The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032817	Salmonella enterica subsp. enterica strain 11TTU1590 chromosome, complete genome	4985874	1106146	1246294	4985874	transposase,tRNA,tail,lysis,terminase,holin,head,capsid,plate,portal,integrase	Salmonella_phage(53.12%)	163	1211985:1212020	1242882:1242917
AYJ62646.1|1106146_1107236_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	87.7	6.7e-141
AYJ62647.1|1107216_1108328_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	8.4e-06
AYJ62648.1|1108950_1109415_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ62649.1|1109487_1110330_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ62650.1|1110341_1112042_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AYJ62651.1|1112119_1113241_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ62652.1|1113315_1114728_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ66363.1|1115075_1116305_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	89.2	1.0e-214
AYJ62653.1|1116631_1117642_-|integrase	integrase	integrase	F1BUN9	Cronobacter_phage	85.7	9.5e-174
AYJ62654.1|1117641_1118208_-	Repressor protein CI	NA	F1BUN8	Cronobacter_phage	59.7	1.1e-65
AYJ62655.1|1118353_1118557_+	hypothetical protein	NA	F1BUN7	Cronobacter_phage	52.0	1.0e-10
AYJ62656.1|1118594_1119098_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	71.3	1.5e-58
AYJ62657.1|1119107_1119335_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ62658.1|1119324_1119750_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
AYJ62659.1|1119749_1120151_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
AYJ62660.1|1120218_1120449_+	DUF2732 family protein	NA	NA	NA	NA	NA
AYJ62661.1|1120439_1120769_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	2.0e-11
AYJ62662.1|1120758_1121592_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	68.3	1.6e-105
AYJ62663.1|1121588_1123610_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.9	1.9e-298
AYJ62664.1|1123722_1123941_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	49.1	3.6e-06
AYJ62665.1|1123914_1124238_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
AYJ62666.1|1124234_1125296_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	6.0e-163
AYJ62667.1|1125292_1127068_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	82.6	7.0e-289
AYJ62668.1|1127228_1128032_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	56.4	4.1e-79
AYJ62669.1|1128093_1129116_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
AYJ62670.1|1129119_1129821_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
AYJ62671.1|1129866_1130370_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.0	5.2e-64
AYJ62672.1|1130366_1130873_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
AYJ62673.1|1130869_1131577_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.9	6.8e-102
AYJ62674.1|1131573_1132701_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
AYJ62675.1|1132697_1133153_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
AYJ62676.1|1133162_1133456_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
AYJ62677.1|1133452_1133794_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
AYJ62678.1|1133793_1134126_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	6.7e-36
AYJ62679.1|1134097_1134286_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	80.6	1.1e-22
AYJ62680.1|1134272_1134530_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
AYJ62681.1|1134717_1136688_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	68.8	9.2e-266
AYJ62682.1|1136684_1137014_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
AYJ62683.1|1137010_1138195_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
AYJ62684.1|1138181_1138775_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
AYJ62685.1|1138784_1140890_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	69.0	8.8e-198
AYJ66364.1|1140998_1141457_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	93.2	1.6e-75
AYJ62686.1|1141446_1142172_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.0	5.5e-67
AYJ62687.1|1142143_1142689_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
AYJ62688.1|1142688_1144392_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	4.9e-223
AYJ62689.1|1145072_1146191_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ62690.1|1147816_1148065_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ62691.1|1148276_1149323_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ62692.1|1149312_1150353_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	92.7	1.7e-189
AYJ62693.1|1150356_1150989_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.1	1.6e-65
AYJ62694.1|1151105_1151348_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
AYJ62695.1|1151380_1151890_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	93.5	1.9e-82
AYJ62696.1|1151897_1152194_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.4e-21
AYJ62697.1|1152311_1152653_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYJ62698.1|1152720_1152954_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	8.3e-33
AYJ62699.1|1152953_1153181_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
AYJ62700.1|1153177_1154035_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.9	1.9e-162
AYJ62701.1|1154031_1156446_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.6	0.0e+00
AYJ62702.1|1156598_1156787_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
AYJ62703.1|1156725_1157031_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AYJ62704.1|1157090_1157822_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ62705.1|1158161_1159229_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ66365.1|1159231_1159546_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
AYJ62706.1|1159545_1160040_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ62707.1|1160125_1161151_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.9	1.1e-172
AYJ62708.1|1161150_1162917_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYJ62709.1|1163059_1163893_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	6.3e-123
AYJ62710.1|1163909_1164968_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
AYJ62711.1|1164971_1165622_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYJ62712.1|1165717_1166182_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
AYJ62713.1|1166181_1166385_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYJ62714.1|1166388_1166604_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYJ66366.1|1166623_1167097_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYJ62715.1|1167098_1167476_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
AYJ62716.1|1167472_1167901_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	1.4e-46
AYJ62717.1|1167830_1168034_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	1.0e-23
AYJ62718.1|1167996_1168428_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	8.4e-71
AYJ62719.1|1168420_1168867_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.6	6.2e-61
AYJ62720.1|1168935_1169514_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	2.1e-93
AYJ62721.1|1169510_1169870_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
AYJ62722.1|1169856_1170765_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	1.7e-142
AYJ62723.1|1170757_1171363_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
AYJ62724.1|1172739_1172937_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ62725.1|1172905_1173511_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	80.9	1.2e-86
AYJ62726.1|1173510_1174062_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	67.6	5.2e-57
AYJ62727.1|1174089_1174656_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
AYJ62728.1|1174798_1175971_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
AYJ62729.1|1175980_1176496_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.2	2.4e-88
AYJ62730.1|1176550_1176853_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
AYJ62731.1|1176867_1176987_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYJ62732.1|1176979_1180057_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.3	0.0e+00
AYJ62733.1|1180053_1180539_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
AYJ62734.1|1180535_1181636_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	3.4e-177
AYJ62735.1|1181704_1181923_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
AYJ62736.1|1181949_1182432_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	33.1	1.7e-16
AYJ66367.1|1182989_1184153_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYJ62737.1|1184160_1186341_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
AYJ62738.1|1186337_1187747_-	type I secretion protein TolC	NA	NA	NA	NA	NA
AYJ62739.1|1187811_1199286_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
AYJ66368.1|1199905_1200388_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
AYJ62740.1|1200537_1201014_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AYJ62741.1|1201003_1201294_+	RnfH family protein	NA	NA	NA	NA	NA
AYJ62742.1|1201459_1201798_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AYJ62743.1|1201946_1203608_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AYJ66370.1|1203693_1204572_-	NAD(+) kinase	NA	NA	NA	NA	NA
AYJ66369.1|1204695_1205286_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AYJ62744.1|1205320_1205926_-	cytoplasmic protein	NA	NA	NA	NA	NA
AYJ62745.1|1206045_1207287_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AYJ62746.1|1207351_1208143_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AYJ62747.1|1208088_1208385_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ62748.1|1208308_1209670_+	signal recognition particle protein	NA	NA	NA	NA	NA
AYJ66372.1|1209983_1210232_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AYJ66371.1|1210250_1210799_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AYJ62749.1|1210843_1211611_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AYJ62750.1|1211651_1211999_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
1211985:1212020	attL	GAGCGTCTTAACTAAGAACGCGCTTTCGCAACATCC	NA	NA	NA	NA
AYJ62751.1|1212143_1212362_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	100.0	1.2e-38
AYJ62752.1|1212437_1213607_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	97.4	1.7e-211
AYJ62753.1|1213603_1214089_-|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	99.4	1.0e-85
AYJ62754.1|1214103_1216548_-|tail	phage tail tape measure protein	tail	Q6K1G6	Salmonella_virus	94.5	0.0e+00
AYJ62755.1|1216540_1216696_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
AYJ62756.1|1216692_1217028_-|tail	phage tail assembly protein	tail	A0A218M4J8	Erwinia_phage	97.3	2.6e-51
AYJ62757.1|1217090_1217609_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	1.4e-93
AYJ62758.1|1217624_1218803_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	99.5	2.9e-222
AYJ62759.1|1218937_1219486_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	100.0	9.9e-101
AYJ62760.1|1219498_1221475_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	99.2	0.0e+00
AYJ62761.1|1221485_1222016_-|tail	phage tail protein I	tail	Q6K1H3	Salmonella_virus	97.2	1.5e-101
AYJ62762.1|1222008_1222917_-|plate	baseplate assembly protein	plate	Q6K1H4	Salmonella_virus	98.3	7.7e-159
AYJ62763.1|1222923_1223271_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	96.5	1.0e-55
AYJ62764.1|1223267_1223909_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	96.7	5.5e-111
AYJ62765.1|1223977_1224427_-	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	94.6	7.4e-70
AYJ62766.1|1224419_1224887_-|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	100.0	1.1e-84
AYJ62767.1|1224849_1225023_-|lysis	phage lysis protein	lysis	S4TNY4	Salmonella_phage	98.2	2.8e-25
AYJ62768.1|1224994_1225408_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0M4R2N5	Salmonella_phage	97.8	1.2e-45
AYJ62769.1|1225404_1225902_-	lysozyme	NA	S4TUB1	Salmonella_phage	99.4	1.2e-92
AYJ62770.1|1225888_1226185_-|holin	holin	holin	Q6K1I2	Salmonella_virus	100.0	5.8e-47
AYJ62771.1|1226188_1226392_-|tail	phage tail protein	tail	A0A0M3ULF4	Salmonella_phage	100.0	3.6e-32
AYJ62772.1|1226391_1226898_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	98.8	2.9e-91
AYJ62773.1|1226991_1227741_-|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	98.4	1.5e-128
AYJ62774.1|1227744_1228812_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.7	1.2e-198
AYJ62775.1|1228888_1229743_-|capsid	capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	94.7	3.6e-150
AYJ62776.1|1229908_1231681_+	oxidoreductase	NA	S4TT96	Salmonella_phage	99.8	0.0e+00
AYJ62777.1|1231677_1232424_+	hypothetical protein	NA	Q6K1I9	Salmonella_virus	96.8	6.6e-140
AYJ62778.1|1232420_1233443_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	99.7	1.5e-198
AYJ62779.1|1233577_1233760_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ62780.1|1233964_1234159_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	79.7	2.5e-19
AYJ62781.1|1234292_1234502_-	hypothetical protein	NA	Q6K1F0	Salmonella_virus	97.1	2.6e-33
AYJ62782.1|1234697_1234931_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	98.7	8.0e-36
AYJ62783.1|1234934_1235117_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	100.0	4.1e-27
AYJ62784.1|1235234_1237457_-	replication endonuclease	NA	A0A0M3ULG0	Salmonella_phage	95.9	0.0e+00
AYJ62785.1|1237453_1238284_-	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	97.1	7.1e-159
AYJ62786.1|1238287_1238566_-	hypothetical protein	NA	A0A0M4R2Q0	Salmonella_phage	87.0	2.0e-41
AYJ62787.1|1238566_1238788_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	98.6	7.1e-34
AYJ62788.1|1238787_1239015_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	97.3	9.9e-31
AYJ62789.1|1239084_1239285_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	97.0	3.0e-31
AYJ62790.1|1239271_1239499_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	97.3	1.2e-36
AYJ62791.1|1239506_1240016_-	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	98.8	9.5e-90
AYJ62792.1|1240066_1240420_-	Cro/Cl family transcriptional regulator	NA	Q6K1F9	Salmonella_virus	100.0	2.3e-58
AYJ62793.1|1240533_1241379_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	73.7	4.9e-115
AYJ62794.1|1241387_1241726_+	DUF2511 domain-containing protein	NA	A0A0M3ULF8	Salmonella_phage	72.1	1.4e-41
AYJ62795.1|1241750_1242800_+|integrase	integrase	integrase	A0A0M4S6G4	Salmonella_phage	90.3	5.4e-188
AYJ62796.1|1243052_1244273_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
1242882:1242917	attR	GAGCGTCTTAACTAAGAACGCGCTTTCGCAACATCC	NA	NA	NA	NA
AYJ62797.1|1244265_1244784_-	YfiR family protein	NA	NA	NA	NA	NA
AYJ62798.1|1245223_1246294_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
>prophage 2
CP032817	Salmonella enterica subsp. enterica strain 11TTU1590 chromosome, complete genome	4985874	1504561	1541990	4985874	tail,lysis,coat,terminase,portal,protease	Salmonella_phage(77.19%)	59	NA	NA
AYJ63022.1|1504561_1505500_+|protease	omptin family outer membrane protease PgtE	protease	NA	NA	NA	NA
AYJ63023.1|1505521_1505752_-	hypothetical protein	NA	C6ZR23	Salmonella_phage	81.8	1.2e-10
AYJ63024.1|1505761_1505965_-	hypothetical protein	NA	C6ZR24	Salmonella_phage	95.5	4.7e-32
AYJ63025.1|1506061_1506697_-	Eac protein	NA	A0A075B8I7	Enterobacteria_phage	88.2	6.3e-107
AYJ63026.1|1506941_1507208_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	96.6	1.1e-44
AYJ63027.1|1508179_1508437_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	5.9e-40
AYJ63028.1|1508438_1509071_-	ead/Ea22-like family protein	NA	A0A1R3Y5T1	Salmonella_virus	44.5	2.1e-25
AYJ63029.1|1509067_1509478_-	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	94.1	5.7e-69
AYJ63030.1|1509474_1509645_-	DUF2737 family protein	NA	A0A220NQV6	Salmonella_phage	100.0	6.1e-25
AYJ63031.1|1509655_1509949_-	DUF2856 family protein	NA	A0A2H4FNA1	Salmonella_phage	97.9	6.1e-49
AYJ63032.1|1509964_1510513_-	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	99.5	1.0e-105
AYJ63033.1|1510521_1511028_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	90.5	7.3e-82
AYJ63034.1|1511028_1511736_-	recombinase	NA	K7PKU3	Enterobacteria_phage	88.9	9.4e-120
AYJ63035.1|1511744_1511933_-	hypothetical protein	NA	C6ZR38	Salmonella_phage	98.4	3.8e-28
AYJ63036.1|1511929_1512043_-	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
AYJ63037.1|1512035_1512182_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	C6ZR40	Salmonella_phage	97.9	1.5e-19
AYJ63038.1|1512408_1512909_-	HNH endonuclease	NA	A5H1L2	Xanthomonas_virus	44.2	2.6e-31
AYJ63039.1|1512992_1513187_-	restriction endonuclease	NA	E7C9Q6	Salmonella_phage	100.0	2.5e-30
AYJ63040.1|1513265_1513604_-	hypothetical protein	NA	E7C9Q7	Salmonella_phage	96.4	1.0e-55
AYJ63041.1|1513955_1514606_-	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	99.5	2.1e-121
AYJ63042.1|1514686_1514872_+	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
AYJ63043.1|1514978_1515269_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	100.0	2.4e-45
AYJ63044.1|1515437_1516286_+	replication protein	NA	C6ZR51	Salmonella_phage	95.7	8.5e-152
AYJ63045.1|1516396_1518277_+	bifunctional DNA primase/helicase	NA	A0A0M4R313	Salmonella_phage	99.2	0.0e+00
AYJ63046.1|1518277_1518556_+	hypothetical protein	NA	C6ZR54	Salmonella_phage	97.8	1.9e-47
AYJ63047.1|1518611_1519067_+	recombination protein NinB	NA	C6ZR55	Salmonella_phage	95.9	1.8e-76
AYJ63048.1|1519063_1519237_+	protein ninD	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
AYJ63049.1|1519203_1519380_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	98.3	1.8e-27
AYJ63050.1|1519382_1519784_+	hypothetical protein	NA	G9L690	Escherichia_phage	85.0	2.7e-63
AYJ63051.1|1519776_1519953_+	protein ninF	NA	I6S668	Salmonella_phage	93.0	3.1e-24
AYJ63052.1|1519945_1520164_+	hypothetical protein	NA	S4TUE0	Salmonella_phage	68.1	5.6e-23
AYJ63053.1|1520164_1520455_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	100.0	1.7e-51
AYJ63054.1|1520451_1520847_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A220NQY4	Salmonella_phage	96.2	5.5e-69
AYJ63055.1|1520843_1521047_+	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
AYJ63056.1|1521027_1521207_+	hypothetical protein	NA	E7C9S6	Salmonella_phage	96.6	4.6e-23
AYJ63057.1|1521203_1521827_+	antitermination protein	NA	C6ZR62	Salmonella_phage	99.0	1.5e-113
AYJ63058.1|1522100_1522298_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ63059.1|1522385_1522904_+	endodeoxyribonuclease	NA	A0A1V0E5R7	Salmonella_phage	100.0	5.9e-95
AYJ63060.1|1523127_1523400_+	hypothetical protein	NA	A0A1V0E5R8	Salmonella_phage	100.0	1.1e-41
AYJ63061.1|1523399_1523897_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	100.0	1.4e-93
AYJ63062.1|1523893_1524361_+|lysis	lysis protein	lysis	A0A1V0E5Q6	Salmonella_phage	98.7	3.8e-77
AYJ63063.1|1524395_1524620_+	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	88.7	1.6e-25
AYJ63064.1|1524573_1525104_+	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	97.2	5.3e-91
AYJ63065.1|1525360_1525603_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
AYJ63066.1|1525604_1526093_+	hypothetical protein	NA	A0A1B2IBG8	Erwinia_phage	34.2	5.1e-16
AYJ63067.1|1526098_1526587_+	DNA-packaging protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
AYJ63068.1|1526564_1528064_+|terminase	terminase	terminase	A0A1R3Y5N2	Salmonella_virus	100.0	2.8e-307
AYJ63069.1|1528063_1530241_+|portal	portal protein	portal	I6R968	Salmonella_phage	98.2	0.0e+00
AYJ63070.1|1530254_1531166_+	scaffolding protein	NA	A0A1R3Y5R6	Salmonella_virus	99.7	1.1e-160
AYJ63071.1|1531165_1532458_+|coat	coat protein	coat	Q76H21	Enterobacteria_phage	99.1	6.7e-241
AYJ63072.1|1532498_1533059_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.4	7.0e-102
AYJ63073.1|1533042_1533543_+	hypothetical protein	NA	I1TEJ0	Salmonella_phage	98.2	1.2e-89
AYJ63074.1|1533502_1534921_+	hypothetical protein	NA	I1TEJ1	Salmonella_phage	98.7	7.3e-273
AYJ63075.1|1534924_1535563_+|tail	phage tail protein	tail	A0A088CPT1	Enterobacteria_phage	94.8	3.4e-84
AYJ63076.1|1535562_1536018_+	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	99.3	8.8e-87
AYJ63077.1|1536020_1536710_+	DNA transfer protein	NA	B9UDK9	Salmonella_phage	91.7	5.6e-93
AYJ66380.1|1536752_1538090_+	DNA transfer protein	NA	I1TEJ5	Salmonella_phage	98.0	7.7e-240
AYJ63078.1|1538089_1540156_+	DNA transfer protein	NA	B9UDL1	Salmonella_phage	81.1	1.1e-288
AYJ63079.1|1540232_1541990_+	hypothetical protein	NA	A0A0M4RD19	Salmonella_phage	51.6	1.8e-55
>prophage 3
CP032817	Salmonella enterica subsp. enterica strain 11TTU1590 chromosome, complete genome	4985874	1788698	1797869	4985874	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYJ63304.1|1788698_1789646_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.3e-23
AYJ63305.1|1789629_1790361_+	ABC transporter permease	NA	NA	NA	NA	NA
AYJ63306.1|1790341_1790449_-	protein YohO	NA	NA	NA	NA	NA
AYJ63307.1|1790508_1791240_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYJ63308.1|1791462_1793148_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AYJ63309.1|1793144_1793864_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYJ63310.1|1793910_1794378_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.0e-74
AYJ63311.1|1794434_1794965_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AYJ63312.1|1795136_1795595_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYJ63313.1|1795835_1797869_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
CP032817	Salmonella enterica subsp. enterica strain 11TTU1590 chromosome, complete genome	4985874	1970652	1977884	4985874		Morganella_phage(33.33%)	8	NA	NA
AYJ63470.1|1970652_1971072_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AYJ63471.1|1971074_1972343_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	1.9e-227
AYJ63472.1|1972788_1973001_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AYJ66395.1|1973011_1973200_+	cold-shock protein	NA	NA	NA	NA	NA
AYJ63473.1|1973459_1974644_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.1	5.1e-110
AYJ63474.1|1975293_1975605_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ63475.1|1975684_1976380_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AYJ63476.1|1976453_1977884_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
CP032817	Salmonella enterica subsp. enterica strain 11TTU1590 chromosome, complete genome	4985874	2081868	2122470	4985874	head,tail,integrase,lysis	Salmonella_phage(17.39%)	61	2084076:2084105	2125702:2125731
AYJ63586.1|2081868_2082099_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	8.5e-14
AYJ63587.1|2082236_2082611_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AYJ63588.1|2082611_2083487_+	copper resistance D family protein	NA	NA	NA	NA	NA
AYJ63589.1|2083503_2083857_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AYJ63590.1|2083915_2084035_+	hypothetical protein	NA	NA	NA	NA	NA
2084076:2084105	attL	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
AYJ63591.1|2084240_2085320_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.8	1.3e-101
AYJ63592.1|2085294_2085573_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
AYJ66401.1|2085633_2085870_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ63593.1|2086160_2086346_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	59.6	2.9e-12
AYJ63594.1|2086392_2087223_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	2.9e-104
AYJ63595.1|2087215_2089906_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.6	9.8e-117
AYJ63596.1|2090046_2090382_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ63597.1|2090456_2090741_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	1.7e-08
AYJ63598.1|2091160_2091385_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ63599.1|2091698_2092124_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	1.2e-13
AYJ63600.1|2092220_2092475_+	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
AYJ63601.1|2092461_2092956_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ63602.1|2092999_2094007_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	68.1	2.4e-124
AYJ63603.1|2093999_2094461_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.8e-67
AYJ63604.1|2094473_2094869_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.1	1.7e-17
AYJ63605.1|2094865_2095138_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ63606.1|2095341_2095497_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	82.4	2.0e-14
AYJ63607.1|2095746_2095995_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ63608.1|2096058_2096658_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.9	5.0e-98
AYJ63609.1|2096654_2096849_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
AYJ63610.1|2096845_2097127_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	1.7e-35
AYJ63611.1|2097123_2097678_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	64.6	2.8e-63
AYJ63612.1|2097623_2097881_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ63613.1|2097923_2098100_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	60.3	1.2e-12
AYJ63614.1|2098150_2098558_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	63.0	1.4e-38
AYJ66402.1|2098707_2099010_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYJ63615.1|2098987_2099527_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	71.8	3.4e-77
AYJ63616.1|2099627_2100092_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	81.7	6.3e-56
AYJ63617.1|2100317_2100500_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
AYJ63618.1|2100570_2101200_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	9.6e-108
AYJ63619.1|2101202_2102822_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	81.2	1.5e-261
AYJ63620.1|2102821_2104342_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.9	3.1e-104
AYJ63621.1|2104382_2105072_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
AYJ63622.1|2105068_2106415_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.2	4.2e-68
AYJ63623.1|2106416_2106899_+	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	1.1e-26
AYJ63624.1|2106898_2107927_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
AYJ63625.1|2107930_2108278_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.0e-10
AYJ63626.1|2108284_2108740_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.8	2.4e-15
AYJ63627.1|2108733_2109318_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	3.2e-17
AYJ63628.1|2109314_2109680_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	39.7	8.8e-21
AYJ63629.1|2109664_2110210_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ63630.1|2110190_2111675_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	4.0e-96
AYJ63631.1|2111675_2112122_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
AYJ63632.1|2112121_2112526_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	8.2e-20
AYJ63633.1|2112567_2112750_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AYJ63634.1|2112733_2114905_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
AYJ63635.1|2114901_2115612_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	5.0e-28
AYJ63636.1|2115611_2115914_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	50.5	2.4e-24
AYJ63637.1|2115910_2116780_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
AYJ63638.1|2116760_2117438_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.0	1.6e-31
AYJ63639.1|2117450_2117807_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
AYJ63640.1|2117803_2119045_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.9	9.1e-102
AYJ63641.1|2119046_2119649_+	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.2	5.9e-30
AYJ63642.1|2119638_2121090_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	70.2	7.3e-42
AYJ63643.1|2121086_2121911_+|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	93.4	1.2e-150
AYJ63644.1|2121900_2122470_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.4	4.2e-94
2125702:2125731	attR	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
>prophage 6
CP032817	Salmonella enterica subsp. enterica strain 11TTU1590 chromosome, complete genome	4985874	2680722	2729056	4985874	tRNA,tail,lysis,terminase,head,capsid,portal,protease	Salmonella_phage(43.33%)	68	NA	NA
AYJ64176.1|2680722_2683110_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AYJ64177.1|2683125_2684109_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
AYJ66429.1|2684245_2684290_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AYJ64178.1|2684410_2684767_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AYJ64179.1|2684817_2685015_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AYJ64180.1|2685110_2685653_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
AYJ64181.1|2685656_2687585_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.6	1.6e-129
AYJ64182.1|2687916_2689185_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	95.0	2.9e-236
AYJ64183.1|2689187_2689607_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.8	3.8e-36
AYJ64184.1|2689843_2691142_-|tail	phage tail protein	tail	I6R0Q9	Salmonella_phage	99.1	5.0e-244
AYJ64185.1|2691152_2692112_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.7	2.8e-183
AYJ64186.1|2692120_2694841_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	99.9	0.0e+00
AYJ64187.1|2694840_2695239_-	hypothetical protein	NA	S4TR39	Salmonella_phage	94.7	2.9e-70
AYJ64188.1|2695245_2695830_-	hypothetical protein	NA	S4TND4	Salmonella_phage	96.9	1.0e-103
AYJ64189.1|2695829_2696423_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	99.0	4.3e-110
AYJ64190.1|2696585_2696840_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ64191.1|2697210_2700501_-|tail	phage tail tape measure protein	tail	Q9MCS3	Enterobacteria_phage	69.6	0.0e+00
AYJ64192.1|2700564_2701164_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ64193.1|2701231_2701528_-	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	100.0	2.9e-46
AYJ64194.1|2701539_2701911_-|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	90.9	4.4e-60
AYJ64195.1|2701938_2702643_-|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	74.4	4.4e-93
AYJ64196.1|2702699_2703047_-	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	96.5	5.5e-57
AYJ64197.1|2703043_2703493_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	95.3	3.5e-72
AYJ64198.1|2703489_2703828_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	6.6e-39
AYJ64199.1|2703837_2704164_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	85.2	5.2e-49
AYJ64200.1|2704163_2704388_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	2.5e-10
AYJ64201.1|2704431_2705649_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.9	6.0e-199
AYJ64202.1|2705658_2706507_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	87.9	1.3e-131
AYJ64203.1|2706520_2707828_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.1	9.3e-214
AYJ64204.1|2707827_2709570_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.3	5.9e-139
AYJ64205.1|2709523_2709988_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.3e-48
AYJ64206.1|2710120_2710465_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	75.7	1.0e-47
AYJ64207.1|2710583_2711051_-|lysis	lysis protein	lysis	A0A1V0E5Q6	Salmonella_phage	98.7	3.8e-77
AYJ64208.1|2711047_2711545_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	100.0	1.4e-93
AYJ64209.1|2711544_2711817_-	hypothetical protein	NA	A0A1V0E5R8	Salmonella_phage	98.9	5.7e-41
AYJ64210.1|2712040_2712559_-	endodeoxyribonuclease	NA	A0A1V0E5R7	Salmonella_phage	100.0	5.9e-95
AYJ64211.1|2712646_2712844_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ64212.1|2713111_2713885_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	99.6	5.3e-132
AYJ64213.1|2713881_2714064_-	hypothetical protein	NA	C6ZR61	Salmonella_phage	95.0	6.1e-23
AYJ64214.1|2714051_2714522_-	hypothetical protein	NA	C6ZR60	Salmonella_phage	100.0	7.9e-91
AYJ64215.1|2714502_2714739_-	hypothetical protein	NA	C6ZR59	Salmonella_phage	88.5	3.4e-34
AYJ64216.1|2714731_2714902_-	NinF family protein	NA	I6R994	Salmonella_phage	87.0	7.4e-23
AYJ64217.1|2714898_2715075_-	NinE family protein	NA	I6RSI9	Salmonella_phage	98.3	1.5e-26
AYJ64218.1|2715071_2715482_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	100.0	3.2e-72
AYJ64219.1|2715453_2715810_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	96.5	4.6e-59
AYJ64220.1|2716026_2716107_-	histone H1	NA	Q9MCP6	Enterobacteria_phage	96.2	1.7e-06
AYJ64221.1|2716106_2717558_-	helicase DnaB	NA	Q7Y2K5	Escherichia_phage	99.2	7.2e-276
AYJ64222.1|2717532_2718423_-	DNA replication protein	NA	Q716D3	Shigella_phage	99.3	3.8e-158
AYJ64223.1|2718605_2718884_-	hypothetical protein	NA	K7P8A8	Enterobacteria_phage	100.0	1.1e-42
AYJ64224.1|2718992_2719187_-	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	98.4	6.7e-28
AYJ64225.1|2719293_2720010_+	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
AYJ64226.1|2720027_2720396_+	hypothetical protein	NA	K7P6G1	Enterobacteria_phage	99.2	1.3e-56
AYJ64227.1|2720971_2721277_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	91.8	2.9e-25
AYJ66430.1|2721285_2721552_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ64228.1|2721607_2722057_+	hypothetical protein	NA	I6RSN8	Salmonella_phage	89.3	8.7e-71
AYJ64229.1|2722135_2722606_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	98.7	3.1e-87
AYJ64230.1|2722695_2722971_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	100.0	1.6e-46
AYJ64231.1|2723225_2723933_+	recombinase	NA	K7PKU3	Enterobacteria_phage	88.5	1.6e-119
AYJ64232.1|2723932_2724217_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
AYJ64233.1|2724263_2724557_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	97.9	8.8e-48
AYJ64234.1|2724567_2724738_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
AYJ64235.1|2724734_2725232_+	ead/Ea22-like family protein	NA	A0A0N6WGF1	Salmonella_phage	82.4	3.5e-73
AYJ64236.1|2725228_2725459_+	hypothetical protein	NA	G8C7U9	Escherichia_phage	89.3	5.5e-29
AYJ64237.1|2725455_2725701_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	92.3	1.0e-33
AYJ64238.1|2725697_2726465_+	ead/Ea22-like family protein	NA	A0A075B8K3	Enterobacteria_phage	60.1	1.3e-69
AYJ64239.1|2726466_2726724_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	5.9e-40
AYJ64240.1|2727653_2727899_+	helix-turn-helix domain-containing protein	NA	A0A1P8DTG1	Proteus_phage	56.7	9.1e-14
AYJ64241.1|2727844_2729056_-	DUF4102 domain-containing protein	NA	I6R9B6	Salmonella_phage	99.3	2.1e-236
>prophage 7
CP032817	Salmonella enterica subsp. enterica strain 11TTU1590 chromosome, complete genome	4985874	2960959	3007452	4985874	tail,lysis,terminase,head,integrase,protease	Salmonella_phage(45.28%)	69	2957897:2957910	3008374:3008387
2957897:2957910	attL	CACGCTGCAAACGC	NA	NA	NA	NA
AYJ66441.1|2960959_2961280_-	hypothetical protein	NA	E5G6P3	Salmonella_phage	76.6	6.8e-09
AYJ64486.1|2961303_2961540_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ64487.1|2961930_2962806_+	SPI-2 type III secretion system effector PipB	NA	NA	NA	NA	NA
AYJ64488.1|2963027_2963708_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.6e-82
AYJ64489.1|2964096_2964363_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	78.4	7.3e-33
AYJ64490.1|2964419_2965067_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ66442.1|2965109_2965307_-	hypothetical protein	NA	S4TTF2	Salmonella_phage	97.0	1.4e-09
AYJ64491.1|2965932_2966325_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	37.4	8.5e-14
AYJ64492.1|2966434_2967043_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	44.7	1.1e-31
AYJ64493.1|2967105_2967291_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ64494.1|2967539_2968058_-|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	53.8	2.0e-47
AYJ64495.1|2968072_2969605_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	66.2	1.4e-128
AYJ64496.1|2969604_2970285_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	96.0	5.5e-125
AYJ64497.1|2970281_2971481_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	96.7	5.5e-213
AYJ64498.1|2971481_2971835_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	95.7	3.0e-58
AYJ64499.1|2971834_2972587_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	69.8	9.7e-91
AYJ64500.1|2972705_2973161_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ64501.1|2973244_2973577_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	69.1	1.7e-23
AYJ64502.1|2973573_2974641_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	91.5	2.0e-174
AYJ64503.1|2974643_2974946_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	100.0	4.2e-53
AYJ64504.1|2974945_2975521_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	99.5	9.1e-97
AYJ64505.1|2975520_2977530_-	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	95.2	0.0e+00
AYJ66443.1|2977519_2977696_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	72.9	4.7e-12
AYJ64506.1|2977707_2978160_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	78.7	1.3e-61
AYJ64507.1|2978163_2978604_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	73.3	2.5e-54
AYJ64508.1|2978615_2979761_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.8	5.9e-164
AYJ64509.1|2979764_2980310_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	50.8	7.4e-48
AYJ64510.1|2980302_2980707_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	69.2	4.1e-43
AYJ64511.1|2980706_2981216_-	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	40.7	8.5e-22
AYJ64512.1|2981212_2981623_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	57.4	2.5e-32
AYJ64513.1|2981591_2981960_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ64514.1|2982009_2982957_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	55.9	1.2e-98
AYJ64515.1|2982968_2983472_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	46.4	3.4e-31
AYJ64516.1|2983483_2984761_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	42.8	1.6e-77
AYJ64517.1|2984812_2985346_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	5.5e-48
AYJ64518.1|2985416_2986886_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	55.7	1.1e-157
AYJ64519.1|2986925_2988344_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	70.0	6.8e-186
AYJ64520.1|2988309_2989062_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	55.2	2.6e-11
AYJ66444.1|2989125_2989314_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
AYJ64521.1|2989626_2990094_-|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	80.6	2.5e-60
AYJ64522.1|2990090_2991002_-	site-specific DNA-methyltransferase	NA	A0A088FRS2	Escherichia_phage	53.0	3.2e-88
AYJ64523.1|2990998_2991487_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	68.1	4.6e-57
AYJ66445.1|2991464_2991767_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYJ64524.1|2991969_2992158_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ64525.1|2992550_2993129_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.0	2.4e-44
AYJ64526.1|2993125_2993419_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	65.3	2.1e-33
AYJ64527.1|2993415_2994012_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	73.7	1.5e-81
AYJ64528.1|2994080_2994272_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ64529.1|2994455_2994794_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	86.6	3.7e-50
AYJ64530.1|2994793_2994964_-	methyltransferase	NA	I6S1S6	Salmonella_phage	87.5	6.3e-06
AYJ64531.1|2994960_2995563_-	adenine methylase	NA	G9L699	Escherichia_phage	87.3	1.7e-98
AYJ64532.1|2995555_2995804_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ64533.1|2995807_2996488_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ64534.1|2996525_2997914_-	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	47.1	1.2e-105
AYJ64535.1|2997910_2998891_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	80.6	2.3e-44
AYJ64536.1|2998893_2999118_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	44.7	1.0e-08
AYJ64537.1|2999140_2999587_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	50.4	5.5e-25
AYJ66446.1|2999521_2999737_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ64538.1|2999651_2999885_-	XRE family transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	48.6	6.2e-12
AYJ64539.1|2999983_3000448_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.7	2.7e-35
AYJ64540.1|3001132_3001456_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ64541.1|3001463_3001709_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	53.8	3.5e-13
AYJ64542.1|3001738_3004012_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.0	9.4e-105
AYJ64543.1|3004008_3004563_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	59.3	1.3e-47
AYJ64544.1|3004565_3004748_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ64545.1|3004797_3004995_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	58.5	8.3e-10
AYJ64546.1|3004960_3005185_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AYJ64547.1|3005185_3006205_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	53.5	1.2e-91
AYJ64548.1|3006792_3007452_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
3008374:3008387	attR	CACGCTGCAAACGC	NA	NA	NA	NA
>prophage 8
CP032817	Salmonella enterica subsp. enterica strain 11TTU1590 chromosome, complete genome	4985874	3240986	3282944	4985874	tail,lysis,terminase,coat,holin,portal,integrase	Salmonella_phage(68.85%)	69	3240537:3240558	3283010:3283031
3240537:3240558	attL	CGTTCAACTTAGTATAAAAAAG	NA	NA	NA	NA
AYJ64748.1|3240986_3241349_+	GtrA family protein	NA	I1TED9	Salmonella_phage	82.5	6.2e-51
AYJ64749.1|3241345_3242263_+	glycosyltransferase	NA	I1TED8	Salmonella_phage	92.7	2.9e-161
AYJ64750.1|3242259_3243711_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ64751.1|3243746_3245507_-	hypothetical protein	NA	I6S5Y0	Salmonella_phage	88.3	3.0e-58
AYJ64752.1|3245606_3246485_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	78.9	1.1e-96
AYJ64753.1|3246547_3246721_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AYJ64754.1|3246809_3247046_+	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	59.2	2.2e-17
AYJ64755.1|3247042_3247252_+	hypothetical protein	NA	I6R975	Salmonella_phage	98.6	5.9e-30
AYJ64756.1|3247226_3247412_-	hypothetical protein	NA	I6RSG3	Salmonella_phage	100.0	1.1e-08
AYJ64757.1|3247437_3247662_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ64758.1|3247675_3248041_-	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	100.0	2.1e-67
AYJ64759.1|3248071_3248260_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ64760.1|3248277_3250143_-	DNA transfer protein	NA	A0A2H4FNB8	Salmonella_phage	98.4	0.0e+00
AYJ64761.1|3250142_3251540_-	DNA transfer protein	NA	A0A2H4FND5	Salmonella_phage	85.8	6.9e-215
AYJ64762.1|3251550_3252243_-	DNA transfer protein	NA	A0A0M4RTU3	Salmonella_phage	96.1	3.7e-105
AYJ64763.1|3252245_3252701_-	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	99.3	6.7e-87
AYJ64764.1|3252700_3253339_-|tail	phage tail protein	tail	A0A088CPT1	Enterobacteria_phage	99.1	7.0e-90
AYJ64765.1|3253342_3254761_-	hypothetical protein	NA	I1TEJ1	Salmonella_phage	98.9	1.5e-273
AYJ64766.1|3254720_3255221_-	hypothetical protein	NA	I1TEJ0	Salmonella_phage	98.2	1.2e-89
AYJ64767.1|3255204_3255765_-	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.4	7.0e-102
AYJ64768.1|3255805_3257098_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	99.3	1.8e-241
AYJ64769.1|3257097_3258009_-	scaffolding protein	NA	A0A1R3Y5R6	Salmonella_virus	99.7	1.1e-160
AYJ64770.1|3258022_3260200_-|portal	portal protein	portal	I6R968	Salmonella_phage	98.2	0.0e+00
AYJ64771.1|3260199_3261699_-|terminase	terminase	terminase	A0A0M4S5Z3	Salmonella_phage	99.6	3.1e-306
AYJ64772.1|3261676_3262165_-	DNA-packaging protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
AYJ64773.1|3262168_3262573_-	Decoration protein	NA	C6ZR73	Salmonella_phage	99.3	1.5e-66
AYJ64774.1|3262575_3262818_-	DUF2560 family protein	NA	A0A1R3Y5V5	Salmonella_virus	100.0	1.7e-36
AYJ64775.1|3262921_3263302_-	hypothetical protein	NA	Q716B1	Shigella_phage	99.2	1.4e-66
AYJ64776.1|3263585_3264104_-	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	100.0	3.2e-93
AYJ64777.1|3264309_3264747_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	95.9	4.2e-70
AYJ64778.1|3264743_3265220_-	lysozyme	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
AYJ64779.1|3265203_3265527_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AYJ64780.1|3265764_3265962_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ64781.1|3266234_3266858_-	antitermination protein	NA	C6ZR62	Salmonella_phage	98.1	9.8e-113
AYJ64782.1|3266854_3267034_-	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	100.0	7.1e-24
AYJ64783.1|3267014_3267218_-	protein ninH	NA	I6RSQ6	Salmonella_phage	97.0	1.4e-31
AYJ64784.1|3267214_3267439_-	protein ninY	NA	I6R0N9	Salmonella_phage	98.6	1.8e-37
AYJ64785.1|3267435_3268092_-	HNH endonuclease	NA	A0A2I7QND8	Vibrio_phage	45.4	3.4e-39
AYJ64786.1|3268088_3268484_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	97.7	2.2e-70
AYJ64787.1|3268480_3268777_-	hypothetical protein	NA	A0A0M3ULJ7	Salmonella_phage	97.8	7.5e-47
AYJ64788.1|3268739_3268916_-	NinF family protein	NA	A0A0M4S6T3	Salmonella_phage	96.6	1.8e-27
AYJ64789.1|3268912_3269089_-	NinE family protein	NA	I6RSI9	Salmonella_phage	100.0	2.3e-27
AYJ64790.1|3269055_3269229_-	protein ninD	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
AYJ64791.1|3269225_3269663_-	recombination protein NinB	NA	A0A192Y6T2	Salmonella_phage	98.6	9.4e-78
AYJ64792.1|3269677_3269884_-	hypothetical protein	NA	I1TEG6	Salmonella_phage	98.5	2.7e-35
AYJ64793.1|3269887_3270172_-	hypothetical protein	NA	A0A2H4FNE3	Salmonella_phage	57.8	4.9e-27
AYJ64794.1|3270171_3270366_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ64795.1|3270439_3270718_-	hypothetical protein	NA	Q5G8S7	Enterobacteria_phage	93.5	1.0e-45
AYJ64796.1|3270718_3272599_-	bifunctional DNA primase/helicase	NA	I6S1U6	Salmonella_phage	97.9	0.0e+00
AYJ64797.1|3272706_3273555_-	replication protein	NA	C6ZR51	Salmonella_phage	94.7	8.0e-150
AYJ64798.1|3273737_3274016_-	hypothetical protein	NA	A0A220NRS4	Escherichia_phage	93.5	2.2e-40
AYJ64799.1|3274123_3274339_-	XRE family transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
AYJ66454.1|3274457_3275120_+	LexA family transcriptional regulator	NA	A0A0M4QWY1	Salmonella_phage	99.1	1.8e-125
AYJ64800.1|3275487_3275820_+	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	95.5	1.0e-52
AYJ64801.1|3275828_3276299_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	98.7	3.1e-87
AYJ64802.1|3276458_3276713_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ64803.1|3276798_3276933_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	78.0	2.1e-09
AYJ64804.1|3276917_3277112_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ64805.1|3277199_3277388_+	hypothetical protein	NA	C6ZR38	Salmonella_phage	82.3	1.7e-23
AYJ64806.1|3277396_3278104_+	recombinase	NA	A0A2H4FN95	Salmonella_phage	89.4	5.0e-121
AYJ64807.1|3278103_3278388_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
AYJ64808.1|3278434_3278728_+	DUF2856 family protein	NA	A0A2H4FNA1	Salmonella_phage	96.9	1.4e-48
AYJ64809.1|3278738_3278909_+	DUF2737 family protein	NA	A0A220NQV6	Salmonella_phage	98.2	1.3e-24
AYJ64810.1|3278905_3279316_+	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	94.1	4.4e-69
AYJ64811.1|3279312_3279945_+	ead/Ea22-like family protein	NA	A0A1R3Y5T1	Salmonella_virus	44.5	2.7e-25
AYJ64812.1|3279946_3280204_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	5.9e-40
AYJ64813.1|3281088_3281355_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	96.6	6.3e-45
AYJ64814.1|3281677_3281896_+	excisionase	NA	A0A1V0E5M4	Salmonella_phage	100.0	5.7e-36
AYJ64815.1|3281873_3282944_+|integrase	integrase	integrase	A0A1V0E5M7	Salmonella_phage	100.0	1.0e-154
3283010:3283031	attR	CGTTCAACTTAGTATAAAAAAG	NA	NA	NA	NA
>prophage 9
CP032817	Salmonella enterica subsp. enterica strain 11TTU1590 chromosome, complete genome	4985874	4542758	4590405	4985874	plate,tRNA,tail	Burkholderia_phage(36.36%)	51	NA	NA
AYJ65925.1|4542758_4543757_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AYJ65926.1|4543844_4545155_-	conjugal transfer protein	NA	NA	NA	NA	NA
AYJ65927.1|4545401_4545917_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
AYJ65928.1|4546015_4546225_-	CsbD family protein	NA	NA	NA	NA	NA
AYJ66503.1|4546246_4546360_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ65929.1|4546356_4547682_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
AYJ65930.1|4547860_4548469_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
AYJ65931.1|4548577_4548946_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AYJ65932.1|4549116_4551537_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AYJ65933.1|4551635_4552508_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AYJ65934.1|4552521_4553019_-	chorismate lyase	NA	NA	NA	NA	NA
AYJ65935.1|4553199_4554117_-	maltose operon protein MalM	NA	NA	NA	NA	NA
AYJ65936.1|4554280_4555636_-	maltoporin	NA	NA	NA	NA	NA
AYJ65937.1|4555724_4556834_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
AYJ65938.1|4557195_4558386_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
AYJ65939.1|4558517_4560062_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
AYJ65940.1|4560076_4560967_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
AYJ65941.1|4561132_4561543_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AYJ65942.1|4561685_4563782_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AYJ65943.1|4563781_4564519_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ65944.1|4564515_4565154_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AYJ65945.1|4565217_4565460_-	outer membrane protein	NA	NA	NA	NA	NA
AYJ65946.1|4565903_4567553_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYJ65947.1|4567941_4569291_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AYJ65948.1|4569425_4569773_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	52.6	7.5e-22
AYJ65949.1|4570349_4570637_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
AYJ65950.1|4570639_4571245_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	58.8	1.0e-58
AYJ65951.1|4571257_4571572_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
AYJ65952.1|4571731_4572187_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ65953.1|4572183_4572381_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	5.1e-07
AYJ65954.1|4572370_4573798_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	1.8e-194
AYJ65955.1|4573797_4574322_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	1.8e-67
AYJ65956.1|4574373_4574691_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AYJ65957.1|4574650_4574779_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AYJ65958.1|4574875_4577230_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.5	3.4e-65
AYJ65959.1|4577229_4578183_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
AYJ65960.1|4578182_4578392_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AYJ65961.1|4578379_4579423_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.6	1.5e-76
AYJ65962.1|4579432_4580155_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
AYJ65963.1|4580163_4580406_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ65964.1|4580481_4580844_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
AYJ65965.1|4580840_4581770_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
AYJ65966.1|4581769_4583317_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	30.4	5.0e-49
AYJ65967.1|4583480_4583840_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
AYJ65968.1|4583830_4584946_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.7	3.1e-101
AYJ65969.1|4584938_4585571_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
AYJ65970.1|4585573_4587232_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	8.0e-53
AYJ65971.1|4587238_4587853_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
AYJ65972.1|4587849_4588305_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ66504.1|4588681_4589098_+	serine acetyltransferase	NA	NA	NA	NA	NA
AYJ65973.1|4589676_4590405_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 10
CP032817	Salmonella enterica subsp. enterica strain 11TTU1590 chromosome, complete genome	4985874	4659989	4755783	4985874	tRNA,tail,lysis,terminase,holin,head,plate,capsid,portal,integrase	Escherichia_phage(38.3%)	100	4720099:4720145	4750837:4750883
AYJ66024.1|4659989_4661090_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
AYJ66025.1|4661136_4661496_-	YijD family membrane protein	NA	NA	NA	NA	NA
AYJ66026.1|4661511_4662147_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
AYJ66027.1|4662148_4662337_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ66028.1|4662345_4663746_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
AYJ66029.1|4663728_4664646_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
AYJ66030.1|4664929_4666306_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AYJ66031.1|4666423_4667200_-	acetylglutamate kinase	NA	NA	NA	NA	NA
AYJ66032.1|4667207_4668212_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AYJ66033.1|4668300_4669452_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
AYJ66034.1|4669843_4672495_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AYJ66035.1|4672705_4674439_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
AYJ66036.1|4674599_4675436_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYJ66037.1|4675690_4676353_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	2.5e-29
AYJ66038.1|4676364_4677468_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
AYJ66039.1|4677726_4678350_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
AYJ66040.1|4678407_4680588_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
AYJ66041.1|4680752_4681643_-	5,10-methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AYJ66042.1|4681837_4683394_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AYJ66043.1|4683529_4684654_+	cytoplasmic protein	NA	NA	NA	NA	NA
AYJ66044.1|4684888_4685887_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ66045.1|4685889_4686747_+	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
AYJ66046.1|4686872_4689305_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
AYJ66047.1|4689307_4690468_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AYJ66048.1|4690732_4691050_+	met repressor	NA	NA	NA	NA	NA
AYJ66049.1|4691506_4693297_+	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
AYJ66506.1|4693589_4693775_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ66050.1|4694292_4694505_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
AYJ66051.1|4694708_4696907_+	primosomal protein N'	NA	NA	NA	NA	NA
AYJ66052.1|4697061_4698087_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
AYJ66053.1|4698180_4699155_+	cell division protein FtsN	NA	NA	NA	NA	NA
AYJ66054.1|4699246_4699777_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AYJ66055.1|4699786_4701118_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
AYJ66056.1|4701184_4702114_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AYJ66057.1|4702206_4702692_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AYJ66058.1|4702913_4703153_-	cell division protein ZapB	NA	NA	NA	NA	NA
AYJ66059.1|4703551_4704397_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
AYJ66060.1|4704417_4705926_+	glycerol kinase	NA	NA	NA	NA	NA
AYJ66061.1|4706037_4707048_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
AYJ66062.1|4707144_4707891_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AYJ66063.1|4708000_4708429_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
AYJ66064.1|4708529_4709126_+	DUF1454 family protein	NA	NA	NA	NA	NA
AYJ66065.1|4709238_4710006_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
AYJ66066.1|4710115_4711420_-	citrate transporter	NA	NA	NA	NA	NA
AYJ66507.1|4711517_4712240_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYJ66067.1|4712302_4713343_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
AYJ66068.1|4713352_4714312_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
AYJ66069.1|4714322_4715657_-	MFS transporter	NA	NA	NA	NA	NA
AYJ66070.1|4715921_4716677_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
AYJ66071.1|4716777_4717767_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYJ66072.1|4717970_4718933_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
AYJ66073.1|4719117_4720020_-	cation-efflux pump FieF	NA	NA	NA	NA	NA
4720099:4720145	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
AYJ66074.1|4720256_4720511_-	DNA-binding transcriptional regulator	NA	M1SNR2	Escherichia_phage	100.0	1.3e-44
AYJ66075.1|4720556_4721720_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	7.0e-205
AYJ66076.1|4721719_4722199_-|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
AYJ66077.1|4722213_4724661_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	94.8	0.0e+00
AYJ66078.1|4724653_4724773_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AYJ66079.1|4724805_4725081_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AYJ66080.1|4725137_4725656_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AYJ66081.1|4725668_4726859_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	4.8e-225
AYJ66082.1|4726918_4727512_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	1.8e-103
AYJ66508.1|4727731_4728220_+|tail	phage tail protein	tail	A0A1S6KZZ0	Salmonella_phage	82.6	2.1e-70
AYJ66083.1|4728189_4728807_+|tail	tail assembly chaperone	tail	A0A1S6KZY8	Salmonella_phage	83.6	5.3e-95
AYJ66084.1|4728811_4729345_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	80.3	5.7e-77
AYJ66085.1|4729347_4730910_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	49.4	1.5e-154
AYJ66086.1|4730966_4731518_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.5e-104
AYJ66087.1|4731510_4732419_-|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	100.0	8.8e-163
AYJ66088.1|4732423_4732771_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
AYJ66089.1|4732767_4733403_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	9.0e-114
AYJ66090.1|4733469_4733922_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
AYJ66091.1|4733914_4734382_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	8.7e-82
AYJ66092.1|4734344_4734518_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
AYJ66093.1|4734489_4734915_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	4.7e-66
AYJ66094.1|4734902_4735328_-	protein lysA	NA	U5N096	Enterobacteria_phage	95.7	2.8e-58
AYJ66095.1|4735342_4735840_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AYJ66096.1|4735839_4736121_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
AYJ66097.1|4736124_4736328_-|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
AYJ66098.1|4736327_4736837_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AYJ66099.1|4736936_4737680_-|terminase	terminase	terminase	Q94MH3	Enterobacteria_phage	98.0	3.1e-121
AYJ66100.1|4737683_4738757_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	100.0	6.7e-202
AYJ66101.1|4738815_4739670_-|capsid	capsid scaffolding protein	capsid	Q94MF5	Enterobacteria_phage	99.6	2.2e-139
AYJ66102.1|4739843_4741616_+	oxidoreductase	NA	A0A0F7LCM8	Escherichia_phage	99.8	0.0e+00
AYJ66103.1|4741615_4742650_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	4.2e-201
AYJ66104.1|4742990_4744823_-	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	32.5	4.1e-90
AYJ66105.1|4744939_4747222_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.4	0.0e+00
AYJ66106.1|4747211_4747487_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	97.8	1.6e-43
AYJ66107.1|4747483_4747708_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	97.3	8.5e-35
AYJ66108.1|4747707_4748010_-	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	97.0	2.5e-45
AYJ66109.1|4748009_4748234_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	2.3e-32
AYJ66110.1|4748297_4748798_-	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
AYJ66111.1|4748967_4749240_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
AYJ66112.1|4749376_4749670_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
AYJ66113.1|4749739_4750720_+|integrase	integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
AYJ66114.1|4750905_4751406_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4750837:4750883	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
AYJ66115.1|4751556_4752255_+	DNA-binding transcriptional regulator CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
AYJ66116.1|4752251_4753625_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
AYJ66117.1|4753672_4753876_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ66118.1|4753996_4754392_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AYJ66119.1|4754403_4755156_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AYJ66120.1|4755162_4755783_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
