1898052_1899615_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	99.8	9.8e-287
AYK10982.1|1899614_1900184_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
AYK10983.1|1900468_1901476_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
AYK10984.1|1901688_1901910_+	DNA-binding protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
AYK10985.1|1902273_1902456_+	hypothetical protein	NA	NA	NA	NA	NA
AYK10986.1|1902848_1903226_+	hypothetical protein	NA	NA	NA	NA	NA
AYK10987.1|1903252_1904071_+	hypothetical protein	NA	NA	NA	NA	NA
AYK10988.1|1904532_1905555_+|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP032851	Salmonella enterica subsp. enterica serovar Enteritidis strain NCM 61 chromosome, complete genome	4679739	2437697	2453641	4679739	tRNA,holin	Escherichia_phage(62.5%)	22	NA	NA
AYK11475.1|2437697_2438132_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
AYK11476.1|2438181_2438520_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AYK11477.1|2438512_2438665_-	multidrug transporter	NA	NA	NA	NA	NA
AYK11478.1|2439365_2439911_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
AYK11479.1|2439907_2440189_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
AYK11480.1|2440178_2440367_-	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
AYK11481.1|2440288_2440684_-	hypothetical protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
AYK11482.1|2442854_2443391_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
AYK11483.1|2443387_2443678_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
AYK11484.1|2443677_2444277_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
AYK11485.1|2444800_2445013_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
AYK11486.1|2445382_2446315_+	hypothetical protein	NA	NA	NA	NA	NA
AYK11487.1|2446311_2446866_+	hypothetical protein	NA	NA	NA	NA	NA
AYK11488.1|2447027_2447357_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
AYK11489.1|2447629_2448097_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
AYK13520.1|2448481_2448637_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
AYK11490.1|2448744_2449266_-	hypothetical protein	NA	NA	NA	NA	NA
AYK11491.1|2449703_2449925_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
AYK11492.1|2450009_2450327_+	hypothetical protein	NA	NA	NA	NA	NA
AYK11493.1|2450354_2450972_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
AYK11494.1|2451288_2452224_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
AYK11495.1|2452267_2453641_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 4
CP032851	Salmonella enterica subsp. enterica serovar Enteritidis strain NCM 61 chromosome, complete genome	4679739	2622622	2694162	4679739	tRNA,holin,lysis,tail,protease,integrase	Enterobacteria_phage(21.74%)	71	2674681:2674710	2694298:2694327
AYK11651.1|2622622_2623318_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AYK11652.1|2625415_2625760_+	RidA family protein	NA	NA	NA	NA	NA
AYK11653.1|2625765_2625945_-	YoaH family protein	NA	NA	NA	NA	NA
AYK11654.1|2626025_2627390_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	34.5	3.6e-43
AYK11655.1|2627393_2627972_+	coenzyme A pyrophosphatase	NA	NA	NA	NA	NA
AYK11656.1|2628235_2629600_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AYK11657.1|2629737_2631339_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AYK11658.1|2631360_2632920_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
AYK11659.1|2632907_2633243_-	hypothetical protein	NA	NA	NA	NA	NA
AYK11660.1|2633392_2634361_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AYK11661.1|2634413_2635214_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AYK11662.1|2635226_2636078_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AYK11663.1|2636136_2636595_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
AYK13530.1|2636950_2637571_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
AYK11664.1|2637567_2638377_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AYK11665.1|2638442_2640188_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
AYK11666.1|2640407_2640617_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AYK11667.1|2640629_2640773_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
AYK11668.1|2641421_2641709_-	hypothetical protein	NA	NA	NA	NA	NA
AYK11669.1|2641779_2641923_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
AYK11670.1|2642080_2642320_+	hypothetical protein	NA	NA	NA	NA	NA
AYK11671.1|2642531_2643323_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AYK11672.1|2643498_2644872_+	MFS transporter	NA	NA	NA	NA	NA
AYK11673.1|2645993_2648042_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
AYK11674.1|2648061_2648748_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AYK11675.1|2648845_2649430_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AYK11676.1|2649471_2650755_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AYK11677.1|2650717_2653357_+	PqiB family protein	NA	NA	NA	NA	NA
AYK11678.1|2654987_2655227_+	DUF1480 family protein	NA	NA	NA	NA	NA
AYK11679.1|2655337_2655529_+	DUF1482 family protein	NA	NA	NA	NA	NA
AYK11680.1|2655547_2656198_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
AYK11681.1|2656421_2656586_-	hypothetical protein	NA	NA	NA	NA	NA
AYK11682.1|2656870_2657593_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
AYK11683.1|2658276_2658672_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
AYK11684.1|2659001_2659478_+	hypothetical protein	NA	NA	NA	NA	NA
AYK11685.1|2659850_2660270_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK11686.1|2660401_2660596_-	hypothetical protein	NA	NA	NA	NA	NA
AYK11687.1|2660642_2660912_+	hypothetical protein	NA	B6SCX2	Bacteriophage	47.9	3.1e-07
AYK11688.1|2661077_2661218_+	hypothetical protein	NA	NA	NA	NA	NA
AYK13531.1|2663538_2663739_-	hypothetical protein	NA	NA	NA	NA	NA
AYK11689.1|2664356_2665271_+	protein PagO	NA	NA	NA	NA	NA
AYK11690.1|2665403_2665562_+	hypothetical protein	NA	NA	NA	NA	NA
AYK11691.1|2665571_2666186_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
AYK11692.1|2667320_2667446_-	arsenic transporter	NA	NA	NA	NA	NA
AYK11693.1|2667708_2667825_+|tail	phage tail protein	tail	NA	NA	NA	NA
AYK11694.1|2668015_2668216_+	phage virulence factor	NA	NA	NA	NA	NA
AYK11695.1|2670917_2671409_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
AYK11696.1|2671463_2671652_+	hypothetical protein	NA	NA	NA	NA	NA
AYK11697.1|2671716_2671884_+	lytic enzyme	NA	NA	NA	NA	NA
AYK11698.1|2672140_2672674_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
AYK11699.1|2672727_2672958_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
AYK13532.1|2673147_2673642_+	RecE	NA	A0A0U2I1R6	Escherichia_phage	70.3	3.7e-22
2674681:2674710	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
AYK11700.1|2675498_2676299_+	hypothetical protein	NA	NA	NA	NA	NA
AYK11701.1|2676778_2677501_+	guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
AYK11702.1|2678051_2678915_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
AYK11703.1|2681554_2682250_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
AYK11704.1|2682339_2682873_+	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AYK13534.1|2683767_2684247_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
AYK13533.1|2684699_2685029_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AYK11705.1|2685304_2685991_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
AYK11706.1|2686350_2686800_+	hypothetical protein	NA	NA	NA	NA	NA
AYK11707.1|2686796_2687120_-	hypothetical protein	NA	NA	NA	NA	NA
AYK13535.1|2687172_2687697_-	hypothetical protein	NA	NA	NA	NA	NA
AYK11708.1|2687793_2688483_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
AYK11709.1|2688612_2688840_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
AYK11710.1|2688836_2689436_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
AYK11711.1|2689499_2689805_-	hypothetical protein	NA	NA	NA	NA	NA
AYK11712.1|2690227_2690419_+	hypothetical protein	NA	NA	NA	NA	NA
AYK11713.1|2690436_2692416_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
AYK11714.1|2692829_2693108_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
AYK11715.1|2693082_2694162_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
2694298:2694327	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 5
CP032851	Salmonella enterica subsp. enterica serovar Enteritidis strain NCM 61 chromosome, complete genome	4679739	2896013	2907238	4679739	tail	Salmonella_phage(40.0%)	11	NA	NA
AYK11920.1|2896013_2898626_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
AYK11921.1|2899052_2899244_+	DinI family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
AYK11922.1|2899514_2900201_+	virulence protein	NA	NA	NA	NA	NA
AYK11923.1|2900560_2901187_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
AYK11924.1|2901834_2902803_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
AYK11925.1|2903028_2903277_+|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
AYK11926.1|2903280_2903862_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
AYK11927.1|2903861_2905571_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
AYK11928.1|2905567_2906194_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
AYK11929.1|2906177_2906807_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
AYK11930.1|2906827_2907238_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
>prophage 6
CP032851	Salmonella enterica subsp. enterica serovar Enteritidis strain NCM 61 chromosome, complete genome	4679739	2978513	2985826	4679739	protease,integrase	Ralstonia_phage(16.67%)	8	2973311:2973325	2984562:2984576
2973311:2973325	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYK11980.1|2978513_2978891_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
AYK11981.1|2979052_2979250_+	hypothetical protein	NA	NA	NA	NA	NA
AYK11982.1|2979462_2981739_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AYK11983.1|2981769_2982090_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYK11984.1|2982413_2982635_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYK11985.1|2982589_2982784_-	hypothetical protein	NA	NA	NA	NA	NA
AYK11986.1|2982764_2984711_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2984562:2984576	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
AYK11987.1|2984707_2985826_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 1
CP032850	Salmonella enterica subsp. enterica serovar Enteritidis strain NCM 61 plasmid pM0061, complete sequence	59387	24618	46568	59387	integrase,transposase	Escherichia_phage(33.33%)	20	23453:23467	56946:56960
23453:23467	attL	AACAGGAACTGGTGA	NA	NA	NA	NA
AYK09295.1|24618_25401_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
AYK09296.1|25409_26123_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYK09297.1|26126_26636_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
AYK09298.1|26629_27115_+	hypothetical protein	NA	NA	NA	NA	NA
AYK09299.1|27834_28395_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AYK09300.1|28461_28812_-|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
AYK09301.1|28868_29294_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.4	3.4e-24
AYK09302.1|29420_30071_-	SPI-2 type III secretion system effector cysteine hydrolase SpvD	NA	NA	NA	NA	NA
AYK09303.1|33298_34066_-	virulence protein SpvA	NA	NA	NA	NA	NA
AYK09304.1|36091_37129_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AYK09305.1|37317_38343_-	AAA family ATPase	NA	NA	NA	NA	NA
AYK09306.1|38275_39940_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AYK09328.1|39923_40484_-	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	43.2	1.5e-32
AYK09307.1|40690_41431_-	carbonic anhydrase	NA	NA	NA	NA	NA
AYK09308.1|42085_42574_-	cytoplasmic protein	NA	NA	NA	NA	NA
AYK09309.1|42831_43947_+	DNA-binding protein	NA	NA	NA	NA	NA
AYK09329.1|44032_44449_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
AYK09310.1|44632_44968_+	hypothetical protein	NA	NA	NA	NA	NA
AYK09311.1|45024_45630_+	DUF2913 family protein	NA	NA	NA	NA	NA
AYK09312.1|45626_46568_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
56946:56960	attR	TCACCAGTTCCTGTT	NA	NA	NA	NA
