The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032816	Salmonella enterica subsp. enterica strain 11TTUC-046 chromosome, complete genome	4588222	1115208	1180168	4588222	lysis,plate,capsid,tail,tRNA,integrase,portal,head	Salmonella_phage(88.37%)	64	1116653:1116699	1151181:1151227
AYJ58274.1|1115208_1116450_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	47.1	8.5e-100
1116653:1116699	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AYJ58275.1|1116816_1117842_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	98.8	9.2e-201
AYJ58276.1|1117845_1118478_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	99.5	3.3e-116
AYJ58277.1|1118597_1118840_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYJ58278.1|1118872_1119382_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	96.4	6.4e-86
AYJ58279.1|1119389_1119623_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
AYJ58280.1|1119570_1120029_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ61474.1|1120248_1120590_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
AYJ58281.1|1120657_1120891_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
AYJ58282.1|1120890_1121118_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
AYJ58283.1|1121964_1124394_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	91.3	0.0e+00
AYJ58284.1|1124546_1124735_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
AYJ58285.1|1124673_1124979_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AYJ58286.1|1125038_1125770_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ58287.1|1125985_1127737_+	AIPR family protein	NA	NA	NA	NA	NA
AYJ58288.1|1127822_1128863_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	93.0	2.4e-188
AYJ58289.1|1128862_1130629_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	97.3	0.0e+00
AYJ58290.1|1130771_1131605_+|capsid	capsid protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
AYJ58291.1|1131621_1132704_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	97.7	1.6e-190
AYJ58292.1|1132707_1133361_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	98.6	4.6e-113
AYJ58293.1|1133454_1133919_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	1.9e-84
AYJ58294.1|1133918_1134122_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	98.5	1.1e-33
AYJ58295.1|1134125_1134341_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
AYJ58296.1|1134321_1134831_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	3.5e-92
AYJ58297.1|1135207_1135636_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
AYJ58298.1|1135731_1136163_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
AYJ58299.1|1136155_1136602_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.0	1.9e-65
AYJ58300.1|1136670_1137249_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	98.4	3.3e-107
AYJ58301.1|1137245_1137605_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	98.3	8.0e-59
AYJ58302.1|1137591_1138500_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	99.0	7.7e-159
AYJ58303.1|1138492_1139098_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.0	4.1e-116
AYJ58304.1|1139094_1140669_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	60.5	3.7e-156
AYJ58305.1|1140638_1141256_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	84.6	4.1e-95
AYJ58306.1|1141259_1141667_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	84.4	2.2e-60
AYJ58307.1|1142724_1143282_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	98.4	5.5e-99
AYJ58308.1|1143384_1144557_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.7	5.7e-223
AYJ58309.1|1144566_1145082_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	98.8	7.9e-92
AYJ58310.1|1145136_1145439_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
AYJ58311.1|1145453_1145573_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
AYJ58312.1|1145565_1148373_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	99.7	0.0e+00
AYJ58313.1|1148369_1148855_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	98.5	2.4e-66
AYJ58314.1|1148851_1149952_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.1	3.4e-193
AYJ61475.1|1150018_1150237_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	76.4	8.3e-27
AYJ58315.1|1150521_1151112_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	75.9	4.4e-46
AYJ61476.1|1151616_1152780_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1151181:1151227	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AYJ58316.1|1152787_1154968_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.9e-19
AYJ58317.1|1154964_1156374_-	type I secretion protein TolC	NA	NA	NA	NA	NA
AYJ58318.1|1156438_1167913_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
AYJ61477.1|1168527_1169010_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
AYJ58319.1|1169159_1169636_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AYJ58320.1|1169625_1169916_+	RnfH family protein	NA	NA	NA	NA	NA
AYJ58321.1|1170077_1170416_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AYJ58322.1|1170564_1172226_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AYJ58323.1|1172311_1173190_-	NAD(+) kinase	NA	NA	NA	NA	NA
AYJ61478.1|1173121_1173316_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
AYJ58324.1|1173312_1173903_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AYJ58325.1|1173937_1174543_-	cytoplasmic protein	NA	NA	NA	NA	NA
AYJ58326.1|1174663_1175905_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AYJ58327.1|1175969_1176761_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AYJ58328.1|1176706_1177003_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ58329.1|1176926_1178288_+	signal recognition particle protein	NA	NA	NA	NA	NA
AYJ61480.1|1178540_1178789_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AYJ61479.1|1178807_1179356_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AYJ58330.1|1179400_1180168_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
CP032816	Salmonella enterica subsp. enterica strain 11TTUC-046 chromosome, complete genome	4588222	1675829	1685000	4588222	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYJ58769.1|1675829_1676777_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
AYJ58770.1|1676760_1677492_+	ABC transporter permease	NA	NA	NA	NA	NA
AYJ58771.1|1677472_1677580_-	protein YohO	NA	NA	NA	NA	NA
AYJ58772.1|1677639_1678371_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYJ58773.1|1678593_1680279_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AYJ58774.1|1680275_1680995_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYJ58775.1|1681041_1681509_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYJ58776.1|1681565_1682096_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AYJ58777.1|1682267_1682726_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
AYJ58778.1|1682966_1685000_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 3
CP032816	Salmonella enterica subsp. enterica strain 11TTUC-046 chromosome, complete genome	4588222	1842173	1849440	4588222		Morganella_phage(33.33%)	8	NA	NA
AYJ58923.1|1842173_1842593_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AYJ58924.1|1842595_1843864_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	1.9e-227
AYJ58925.1|1844318_1844531_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AYJ61503.1|1844541_1844730_+	cold-shock protein	NA	NA	NA	NA	NA
AYJ58926.1|1844988_1846200_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	2.6e-109
AYJ58927.1|1846849_1847149_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ58928.1|1847240_1847936_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	1.6e-07
AYJ58929.1|1848009_1849440_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
>prophage 4
CP032816	Salmonella enterica subsp. enterica strain 11TTUC-046 chromosome, complete genome	4588222	2135651	2142552	4588222		Salmonella_phage(28.57%)	10	NA	NA
AYJ59217.1|2135651_2136458_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
AYJ59218.1|2136459_2137452_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
AYJ59219.1|2137451_2138342_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
AYJ61518.1|2138465_2138867_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	8.4e-33
AYJ59220.1|2139246_2140134_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	37.7	2.1e-36
AYJ59221.1|2140439_2140613_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	80.6	4.9e-22
AYJ59222.1|2141028_2141169_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	77.1	6.5e-09
AYJ59223.1|2141207_2141507_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	55.7	8.5e-14
AYJ59224.1|2141433_2141859_+	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
AYJ59225.1|2142237_2142552_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	86.1	4.3e-40
>prophage 5
CP032816	Salmonella enterica subsp. enterica strain 11TTUC-046 chromosome, complete genome	4588222	2598985	2606190	4588222		Escherichia_phage(42.86%)	8	NA	NA
AYJ59674.1|2598985_2599225_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	87.3	2.5e-32
AYJ61538.1|2600104_2600914_+	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYJ59675.1|2600986_2601364_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYJ59676.1|2601511_2602054_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	66.5	8.1e-71
AYJ59677.1|2602246_2602975_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	1.2e-61
AYJ59678.1|2602991_2603405_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	37.7	5.5e-19
AYJ59679.1|2604454_2605579_-	DUF3626 domain-containing protein	NA	NA	NA	NA	NA
AYJ59680.1|2606025_2606190_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	9.6e-20
>prophage 6
CP032816	Salmonella enterica subsp. enterica strain 11TTUC-046 chromosome, complete genome	4588222	4332228	4368657	4588222	plate,terminase,capsid,tail,holin,integrase,lysis,portal,head	Escherichia_phage(43.9%)	48	4332071:4332117	4364032:4364078
4332071:4332117	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
AYJ61201.1|4332228_4332483_-	DNA-binding transcriptional regulator	NA	M1SNR2	Escherichia_phage	100.0	1.3e-44
AYJ61202.1|4332528_4333692_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	2.4e-205
AYJ61203.1|4333691_4334171_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
AYJ61204.1|4334185_4336633_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	94.7	0.0e+00
AYJ61205.1|4336625_4336745_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AYJ61206.1|4336777_4337053_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	97.8	8.3e-40
AYJ61207.1|4337109_4337628_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AYJ61208.1|4337640_4338831_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	98.7	4.0e-224
AYJ61209.1|4339090_4339783_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	99.1	5.6e-125
AYJ61210.1|4340274_4340454_+	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
AYJ61211.1|4340506_4340785_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ61212.1|4341005_4341533_-|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	96.0	3.1e-91
AYJ61213.1|4341536_4343546_-|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	97.3	0.0e+00
AYJ61214.1|4343556_4344087_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	98.9	5.1e-102
AYJ61215.1|4344079_4344988_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.3	1.3e-161
AYJ61216.1|4344992_4345340_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
AYJ61217.1|4345336_4345972_-|plate	phage baseplate assembly protein V	plate	A0A0F7LDY9	Escherichia_phage	99.5	5.3e-114
AYJ61218.1|4346055_4346841_+	hypothetical protein	NA	NA	NA	NA	NA
AYJ61219.1|4346912_4347365_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	4.5e-75
AYJ61220.1|4347357_4347825_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	96.8	1.3e-80
AYJ61221.1|4347787_4347961_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
AYJ61222.1|4347932_4348358_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	94.3	1.2e-64
AYJ61223.1|4348345_4348771_-	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	95.7	2.5e-59
AYJ61224.1|4348785_4349283_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AYJ61225.1|4349282_4349564_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AYJ61226.1|4349567_4349771_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
AYJ61227.1|4349770_4350280_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	98.8	2.1e-89
AYJ61228.1|4350379_4351123_-|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	96.8	1.2e-125
AYJ61229.1|4351126_4352200_-|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	99.4	5.7e-201
AYJ61230.1|4352258_4353113_-|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.9	1.5e-135
AYJ61231.1|4353286_4355059_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
AYJ61232.1|4355058_4356093_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	5.5e-201
AYJ61605.1|4357745_4357943_-	hypothetical protein	NA	NA	NA	NA	NA
AYJ61233.1|4358119_4360402_-	replication endonuclease	NA	U5N0W3	Enterobacteria_phage	98.1	0.0e+00
AYJ61234.1|4360391_4360667_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
AYJ61235.1|4360663_4360888_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
AYJ61236.1|4360887_4361190_-	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	100.0	3.5e-47
AYJ61237.1|4361189_4361414_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AYJ61238.1|4361477_4361978_-	replication protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
AYJ61239.1|4362147_4362420_-	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
AYJ61240.1|4362572_4362866_+	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
AYJ61241.1|4362935_4363916_+|integrase	integrase	integrase	U5N0A8	Enterobacteria_phage	100.0	4.7e-186
AYJ61242.1|4364100_4364601_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4364032:4364078	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
AYJ61243.1|4364751_4365450_+	DNA-binding transcriptional regulator CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AYJ61244.1|4365446_4366820_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
AYJ61245.1|4366870_4367266_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AYJ61246.1|4367277_4368030_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AYJ61247.1|4368036_4368657_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.4	7.1e-63
