The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032815	Salmonella enterica subsp. enterica strain 11TTU1615b chromosome, complete genome	4985867	1106145	1246291	4985867	transposase,tail,tRNA,terminase,capsid,head,holin,portal,lysis,plate,integrase	Salmonella_phage(52.71%)	164	1211982:1212017	1242879:1242914
AYJ53361.1|1106145_1107235_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	87.7	6.7e-141
AYJ53362.1|1107215_1108327_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	8.4e-06
AYJ53363.1|1108949_1109414_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ53364.1|1109486_1110329_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ53365.1|1110340_1112041_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AYJ53366.1|1112118_1113240_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ53367.1|1113314_1114727_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ57075.1|1115074_1116304_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	89.2	1.0e-214
AYJ53368.1|1116630_1117641_-|integrase	integrase	integrase	F1BUN9	Cronobacter_phage	85.7	9.5e-174
AYJ53369.1|1117640_1118207_-	Repressor protein CI	NA	F1BUN8	Cronobacter_phage	59.7	1.1e-65
AYJ53370.1|1118352_1118556_+	hypothetical protein	NA	F1BUN7	Cronobacter_phage	52.0	1.0e-10
AYJ53371.1|1118593_1119097_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	71.3	1.5e-58
AYJ53372.1|1119106_1119334_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ53373.1|1119323_1119749_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
AYJ53374.1|1119748_1120150_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
AYJ53375.1|1120217_1120448_+	DUF2732 family protein	NA	NA	NA	NA	NA
AYJ53376.1|1120438_1120768_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	2.0e-11
AYJ53377.1|1120757_1121591_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	68.3	1.6e-105
AYJ53378.1|1121587_1123609_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.9	1.9e-298
AYJ53379.1|1123721_1123940_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	49.1	3.6e-06
AYJ53380.1|1123913_1124237_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
AYJ53381.1|1124233_1125295_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	6.0e-163
AYJ53382.1|1125291_1127067_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	82.6	7.0e-289
AYJ53383.1|1127227_1128031_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	56.4	4.1e-79
AYJ53384.1|1128092_1129115_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
AYJ53385.1|1129118_1129820_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
AYJ53386.1|1129865_1130369_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.0	5.2e-64
AYJ53387.1|1130365_1130872_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
AYJ53388.1|1130868_1131576_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.9	6.8e-102
AYJ53389.1|1131572_1132700_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
AYJ53390.1|1132696_1133152_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
AYJ53391.1|1133161_1133455_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
AYJ53392.1|1133451_1133793_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
AYJ53393.1|1133792_1134125_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	6.7e-36
AYJ53394.1|1134096_1134285_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	80.6	1.1e-22
AYJ53395.1|1134271_1134529_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
AYJ53396.1|1134716_1136687_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	68.8	9.2e-266
AYJ53397.1|1136683_1137013_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
AYJ53398.1|1137009_1138194_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
AYJ53399.1|1138180_1138774_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
AYJ53400.1|1138783_1140889_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	69.0	8.8e-198
AYJ57076.1|1140997_1141456_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	93.2	1.6e-75
AYJ53401.1|1141445_1142171_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.0	5.5e-67
AYJ53402.1|1142142_1142688_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
AYJ53403.1|1142687_1144391_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	4.9e-223
AYJ53404.1|1145071_1146190_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ53405.1|1147815_1148064_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ53406.1|1148275_1149322_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ53407.1|1149311_1150352_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	92.7	1.7e-189
AYJ53408.1|1150355_1150988_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.1	1.6e-65
AYJ53409.1|1151104_1151347_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
AYJ53410.1|1151379_1151889_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	93.5	1.9e-82
AYJ53411.1|1151896_1152193_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.4e-21
AYJ53412.1|1152310_1152652_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYJ53413.1|1152719_1152953_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	8.3e-33
AYJ53414.1|1152952_1153180_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
AYJ53415.1|1153176_1154034_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.9	1.9e-162
AYJ53416.1|1154030_1156445_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.6	0.0e+00
AYJ53417.1|1156597_1156786_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
AYJ53418.1|1156724_1157030_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AYJ53419.1|1157089_1157821_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ53420.1|1158160_1159228_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ57077.1|1159230_1159545_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
AYJ53421.1|1159544_1160039_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ53422.1|1160124_1161150_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.9	1.1e-172
AYJ53423.1|1161149_1162916_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYJ53424.1|1163058_1163892_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	6.3e-123
AYJ53425.1|1163908_1164967_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
AYJ53426.1|1164970_1165621_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYJ53427.1|1165716_1166181_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
AYJ53428.1|1166180_1166384_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYJ53429.1|1166387_1166603_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYJ57078.1|1166622_1167096_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYJ53430.1|1167097_1167475_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
AYJ53431.1|1167471_1167900_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	1.4e-46
AYJ53432.1|1167829_1168033_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	1.0e-23
AYJ53433.1|1167995_1168427_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	8.4e-71
AYJ53434.1|1168419_1168866_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.6	6.2e-61
AYJ53435.1|1168934_1169513_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	2.1e-93
AYJ53436.1|1169509_1169869_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
AYJ53437.1|1169855_1170764_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	1.7e-142
AYJ53438.1|1170756_1171362_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
AYJ53439.1|1171358_1172750_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	73.6	2.2e-152
AYJ53440.1|1172736_1172934_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ53441.1|1172902_1173508_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	80.9	1.2e-86
AYJ53442.1|1173507_1174059_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	67.6	5.2e-57
AYJ53443.1|1174086_1174653_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
AYJ53444.1|1174795_1175968_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
AYJ53445.1|1175977_1176493_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.2	2.4e-88
AYJ53446.1|1176547_1176850_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
AYJ53447.1|1176864_1176984_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYJ53448.1|1176976_1180054_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.3	0.0e+00
AYJ53449.1|1180050_1180536_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
AYJ53450.1|1180532_1181633_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	3.4e-177
AYJ53451.1|1181701_1181920_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
AYJ53452.1|1181946_1182429_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	33.1	1.7e-16
AYJ57079.1|1182986_1184150_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYJ53453.1|1184157_1186338_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
AYJ53454.1|1186334_1187744_-	type I secretion protein TolC	NA	NA	NA	NA	NA
AYJ53455.1|1187808_1199283_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
AYJ57080.1|1199902_1200385_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
AYJ53456.1|1200534_1201011_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AYJ53457.1|1201000_1201291_+	RnfH family protein	NA	NA	NA	NA	NA
AYJ53458.1|1201456_1201795_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AYJ53459.1|1201943_1203605_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AYJ57082.1|1203690_1204569_-	NAD(+) kinase	NA	NA	NA	NA	NA
AYJ57081.1|1204692_1205283_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AYJ53460.1|1205317_1205923_-	cytoplasmic protein	NA	NA	NA	NA	NA
AYJ53461.1|1206042_1207284_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AYJ53462.1|1207348_1208140_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AYJ53463.1|1208085_1208382_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ53464.1|1208305_1209667_+	signal recognition particle protein	NA	NA	NA	NA	NA
AYJ57084.1|1209980_1210229_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AYJ57083.1|1210247_1210796_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AYJ53465.1|1210840_1211608_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AYJ53466.1|1211648_1211996_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
1211982:1212017	attL	GAGCGTCTTAACTAAGAACGCGCTTTCGCAACATCC	NA	NA	NA	NA
AYJ53467.1|1212140_1212359_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	100.0	1.2e-38
AYJ53468.1|1212434_1213604_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	97.4	1.7e-211
AYJ53469.1|1213600_1214086_-|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	99.4	1.0e-85
AYJ53470.1|1214100_1216545_-|tail	phage tail tape measure protein	tail	Q6K1G6	Salmonella_virus	94.5	0.0e+00
AYJ53471.1|1216537_1216693_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
AYJ53472.1|1216689_1217025_-|tail	phage tail assembly protein	tail	A0A218M4J8	Erwinia_phage	97.3	2.6e-51
AYJ53473.1|1217087_1217606_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	1.4e-93
AYJ53474.1|1217621_1218800_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	99.5	2.9e-222
AYJ53475.1|1218934_1219483_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	100.0	9.9e-101
AYJ53476.1|1219495_1221472_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	99.2	0.0e+00
AYJ53477.1|1221482_1222013_-|tail	phage tail protein I	tail	Q6K1H3	Salmonella_virus	97.2	1.5e-101
AYJ53478.1|1222005_1222914_-|plate	baseplate assembly protein	plate	Q6K1H4	Salmonella_virus	98.3	7.7e-159
AYJ53479.1|1222920_1223268_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	96.5	1.0e-55
AYJ53480.1|1223264_1223906_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	96.7	5.5e-111
AYJ53481.1|1223974_1224424_-	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	94.6	7.4e-70
AYJ53482.1|1224416_1224884_-|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	100.0	1.1e-84
AYJ53483.1|1224846_1225020_-|lysis	phage lysis protein	lysis	S4TNY4	Salmonella_phage	98.2	2.8e-25
AYJ53484.1|1224991_1225405_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0M4R2N5	Salmonella_phage	97.8	1.2e-45
AYJ53485.1|1225401_1225899_-	lysozyme	NA	S4TUB1	Salmonella_phage	99.4	1.2e-92
AYJ53486.1|1225885_1226182_-|holin	holin	holin	Q6K1I2	Salmonella_virus	100.0	5.8e-47
AYJ53487.1|1226185_1226389_-|tail	phage tail protein	tail	A0A0M3ULF4	Salmonella_phage	100.0	3.6e-32
AYJ53488.1|1226388_1226895_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	98.8	2.9e-91
AYJ53489.1|1226988_1227738_-|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	98.4	1.5e-128
AYJ53490.1|1227741_1228809_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.7	1.2e-198
AYJ53491.1|1228885_1229740_-|capsid	capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	94.7	3.6e-150
AYJ53492.1|1229905_1231678_+	oxidoreductase	NA	S4TT96	Salmonella_phage	99.8	0.0e+00
AYJ53493.1|1231674_1232421_+	hypothetical protein	NA	Q6K1I9	Salmonella_virus	96.8	6.6e-140
AYJ53494.1|1232417_1233440_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	99.7	1.5e-198
AYJ53495.1|1233574_1233757_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ53496.1|1233961_1234156_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	79.7	2.5e-19
AYJ53497.1|1234289_1234499_-	hypothetical protein	NA	Q6K1F0	Salmonella_virus	97.1	2.6e-33
AYJ53498.1|1234694_1234928_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	98.7	8.0e-36
AYJ53499.1|1234931_1235114_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	100.0	4.1e-27
AYJ53500.1|1235231_1237454_-	replication endonuclease	NA	A0A0M3ULG0	Salmonella_phage	95.9	0.0e+00
AYJ53501.1|1237450_1238281_-	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	97.1	7.1e-159
AYJ53502.1|1238284_1238563_-	hypothetical protein	NA	A0A0M4R2Q0	Salmonella_phage	87.0	2.0e-41
AYJ53503.1|1238563_1238785_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	98.6	7.1e-34
AYJ53504.1|1238784_1239012_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	97.3	9.9e-31
AYJ53505.1|1239081_1239282_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	97.0	3.0e-31
AYJ53506.1|1239268_1239496_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	97.3	1.2e-36
AYJ53507.1|1239503_1240013_-	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	98.8	9.5e-90
AYJ53508.1|1240063_1240417_-	Cro/Cl family transcriptional regulator	NA	Q6K1F9	Salmonella_virus	100.0	2.3e-58
AYJ53509.1|1240530_1241376_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	73.7	4.9e-115
AYJ53510.1|1241384_1241723_+	DUF2511 domain-containing protein	NA	A0A0M3ULF8	Salmonella_phage	72.1	1.4e-41
AYJ53511.1|1241747_1242797_+|integrase	integrase	integrase	A0A0M4S6G4	Salmonella_phage	90.3	5.4e-188
AYJ53512.1|1243049_1244270_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	7.5e-08
1242879:1242914	attR	GAGCGTCTTAACTAAGAACGCGCTTTCGCAACATCC	NA	NA	NA	NA
AYJ53513.1|1244262_1244781_-	YfiR family protein	NA	NA	NA	NA	NA
AYJ53514.1|1245220_1246291_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
>prophage 2
CP032815	Salmonella enterica subsp. enterica strain 11TTU1615b chromosome, complete genome	4985867	1504558	1541987	4985867	tail,protease,terminase,portal,lysis,coat	Salmonella_phage(77.19%)	59	NA	NA
AYJ53738.1|1504558_1505497_+|protease	omptin family outer membrane protease PgtE	protease	NA	NA	NA	NA
AYJ53739.1|1505518_1505749_-	hypothetical protein	NA	C6ZR23	Salmonella_phage	81.8	1.2e-10
AYJ53740.1|1505758_1505962_-	hypothetical protein	NA	C6ZR24	Salmonella_phage	95.5	4.7e-32
AYJ53741.1|1506058_1506694_-	Eac protein	NA	A0A075B8I7	Enterobacteria_phage	88.2	6.3e-107
AYJ53742.1|1506938_1507205_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	96.6	1.1e-44
AYJ53743.1|1508176_1508434_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	5.9e-40
AYJ53744.1|1508435_1509068_-	ead/Ea22-like family protein	NA	A0A1R3Y5T1	Salmonella_virus	44.5	2.1e-25
AYJ53745.1|1509064_1509475_-	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	94.1	5.7e-69
AYJ53746.1|1509471_1509642_-	DUF2737 family protein	NA	A0A220NQV6	Salmonella_phage	100.0	6.1e-25
AYJ53747.1|1509652_1509946_-	DUF2856 family protein	NA	A0A2H4FNA1	Salmonella_phage	97.9	6.1e-49
AYJ53748.1|1509961_1510510_-	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	99.5	1.0e-105
AYJ53749.1|1510518_1511025_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	90.5	7.3e-82
AYJ53750.1|1511025_1511733_-	recombinase	NA	K7PKU3	Enterobacteria_phage	88.9	9.4e-120
AYJ53751.1|1511741_1511930_-	hypothetical protein	NA	C6ZR38	Salmonella_phage	98.4	3.8e-28
AYJ53752.1|1511926_1512040_-	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
AYJ53753.1|1512032_1512179_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	C6ZR40	Salmonella_phage	97.9	1.5e-19
AYJ53754.1|1512405_1512906_-	HNH endonuclease	NA	A5H1L2	Xanthomonas_virus	44.2	2.6e-31
AYJ53755.1|1512989_1513184_-	restriction endonuclease	NA	E7C9Q6	Salmonella_phage	100.0	2.5e-30
AYJ53756.1|1513262_1513601_-	hypothetical protein	NA	E7C9Q7	Salmonella_phage	96.4	1.0e-55
AYJ53757.1|1513952_1514603_-	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	99.5	2.1e-121
AYJ53758.1|1514683_1514869_+	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
AYJ53759.1|1514975_1515266_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	100.0	2.4e-45
AYJ53760.1|1515434_1516283_+	replication protein	NA	C6ZR51	Salmonella_phage	95.7	8.5e-152
AYJ53761.1|1516393_1518274_+	bifunctional DNA primase/helicase	NA	A0A0M4R313	Salmonella_phage	99.2	0.0e+00
AYJ53762.1|1518274_1518553_+	hypothetical protein	NA	C6ZR54	Salmonella_phage	97.8	1.9e-47
AYJ53763.1|1518608_1519064_+	recombination protein NinB	NA	C6ZR55	Salmonella_phage	95.9	1.8e-76
AYJ53764.1|1519060_1519234_+	protein ninD	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
AYJ53765.1|1519200_1519377_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	98.3	1.8e-27
AYJ53766.1|1519379_1519781_+	hypothetical protein	NA	G9L690	Escherichia_phage	85.0	2.7e-63
AYJ53767.1|1519773_1519950_+	protein ninF	NA	I6S668	Salmonella_phage	93.0	3.1e-24
AYJ53768.1|1519942_1520161_+	hypothetical protein	NA	S4TUE0	Salmonella_phage	68.1	5.6e-23
AYJ53769.1|1520161_1520452_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	100.0	1.7e-51
AYJ53770.1|1520448_1520844_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A220NQY4	Salmonella_phage	96.2	5.5e-69
AYJ53771.1|1520840_1521044_+	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
AYJ53772.1|1521024_1521204_+	hypothetical protein	NA	E7C9S6	Salmonella_phage	96.6	4.6e-23
AYJ53773.1|1521200_1521824_+	antitermination protein	NA	C6ZR62	Salmonella_phage	99.0	1.5e-113
AYJ53774.1|1522097_1522295_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ53775.1|1522382_1522901_+	endodeoxyribonuclease	NA	A0A1V0E5R7	Salmonella_phage	100.0	5.9e-95
AYJ53776.1|1523124_1523397_+	hypothetical protein	NA	A0A1V0E5R8	Salmonella_phage	100.0	1.1e-41
AYJ53777.1|1523396_1523894_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	100.0	1.4e-93
AYJ53778.1|1523890_1524358_+|lysis	lysis protein	lysis	A0A1V0E5Q6	Salmonella_phage	98.7	3.8e-77
AYJ53779.1|1524392_1524617_+	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	88.7	1.6e-25
AYJ53780.1|1524570_1525101_+	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	97.2	5.3e-91
AYJ53781.1|1525357_1525600_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
AYJ53782.1|1525601_1526090_+	hypothetical protein	NA	A0A1B2IBG8	Erwinia_phage	34.2	5.1e-16
AYJ53783.1|1526095_1526584_+	DNA-packaging protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
AYJ53784.1|1526561_1528061_+|terminase	terminase	terminase	A0A1R3Y5N2	Salmonella_virus	100.0	2.8e-307
AYJ53785.1|1528060_1530238_+|portal	portal protein	portal	I6R968	Salmonella_phage	98.2	0.0e+00
AYJ53786.1|1530251_1531163_+	scaffolding protein	NA	A0A1R3Y5R6	Salmonella_virus	99.7	1.1e-160
AYJ53787.1|1531162_1532455_+|coat	coat protein	coat	Q76H21	Enterobacteria_phage	99.3	1.8e-241
AYJ53788.1|1532495_1533056_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.4	7.0e-102
AYJ53789.1|1533039_1533540_+	hypothetical protein	NA	I1TEJ0	Salmonella_phage	98.2	1.2e-89
AYJ53790.1|1533499_1534918_+	hypothetical protein	NA	I1TEJ1	Salmonella_phage	98.7	7.3e-273
AYJ53791.1|1534921_1535560_+|tail	phage tail protein	tail	A0A088CPT1	Enterobacteria_phage	94.8	3.4e-84
AYJ53792.1|1535559_1536015_+	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	99.3	8.8e-87
AYJ53793.1|1536017_1536707_+	DNA transfer protein	NA	B9UDK9	Salmonella_phage	91.7	5.6e-93
AYJ57092.1|1536749_1538087_+	DNA transfer protein	NA	I1TEJ5	Salmonella_phage	98.0	7.7e-240
AYJ53794.1|1538086_1540153_+	DNA transfer protein	NA	B9UDL1	Salmonella_phage	81.1	1.1e-288
AYJ53795.1|1540229_1541987_+	hypothetical protein	NA	A0A0M4RD19	Salmonella_phage	51.6	1.8e-55
>prophage 3
CP032815	Salmonella enterica subsp. enterica strain 11TTU1615b chromosome, complete genome	4985867	1788695	1797866	4985867	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYJ54020.1|1788695_1789643_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.3e-23
AYJ54021.1|1789626_1790358_+	ABC transporter permease	NA	NA	NA	NA	NA
AYJ54022.1|1790338_1790446_-	protein YohO	NA	NA	NA	NA	NA
AYJ54023.1|1790505_1791237_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYJ54024.1|1791459_1793145_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AYJ54025.1|1793141_1793861_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYJ54026.1|1793907_1794375_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.0e-74
AYJ54027.1|1794431_1794962_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AYJ54028.1|1795133_1795592_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYJ54029.1|1795832_1797866_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
CP032815	Salmonella enterica subsp. enterica strain 11TTU1615b chromosome, complete genome	4985867	1970649	1977881	4985867		Morganella_phage(33.33%)	8	NA	NA
AYJ54185.1|1970649_1971069_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AYJ54186.1|1971071_1972340_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	1.9e-227
AYJ54187.1|1972785_1972998_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AYJ57108.1|1973008_1973197_+	cold-shock protein	NA	NA	NA	NA	NA
AYJ54188.1|1973456_1974641_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.1	5.1e-110
AYJ54189.1|1975290_1975602_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ54190.1|1975681_1976377_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AYJ54191.1|1976450_1977881_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
CP032815	Salmonella enterica subsp. enterica strain 11TTU1615b chromosome, complete genome	4985867	2081857	2122459	4985867	head,integrase,tail,lysis	Salmonella_phage(17.39%)	61	2084065:2084094	2125691:2125720
AYJ54300.1|2081857_2082088_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	8.5e-14
AYJ54301.1|2082225_2082600_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AYJ54302.1|2082600_2083476_+	copper resistance D family protein	NA	NA	NA	NA	NA
AYJ54303.1|2083492_2083846_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AYJ54304.1|2083904_2084024_+	hypothetical protein	NA	NA	NA	NA	NA
2084065:2084094	attL	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
AYJ54305.1|2084229_2085309_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.8	1.3e-101
AYJ54306.1|2085283_2085562_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
AYJ57114.1|2085622_2085859_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ54307.1|2086149_2086335_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	59.6	2.9e-12
AYJ54308.1|2086381_2087212_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	2.9e-104
AYJ54309.1|2087204_2089895_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.6	9.8e-117
AYJ54310.1|2090035_2090371_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ54311.1|2090445_2090730_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	1.7e-08
AYJ54312.1|2091149_2091374_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ54313.1|2091687_2092113_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	1.2e-13
AYJ54314.1|2092209_2092464_+	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
AYJ54315.1|2092450_2092945_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ54316.1|2092988_2093996_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	68.1	2.4e-124
AYJ54317.1|2093988_2094450_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.8e-67
AYJ54318.1|2094462_2094858_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.1	1.7e-17
AYJ54319.1|2094854_2095127_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ54320.1|2095330_2095486_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	82.4	2.0e-14
AYJ54321.1|2095735_2095984_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ54322.1|2096047_2096647_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.9	5.0e-98
AYJ54323.1|2096643_2096838_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
AYJ54324.1|2096834_2097116_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	1.7e-35
AYJ54325.1|2097112_2097667_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	64.6	2.8e-63
AYJ54326.1|2097612_2097870_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ54327.1|2097912_2098089_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	60.3	1.2e-12
AYJ54328.1|2098139_2098547_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	63.0	1.4e-38
AYJ57115.1|2098696_2098999_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYJ54329.1|2098976_2099516_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	71.8	3.4e-77
AYJ54330.1|2099616_2100081_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	81.7	6.3e-56
AYJ54331.1|2100306_2100489_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
AYJ54332.1|2100559_2101189_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	9.6e-108
AYJ54333.1|2101191_2102811_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	81.2	1.5e-261
AYJ54334.1|2102810_2104331_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.9	3.1e-104
AYJ54335.1|2104371_2105061_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
AYJ54336.1|2105057_2106404_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.2	4.2e-68
AYJ54337.1|2106405_2106888_+	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	1.1e-26
AYJ54338.1|2106887_2107916_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
AYJ54339.1|2107919_2108267_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.0e-10
AYJ54340.1|2108273_2108729_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.8	2.4e-15
AYJ54341.1|2108722_2109307_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	3.2e-17
AYJ54342.1|2109303_2109669_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	39.7	8.8e-21
AYJ54343.1|2109653_2110199_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ54344.1|2110179_2111664_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	4.0e-96
AYJ54345.1|2111664_2112111_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
AYJ54346.1|2112110_2112515_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	8.2e-20
AYJ54347.1|2112556_2112739_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AYJ54348.1|2112722_2114894_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
AYJ54349.1|2114890_2115601_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	5.0e-28
AYJ54350.1|2115600_2115903_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	50.5	2.4e-24
AYJ54351.1|2115899_2116769_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
AYJ54352.1|2116749_2117427_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.0	1.6e-31
AYJ54353.1|2117439_2117796_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
AYJ54354.1|2117792_2119034_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.9	9.1e-102
AYJ54355.1|2119035_2119638_+	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.2	5.9e-30
AYJ54356.1|2119627_2121079_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	70.2	7.3e-42
AYJ54357.1|2121075_2121900_+|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	93.4	1.2e-150
AYJ54358.1|2121889_2122459_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.4	4.2e-94
2125691:2125720	attR	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
>prophage 6
CP032815	Salmonella enterica subsp. enterica strain 11TTU1615b chromosome, complete genome	4985867	2680711	2729045	4985867	tail,tRNA,protease,capsid,head,terminase,portal,lysis	Salmonella_phage(43.33%)	68	NA	NA
AYJ54892.1|2680711_2683099_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AYJ54893.1|2683114_2684098_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
AYJ57141.1|2684234_2684279_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AYJ54894.1|2684399_2684756_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AYJ54895.1|2684806_2685004_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AYJ54896.1|2685099_2685642_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
AYJ54897.1|2685645_2687574_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.6	1.6e-129
AYJ54898.1|2687905_2689174_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	95.0	2.9e-236
AYJ54899.1|2689176_2689596_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.8	3.8e-36
AYJ54900.1|2689832_2691131_-|tail	phage tail protein	tail	I6R0Q9	Salmonella_phage	99.1	5.0e-244
AYJ54901.1|2691141_2692101_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.7	2.8e-183
AYJ54902.1|2692109_2694830_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	99.9	0.0e+00
AYJ54903.1|2694829_2695228_-	hypothetical protein	NA	S4TR39	Salmonella_phage	94.7	2.9e-70
AYJ54904.1|2695234_2695819_-	hypothetical protein	NA	S4TND4	Salmonella_phage	96.9	1.0e-103
AYJ54905.1|2695818_2696412_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	99.0	4.3e-110
AYJ54906.1|2696574_2696829_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ54907.1|2697199_2700490_-|tail	phage tail tape measure protein	tail	Q9MCS3	Enterobacteria_phage	69.6	0.0e+00
AYJ54908.1|2700553_2701153_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ54909.1|2701220_2701517_-	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	100.0	2.9e-46
AYJ54910.1|2701528_2701900_-|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	90.9	4.4e-60
AYJ54911.1|2701927_2702632_-|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	74.4	4.4e-93
AYJ54912.1|2702688_2703036_-	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	96.5	5.5e-57
AYJ54913.1|2703032_2703482_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	95.3	3.5e-72
AYJ54914.1|2703478_2703817_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	6.6e-39
AYJ54915.1|2703826_2704153_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	85.2	5.2e-49
AYJ54916.1|2704152_2704377_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	2.5e-10
AYJ54917.1|2704420_2705638_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.9	6.0e-199
AYJ54918.1|2705647_2706496_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	87.9	1.3e-131
AYJ54919.1|2706509_2707817_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.1	9.3e-214
AYJ54920.1|2707816_2709559_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.3	5.9e-139
AYJ54921.1|2709512_2709977_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.3e-48
AYJ54922.1|2710109_2710454_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	75.7	1.0e-47
AYJ54923.1|2710572_2711040_-|lysis	lysis protein	lysis	A0A1V0E5Q6	Salmonella_phage	98.7	3.8e-77
AYJ54924.1|2711036_2711534_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	100.0	1.4e-93
AYJ54925.1|2711533_2711806_-	hypothetical protein	NA	A0A1V0E5R8	Salmonella_phage	98.9	5.7e-41
AYJ54926.1|2712029_2712548_-	endodeoxyribonuclease	NA	A0A1V0E5R7	Salmonella_phage	100.0	5.9e-95
AYJ54927.1|2712635_2712833_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ54928.1|2713100_2713874_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	99.6	5.3e-132
AYJ54929.1|2713870_2714053_-	hypothetical protein	NA	C6ZR61	Salmonella_phage	95.0	6.1e-23
AYJ54930.1|2714040_2714511_-	hypothetical protein	NA	C6ZR60	Salmonella_phage	100.0	7.9e-91
AYJ54931.1|2714491_2714728_-	hypothetical protein	NA	C6ZR59	Salmonella_phage	88.5	3.4e-34
AYJ54932.1|2714720_2714891_-	NinF family protein	NA	I6R994	Salmonella_phage	87.0	7.4e-23
AYJ54933.1|2714887_2715064_-	NinE family protein	NA	I6RSI9	Salmonella_phage	98.3	1.5e-26
AYJ54934.1|2715060_2715471_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	100.0	3.2e-72
AYJ54935.1|2715442_2715799_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	96.5	4.6e-59
AYJ54936.1|2716015_2716096_-	histone H1	NA	Q9MCP6	Enterobacteria_phage	96.2	1.7e-06
AYJ54937.1|2716095_2717547_-	helicase DnaB	NA	Q7Y2K5	Escherichia_phage	99.2	7.2e-276
AYJ54938.1|2717521_2718412_-	DNA replication protein	NA	Q716D3	Shigella_phage	99.3	3.8e-158
AYJ54939.1|2718594_2718873_-	hypothetical protein	NA	K7P8A8	Enterobacteria_phage	100.0	1.1e-42
AYJ54940.1|2718981_2719176_-	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	98.4	6.7e-28
AYJ54941.1|2719282_2719999_+	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
AYJ54942.1|2720016_2720385_+	hypothetical protein	NA	K7P6G1	Enterobacteria_phage	99.2	1.3e-56
AYJ54943.1|2720960_2721266_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	91.8	2.9e-25
AYJ54944.1|2721274_2721541_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ54945.1|2721596_2722046_+	hypothetical protein	NA	I6RSN8	Salmonella_phage	89.3	8.7e-71
AYJ54946.1|2722124_2722595_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	98.7	3.1e-87
AYJ54947.1|2722684_2722960_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	100.0	1.6e-46
AYJ54948.1|2723214_2723922_+	recombinase	NA	K7PKU3	Enterobacteria_phage	88.5	1.6e-119
AYJ54949.1|2723921_2724206_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
AYJ54950.1|2724252_2724546_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	97.9	8.8e-48
AYJ54951.1|2724556_2724727_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
AYJ54952.1|2724723_2725221_+	ead/Ea22-like family protein	NA	A0A0N6WGF1	Salmonella_phage	82.4	3.5e-73
AYJ54953.1|2725217_2725448_+	hypothetical protein	NA	G8C7U9	Escherichia_phage	89.3	5.5e-29
AYJ54954.1|2725444_2725690_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	92.3	1.0e-33
AYJ54955.1|2725686_2726454_+	ead/Ea22-like family protein	NA	A0A075B8K3	Enterobacteria_phage	60.1	1.3e-69
AYJ54956.1|2726455_2726713_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	5.9e-40
AYJ54957.1|2727642_2727888_+	helix-turn-helix domain-containing protein	NA	A0A1P8DTG1	Proteus_phage	56.7	9.1e-14
AYJ54958.1|2727833_2729045_-	DUF4102 domain-containing protein	NA	I6R9B6	Salmonella_phage	99.3	2.1e-236
>prophage 7
CP032815	Salmonella enterica subsp. enterica strain 11TTU1615b chromosome, complete genome	4985867	2960948	3007441	4985867	tail,protease,terminase,head,lysis,integrase	Salmonella_phage(45.28%)	69	2957886:2957899	3008363:3008376
2957886:2957899	attL	CACGCTGCAAACGC	NA	NA	NA	NA
AYJ57153.1|2960948_2961269_-	hypothetical protein	NA	E5G6P3	Salmonella_phage	76.6	6.8e-09
AYJ55202.1|2961292_2961529_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ55203.1|2961919_2962795_+	SPI-2 type III secretion system effector PipB	NA	NA	NA	NA	NA
AYJ55204.1|2963016_2963697_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.6e-82
AYJ55205.1|2964085_2964352_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	78.4	7.3e-33
AYJ55206.1|2964408_2965056_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ57154.1|2965098_2965296_-	hypothetical protein	NA	S4TTF2	Salmonella_phage	97.0	1.4e-09
AYJ55207.1|2965921_2966314_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	37.4	8.5e-14
AYJ55208.1|2966423_2967032_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	44.7	1.1e-31
AYJ55209.1|2967094_2967280_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ55210.1|2967528_2968047_-|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	53.8	2.0e-47
AYJ55211.1|2968061_2969594_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	66.2	1.4e-128
AYJ55212.1|2969593_2970274_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	96.0	5.5e-125
AYJ55213.1|2970270_2971470_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	96.7	5.5e-213
AYJ55214.1|2971470_2971824_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	95.7	3.0e-58
AYJ55215.1|2971823_2972576_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	69.8	9.7e-91
AYJ55216.1|2972694_2973150_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ55217.1|2973233_2973566_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	69.1	1.7e-23
AYJ55218.1|2973562_2974630_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	91.5	2.0e-174
AYJ55219.1|2974632_2974935_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	100.0	4.2e-53
AYJ55220.1|2974934_2975510_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	99.5	9.1e-97
AYJ55221.1|2975509_2977519_-	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	95.2	0.0e+00
AYJ57155.1|2977508_2977685_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	72.9	4.7e-12
AYJ55222.1|2977696_2978149_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	78.7	1.3e-61
AYJ55223.1|2978152_2978593_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	73.3	2.5e-54
AYJ55224.1|2978604_2979750_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.8	5.9e-164
AYJ55225.1|2979753_2980299_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	50.8	7.4e-48
AYJ55226.1|2980291_2980696_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	69.2	4.1e-43
AYJ55227.1|2980695_2981205_-	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	40.7	8.5e-22
AYJ55228.1|2981201_2981612_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	57.4	2.5e-32
AYJ55229.1|2981580_2981949_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ55230.1|2981998_2982946_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	55.9	1.2e-98
AYJ55231.1|2982957_2983461_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	46.4	3.4e-31
AYJ55232.1|2983472_2984750_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	42.8	1.6e-77
AYJ55233.1|2984801_2985335_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	5.5e-48
AYJ55234.1|2985405_2986875_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	55.7	1.1e-157
AYJ55235.1|2986914_2988333_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	70.0	6.8e-186
AYJ55236.1|2988298_2989051_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	55.2	2.6e-11
AYJ57156.1|2989114_2989303_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
AYJ55237.1|2989615_2990083_-|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	80.6	2.5e-60
AYJ55238.1|2990079_2990991_-	site-specific DNA-methyltransferase	NA	A0A088FRS2	Escherichia_phage	53.0	3.2e-88
AYJ55239.1|2990987_2991476_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	68.1	4.6e-57
AYJ57157.1|2991453_2991756_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYJ55240.1|2991958_2992147_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ55241.1|2992539_2993118_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.0	2.4e-44
AYJ55242.1|2993114_2993408_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	65.3	2.1e-33
AYJ55243.1|2993404_2994001_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	73.7	1.5e-81
AYJ55244.1|2994069_2994261_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ55245.1|2994444_2994783_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	86.6	3.7e-50
AYJ55246.1|2994782_2994953_-	methyltransferase	NA	I6S1S6	Salmonella_phage	87.5	6.3e-06
AYJ55247.1|2994949_2995552_-	adenine methylase	NA	G9L699	Escherichia_phage	87.3	1.7e-98
AYJ55248.1|2995544_2995793_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ55249.1|2995796_2996477_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ55250.1|2996514_2997903_-	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	47.1	1.2e-105
AYJ55251.1|2997899_2998880_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	80.6	2.3e-44
AYJ55252.1|2998882_2999107_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	44.7	1.0e-08
AYJ55253.1|2999129_2999576_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	50.4	5.5e-25
AYJ57158.1|2999510_2999726_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ55254.1|2999640_2999874_-	XRE family transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	48.6	6.2e-12
AYJ55255.1|2999972_3000437_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.7	2.7e-35
AYJ55256.1|3001121_3001445_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ55257.1|3001452_3001698_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	53.8	3.5e-13
AYJ55258.1|3001727_3004001_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.0	9.4e-105
AYJ55259.1|3003997_3004552_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	59.3	1.3e-47
AYJ55260.1|3004554_3004737_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ55261.1|3004786_3004984_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	58.5	8.3e-10
AYJ55262.1|3004949_3005174_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AYJ55263.1|3005174_3006194_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	53.5	1.2e-91
AYJ55264.1|3006781_3007441_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
3008363:3008376	attR	CACGCTGCAAACGC	NA	NA	NA	NA
>prophage 8
CP032815	Salmonella enterica subsp. enterica strain 11TTU1615b chromosome, complete genome	4985867	3240979	3282937	4985867	tail,terminase,holin,portal,lysis,coat,integrase	Salmonella_phage(70.49%)	69	3240530:3240551	3283003:3283024
3240530:3240551	attL	CGTTCAACTTAGTATAAAAAAG	NA	NA	NA	NA
AYJ55462.1|3240979_3241342_+	GtrA family protein	NA	I1TED9	Salmonella_phage	82.5	6.2e-51
AYJ55463.1|3241338_3242256_+	glycosyltransferase	NA	I1TED8	Salmonella_phage	93.1	1.3e-161
AYJ55464.1|3242252_3243704_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ55465.1|3243739_3245500_-	hypothetical protein	NA	I6S5Y0	Salmonella_phage	88.3	3.0e-58
AYJ55466.1|3245599_3246478_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	78.9	1.1e-96
AYJ55467.1|3246540_3246714_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AYJ55468.1|3246802_3247039_+	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	59.2	2.2e-17
AYJ55469.1|3247035_3247245_+	hypothetical protein	NA	I6R975	Salmonella_phage	98.6	5.9e-30
AYJ55470.1|3247219_3247405_-	hypothetical protein	NA	I6RSG3	Salmonella_phage	100.0	1.1e-08
AYJ55471.1|3247430_3247655_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ55472.1|3247668_3248034_-	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	100.0	2.1e-67
AYJ55473.1|3248064_3248253_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ55474.1|3248270_3250136_-	DNA transfer protein	NA	A0A2H4FNB8	Salmonella_phage	98.4	0.0e+00
AYJ55475.1|3250135_3251533_-	DNA transfer protein	NA	A0A2H4FND5	Salmonella_phage	85.8	6.9e-215
AYJ55476.1|3251543_3252236_-	DNA transfer protein	NA	A0A0M4RTU3	Salmonella_phage	96.1	3.7e-105
AYJ55477.1|3252238_3252694_-	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	99.3	6.7e-87
AYJ55478.1|3252693_3253332_-|tail	phage tail protein	tail	A0A088CPT1	Enterobacteria_phage	99.1	7.0e-90
AYJ55479.1|3253335_3254754_-	hypothetical protein	NA	I1TEJ1	Salmonella_phage	98.9	1.5e-273
AYJ55480.1|3254713_3255214_-	hypothetical protein	NA	I1TEJ0	Salmonella_phage	100.0	3.2e-90
AYJ55481.1|3255197_3255758_-	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.4	7.0e-102
AYJ55482.1|3255798_3257091_-|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.3	3.2e-243
AYJ55483.1|3257090_3258002_-	scaffolding protein	NA	A0A1R3Y5R6	Salmonella_virus	99.7	1.1e-160
AYJ55484.1|3258015_3260193_-|portal	portal protein	portal	I6R968	Salmonella_phage	98.2	0.0e+00
AYJ55485.1|3260192_3261692_-|terminase	terminase	terminase	A0A0M4S5Z3	Salmonella_phage	99.6	3.1e-306
AYJ55486.1|3261669_3262158_-	DNA-packaging protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
AYJ55487.1|3262161_3262566_-	Decoration protein	NA	C6ZR73	Salmonella_phage	99.3	1.5e-66
AYJ55488.1|3262568_3262811_-	DUF2560 family protein	NA	A0A1R3Y5V5	Salmonella_virus	100.0	1.7e-36
AYJ55489.1|3262914_3263295_-	hypothetical protein	NA	Q716B1	Shigella_phage	99.2	1.4e-66
AYJ55490.1|3263578_3264097_-	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	100.0	3.2e-93
AYJ55491.1|3264302_3264740_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	95.9	4.2e-70
AYJ55492.1|3264736_3265213_-	lysozyme	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
AYJ55493.1|3265196_3265520_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AYJ55494.1|3265757_3265955_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ55495.1|3266227_3266851_-	antitermination protein	NA	C6ZR62	Salmonella_phage	98.1	9.8e-113
AYJ55496.1|3266847_3267027_-	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	100.0	7.1e-24
AYJ55497.1|3267007_3267211_-	protein ninH	NA	I6RSQ6	Salmonella_phage	97.0	1.4e-31
AYJ55498.1|3267207_3267432_-	protein ninY	NA	I6R0N9	Salmonella_phage	98.6	1.8e-37
AYJ55499.1|3267428_3268085_-	HNH endonuclease	NA	A0A2I7QND8	Vibrio_phage	45.4	3.4e-39
AYJ55500.1|3268081_3268477_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	97.7	2.2e-70
AYJ55501.1|3268473_3268770_-	hypothetical protein	NA	A0A0M3ULJ7	Salmonella_phage	97.8	7.5e-47
AYJ55502.1|3268732_3268909_-	NinF family protein	NA	A0A0M4S6T3	Salmonella_phage	96.6	1.8e-27
AYJ55503.1|3268905_3269082_-	NinE family protein	NA	I6RSI9	Salmonella_phage	100.0	2.3e-27
AYJ55504.1|3269048_3269222_-	protein ninD	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
AYJ55505.1|3269218_3269656_-	recombination protein NinB	NA	A0A192Y6T2	Salmonella_phage	98.6	9.4e-78
AYJ55506.1|3269670_3269877_-	hypothetical protein	NA	I1TEG6	Salmonella_phage	98.5	2.7e-35
AYJ55507.1|3269880_3270165_-	hypothetical protein	NA	A0A2H4FNE3	Salmonella_phage	57.8	4.9e-27
AYJ55508.1|3270164_3270359_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ55509.1|3270432_3270711_-	hypothetical protein	NA	Q5G8S7	Enterobacteria_phage	93.5	1.0e-45
AYJ55510.1|3270711_3272592_-	bifunctional DNA primase/helicase	NA	I6S1U6	Salmonella_phage	97.9	0.0e+00
AYJ55511.1|3272699_3273548_-	replication protein	NA	C6ZR51	Salmonella_phage	94.7	8.0e-150
AYJ55512.1|3273730_3274009_-	hypothetical protein	NA	A0A220NRS4	Escherichia_phage	93.5	2.2e-40
AYJ55513.1|3274116_3274332_-	XRE family transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
AYJ55514.1|3274450_3275113_+	LexA family transcriptional regulator	NA	A0A0M4QWY1	Salmonella_phage	99.1	1.8e-125
AYJ55515.1|3275480_3275813_+	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	95.5	1.0e-52
AYJ55516.1|3275821_3276292_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	98.7	3.1e-87
AYJ55517.1|3276451_3276706_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ55518.1|3276791_3276926_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	78.0	2.1e-09
AYJ55519.1|3276910_3277105_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ55520.1|3277192_3277381_+	hypothetical protein	NA	C6ZR38	Salmonella_phage	82.3	1.7e-23
AYJ55521.1|3277389_3278097_+	recombinase	NA	A0A2H4FN95	Salmonella_phage	89.4	5.0e-121
AYJ55522.1|3278096_3278381_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
AYJ55523.1|3278427_3278721_+	DUF2856 family protein	NA	A0A2H4FNA1	Salmonella_phage	96.9	1.4e-48
AYJ55524.1|3278731_3278902_+	DUF2737 family protein	NA	A0A220NQV6	Salmonella_phage	98.2	1.3e-24
AYJ55525.1|3278898_3279309_+	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	94.1	4.4e-69
AYJ55526.1|3279305_3279938_+	ead/Ea22-like family protein	NA	A0A1R3Y5T1	Salmonella_virus	44.5	2.7e-25
AYJ55527.1|3279939_3280197_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	5.9e-40
AYJ55528.1|3281081_3281348_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	96.6	6.3e-45
AYJ55529.1|3281670_3281889_+	excisionase	NA	A0A1V0E5M4	Salmonella_phage	100.0	5.7e-36
AYJ55530.1|3281866_3282937_+|integrase	integrase	integrase	A0A1V0E5M7	Salmonella_phage	100.0	1.0e-154
3283003:3283024	attR	CGTTCAACTTAGTATAAAAAAG	NA	NA	NA	NA
>prophage 9
CP032815	Salmonella enterica subsp. enterica strain 11TTU1615b chromosome, complete genome	4985867	4542751	4590398	4985867	tRNA,plate,tail	Burkholderia_phage(36.36%)	51	NA	NA
AYJ56638.1|4542751_4543750_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AYJ56639.1|4543837_4545148_-	conjugal transfer protein	NA	NA	NA	NA	NA
AYJ56640.1|4545394_4545910_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
AYJ56641.1|4546008_4546218_-	CsbD family protein	NA	NA	NA	NA	NA
AYJ57217.1|4546239_4546353_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ56642.1|4546349_4547675_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
AYJ56643.1|4547853_4548462_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
AYJ56644.1|4548570_4548939_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AYJ56645.1|4549109_4551530_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AYJ56646.1|4551628_4552501_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AYJ56647.1|4552514_4553012_-	chorismate lyase	NA	NA	NA	NA	NA
AYJ56648.1|4553192_4554110_-	maltose operon protein MalM	NA	NA	NA	NA	NA
AYJ56649.1|4554273_4555629_-	maltoporin	NA	NA	NA	NA	NA
AYJ56650.1|4555717_4556827_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
AYJ56651.1|4557188_4558379_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
AYJ56652.1|4558510_4560055_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
AYJ56653.1|4560069_4560960_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
AYJ56654.1|4561125_4561536_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AYJ56655.1|4561678_4563775_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AYJ56656.1|4563774_4564512_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ56657.1|4564508_4565147_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AYJ56658.1|4565210_4565453_-	outer membrane protein	NA	NA	NA	NA	NA
AYJ56659.1|4565896_4567546_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYJ56660.1|4567934_4569284_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AYJ56661.1|4569418_4569766_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	52.6	7.5e-22
AYJ56662.1|4570342_4570630_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
AYJ56663.1|4570632_4571238_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	58.8	1.0e-58
AYJ56664.1|4571250_4571565_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
AYJ56665.1|4571724_4572180_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ56666.1|4572176_4572374_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	5.1e-07
AYJ56667.1|4572363_4573791_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	1.8e-194
AYJ56668.1|4573790_4574315_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	1.8e-67
AYJ56669.1|4574366_4574684_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AYJ56670.1|4574643_4574772_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AYJ56671.1|4574868_4577223_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.5	3.4e-65
AYJ56672.1|4577222_4578176_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
AYJ56673.1|4578175_4578385_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AYJ56674.1|4578372_4579416_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.6	1.5e-76
AYJ56675.1|4579425_4580148_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
AYJ56676.1|4580156_4580399_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ56677.1|4580474_4580837_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
AYJ56678.1|4580833_4581763_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
AYJ56679.1|4581762_4583310_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	30.4	5.0e-49
AYJ56680.1|4583473_4583833_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
AYJ56681.1|4583823_4584939_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.7	3.1e-101
AYJ56682.1|4584931_4585564_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
AYJ56683.1|4585566_4587225_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	8.0e-53
AYJ56684.1|4587231_4587846_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
AYJ56685.1|4587842_4588298_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ57218.1|4588674_4589091_+	serine acetyltransferase	NA	NA	NA	NA	NA
AYJ56686.1|4589669_4590398_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 10
CP032815	Salmonella enterica subsp. enterica strain 11TTU1615b chromosome, complete genome	4985867	4659983	4755777	4985867	tail,tRNA,terminase,capsid,head,holin,portal,lysis,plate,integrase	Escherichia_phage(38.3%)	100	4720093:4720139	4750831:4750877
AYJ56736.1|4659983_4661084_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
AYJ56737.1|4661130_4661490_-	YijD family membrane protein	NA	NA	NA	NA	NA
AYJ56738.1|4661505_4662141_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
AYJ56739.1|4662142_4662331_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ56740.1|4662339_4663740_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
AYJ56741.1|4663722_4664640_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
AYJ56742.1|4664923_4666300_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AYJ56743.1|4666417_4667194_-	acetylglutamate kinase	NA	NA	NA	NA	NA
AYJ56744.1|4667201_4668206_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AYJ56745.1|4668294_4669446_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
AYJ56746.1|4669837_4672489_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AYJ56747.1|4672699_4674433_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
AYJ56748.1|4674593_4675430_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYJ56749.1|4675684_4676347_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	2.5e-29
AYJ56750.1|4676358_4677462_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
AYJ56751.1|4677720_4678344_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
AYJ56752.1|4678401_4680582_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
AYJ56753.1|4680746_4681637_-	5,10-methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AYJ56754.1|4681831_4683388_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AYJ56755.1|4683523_4684648_+	cytoplasmic protein	NA	NA	NA	NA	NA
AYJ56756.1|4684882_4685881_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ56757.1|4685883_4686741_+	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
AYJ56758.1|4686866_4689299_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
AYJ56759.1|4689301_4690462_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AYJ56760.1|4690726_4691044_+	met repressor	NA	NA	NA	NA	NA
AYJ56761.1|4691500_4693291_+	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
AYJ57221.1|4693583_4693769_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ56762.1|4694286_4694499_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
AYJ56763.1|4694702_4696901_+	primosomal protein N'	NA	NA	NA	NA	NA
AYJ56764.1|4697055_4698081_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
AYJ56765.1|4698174_4699149_+	cell division protein FtsN	NA	NA	NA	NA	NA
AYJ56766.1|4699240_4699771_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AYJ56767.1|4699780_4701112_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
AYJ56768.1|4701178_4702108_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AYJ56769.1|4702200_4702686_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AYJ56770.1|4702907_4703147_-	cell division protein ZapB	NA	NA	NA	NA	NA
AYJ56771.1|4703545_4704391_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
AYJ56772.1|4704411_4705920_+	glycerol kinase	NA	NA	NA	NA	NA
AYJ56773.1|4706031_4707042_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
AYJ56774.1|4707138_4707885_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AYJ56775.1|4707994_4708423_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
AYJ56776.1|4708523_4709120_+	DUF1454 family protein	NA	NA	NA	NA	NA
AYJ56777.1|4709232_4710000_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
AYJ56778.1|4710109_4711414_-	citrate transporter	NA	NA	NA	NA	NA
AYJ57222.1|4711511_4712234_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYJ56779.1|4712296_4713337_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
AYJ56780.1|4713346_4714306_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
AYJ56781.1|4714316_4715651_-	MFS transporter	NA	NA	NA	NA	NA
AYJ56782.1|4715915_4716671_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
AYJ56783.1|4716771_4717761_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYJ56784.1|4717964_4718927_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
AYJ56785.1|4719111_4720014_-	cation-efflux pump FieF	NA	NA	NA	NA	NA
4720093:4720139	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
AYJ56786.1|4720250_4720505_-	DNA-binding transcriptional regulator	NA	M1SNR2	Escherichia_phage	100.0	1.3e-44
AYJ56787.1|4720550_4721714_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	7.0e-205
AYJ56788.1|4721713_4722193_-|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
AYJ56789.1|4722207_4724655_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	94.8	0.0e+00
AYJ56790.1|4724647_4724767_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AYJ56791.1|4724799_4725075_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AYJ56792.1|4725131_4725650_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AYJ56793.1|4725662_4726853_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	4.8e-225
AYJ56794.1|4726912_4727506_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	1.8e-103
AYJ57223.1|4727725_4728214_+|tail	phage tail protein	tail	A0A1S6KZZ0	Salmonella_phage	82.6	2.1e-70
AYJ56795.1|4728183_4728801_+|tail	tail assembly chaperone	tail	A0A1S6KZY8	Salmonella_phage	83.6	5.3e-95
AYJ56796.1|4728805_4729339_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	80.3	5.7e-77
AYJ56797.1|4729341_4730904_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	49.4	1.5e-154
AYJ56798.1|4730960_4731512_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.5e-104
AYJ56799.1|4731504_4732413_-|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	100.0	8.8e-163
AYJ56800.1|4732417_4732765_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
AYJ56801.1|4732761_4733397_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	9.0e-114
AYJ56802.1|4733463_4733916_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
AYJ56803.1|4733908_4734376_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	8.7e-82
AYJ56804.1|4734338_4734512_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
AYJ56805.1|4734483_4734909_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	4.7e-66
AYJ56806.1|4734896_4735322_-	protein lysA	NA	U5N096	Enterobacteria_phage	95.7	2.8e-58
AYJ56807.1|4735336_4735834_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AYJ56808.1|4735833_4736115_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
AYJ56809.1|4736118_4736322_-|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
AYJ56810.1|4736321_4736831_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AYJ56811.1|4736930_4737674_-|terminase	terminase	terminase	Q94MH3	Enterobacteria_phage	98.0	3.1e-121
AYJ56812.1|4737677_4738751_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	100.0	6.7e-202
AYJ56813.1|4738809_4739664_-|capsid	capsid scaffolding protein	capsid	Q94MF5	Enterobacteria_phage	99.6	2.2e-139
AYJ56814.1|4739837_4741610_+	oxidoreductase	NA	A0A0F7LCM8	Escherichia_phage	99.8	0.0e+00
AYJ56815.1|4741609_4742644_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	4.2e-201
AYJ56816.1|4742984_4744817_-	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	32.5	4.1e-90
AYJ56817.1|4744933_4747216_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.4	0.0e+00
AYJ56818.1|4747205_4747481_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	97.8	1.6e-43
AYJ56819.1|4747477_4747702_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	97.3	8.5e-35
AYJ56820.1|4747701_4748004_-	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	96.0	5.5e-45
AYJ56821.1|4748003_4748228_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	2.3e-32
AYJ56822.1|4748291_4748792_-	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
AYJ56823.1|4748961_4749234_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	98.9	1.5e-46
AYJ56824.1|4749370_4749664_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
AYJ56825.1|4749733_4750714_+|integrase	integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
AYJ56826.1|4750899_4751400_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4750831:4750877	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
AYJ56827.1|4751550_4752249_+	DNA-binding transcriptional regulator CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
AYJ56828.1|4752245_4753619_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
AYJ56829.1|4753666_4753870_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ56830.1|4753990_4754386_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AYJ56831.1|4754397_4755150_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AYJ56832.1|4755156_4755777_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
