The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026979	Pectobacterium parmentieri strain IFB5432 chromosome, complete genome	5010533	1161700	1167103	5010533		Mycobacterium_phage(33.33%)	6	NA	NA
AYH31127.1|1161700_1162165_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	57.3	1.7e-48
AYH31128.1|1162220_1162958_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.4	5.0e-39
AYH31129.1|1163314_1164277_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	74.2	1.9e-139
AYH31130.1|1164301_1166449_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.0	4.9e-204
AYH31131.1|1166445_1166853_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A220BYR7	Staphylococcus_phage	27.7	1.4e-06
AYH31132.1|1166863_1167103_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	58.1	3.5e-18
>prophage 3
CP026979	Pectobacterium parmentieri strain IFB5432 chromosome, complete genome	5010533	2214244	2224238	5010533	tRNA	Tupanvirus(33.33%)	10	NA	NA
AYH31981.1|2214244_2216173_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.4	4.4e-127
AYH31982.1|2216175_2216718_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.5	2.8e-15
AYH31983.1|2216831_2217029_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AYH31984.1|2217072_2217429_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AYH31985.1|2217757_2218741_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	39.3	4.5e-35
AYH31986.1|2218755_2221143_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	28.9	5.1e-08
AYH31987.1|2221147_2221444_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	5.5e-13
AYH31988.1|2221511_2221973_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYH31989.1|2222005_2222383_-	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
AYH31990.1|2222519_2224238_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.0	1.1e-57
>prophage 4
CP026979	Pectobacterium parmentieri strain IFB5432 chromosome, complete genome	5010533	2934388	2992090	5010533	bacteriocin,plate,tail,protease	Burkholderia_phage(39.13%)	62	NA	NA
AYH34493.1|2934388_2934685_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYH32590.1|2934763_2934964_-	hypothetical protein	NA	NA	NA	NA	NA
AYH34494.1|2935251_2935467_+	hypothetical protein	NA	NA	NA	NA	NA
AYH32591.1|2936215_2936875_+	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	48.8	2.7e-44
AYH32592.1|2936986_2937316_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
AYH32593.1|2937326_2937605_-	acylphosphatase	NA	NA	NA	NA	NA
AYH32594.1|2937838_2938147_+	heat shock protein HspQ	NA	NA	NA	NA	NA
AYH32595.1|2938227_2938641_-	CoA-binding protein	NA	NA	NA	NA	NA
AYH32596.1|2938836_2939361_+	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
AYH32597.1|2939498_2939957_+	methylglyoxal synthase	NA	NA	NA	NA	NA
AYH32598.1|2940035_2942093_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.7	2.2e-15
AYH32599.1|2942279_2942726_+	YccF domain-containing protein	NA	NA	NA	NA	NA
AYH32600.1|2942746_2944882_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AYH32601.1|2944897_2945518_-	competence-specific regulator	NA	NA	NA	NA	NA
AYH32602.1|2945740_2946247_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
AYH32603.1|2946609_2947695_+	porin OmpA	NA	NA	NA	NA	NA
AYH32604.1|2947845_2948307_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
AYH32605.1|2948483_2950253_+|protease	Lon protease	protease	NA	NA	NA	NA
AYH32606.1|2950344_2950863_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
AYH32607.1|2950959_2951613_-	DUF533 domain-containing protein	NA	NA	NA	NA	NA
AYH32608.1|2952107_2952746_+	hypothetical protein	NA	NA	NA	NA	NA
AYH32609.1|2953491_2953803_+	hypothetical protein	NA	NA	NA	NA	NA
AYH32610.1|2954367_2954613_+	DUF2543 domain-containing protein	NA	NA	NA	NA	NA
AYH32611.1|2954867_2955407_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
AYH32612.1|2955707_2956190_+	cold-shock protein	NA	NA	NA	NA	NA
AYH32613.1|2956263_2957304_-	hypothetical protein	NA	NA	NA	NA	NA
AYH32614.1|2957749_2958079_-	hypothetical protein	NA	NA	NA	NA	NA
AYH32615.1|2958136_2958673_-	hypothetical protein	NA	NA	NA	NA	NA
AYH32616.1|2959046_2960447_+	FMN/FAD transporter	NA	NA	NA	NA	NA
AYH32617.1|2960494_2961664_-	MFS transporter	NA	NA	NA	NA	NA
AYH32618.1|2961954_2962470_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.5	2.0e-15
AYH32619.1|2962846_2963728_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AYH32620.1|2963741_2964281_-	adenylate kinase	NA	A0A097BYE2	Leuconostoc_phage	36.1	2.8e-15
AYH32621.1|2964594_2965098_+	DNA starvation/stationary phase protection protein	NA	A0A222YYG6	Streptomyces_phage	28.9	1.4e-08
AYH32622.1|2965495_2966242_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
AYH32623.1|2966268_2966928_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
AYH32624.1|2966924_2967647_+	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	5.0e-36
AYH32625.1|2967686_2969555_-	peptidase M3	NA	NA	NA	NA	NA
AYH32626.1|2969641_2970610_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AYH32627.1|2970719_2970962_-	hypothetical protein	NA	A0A286S1P7	Klebsiella_phage	63.5	1.8e-14
AYH32628.1|2974198_2974780_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	60.6	6.2e-61
AYH32629.1|2974772_2975876_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	54.3	5.1e-104
AYH32630.1|2975866_2976214_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.0	9.5e-33
AYH32631.1|2976273_2976855_-|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	45.6	6.1e-24
AYH32632.1|2976851_2978006_-	phage protein D	NA	Q6QIA2	Burkholderia_phage	52.6	1.3e-89
AYH32633.1|2977993_2978206_-	hypothetical protein	NA	A4JWL2	Burkholderia_virus	57.1	2.6e-17
AYH32634.1|2978205_2979123_-	hypothetical protein	NA	Q6QIA4	Burkholderia_phage	45.9	6.0e-50
AYH34495.1|2979122_2981570_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.3	2.7e-89
AYH34496.1|2981792_2981936_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AYH32635.1|2981880_2982201_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AYH32636.1|2982343_2982868_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	66.7	9.5e-69
AYH32637.1|2982867_2984295_-|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	73.6	9.5e-204
AYH32638.1|2984284_2984482_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	58.8	5.4e-09
AYH32639.1|2984478_2984946_-	hypothetical protein	NA	NA	NA	NA	NA
AYH32640.1|2985189_2985501_-	hypothetical protein	NA	Q6QIC3	Burkholderia_phage	45.5	8.3e-20
AYH32641.1|2985493_2985823_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	50.0	2.5e-19
AYH32642.1|2985812_2986487_-	hypothetical protein	NA	NA	NA	NA	NA
AYH32643.1|2986476_2987088_-	lytic transglycosylase	NA	Q5ZQZ1	Pseudomonas_phage	56.0	2.7e-59
AYH32644.1|2987089_2987419_-	hypothetical protein	NA	A4JWP3	Burkholderia_virus	58.3	1.2e-24
AYH32645.1|2987635_2989003_-	peptidase	NA	NA	NA	NA	NA
AYH32646.1|2989005_2990334_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYH32647.1|2990362_2992090_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	33.1	7.3e-25
>prophage 5
CP026979	Pectobacterium parmentieri strain IFB5432 chromosome, complete genome	5010533	3109422	3115630	5010533		Escherichia_phage(50.0%)	6	NA	NA
AYH32746.1|3109422_3110829_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	A0A1D7RI04	Synechococcus_phage	29.6	1.5e-31
AYH32747.1|3111062_3111959_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.8	3.5e-47
AYH32748.1|3112193_3113063_+	glucose-1-phosphate thymidylyltransferase	NA	A0A291LA53	Escherichia_phage	66.3	2.7e-108
AYH32749.1|3113064_3113601_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	60.3	1.8e-59
AYH32750.1|3113597_3114443_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	40.8	2.2e-46
AYH32751.1|3114484_3115630_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	45.3	1.1e-80
>prophage 6
CP026979	Pectobacterium parmentieri strain IFB5432 chromosome, complete genome	5010533	3351455	3390575	5010533	head,tail,holin	Burkholderia_phage(24.39%)	54	NA	NA
AYH32949.1|3351455_3351692_-	hypothetical protein	NA	H9C1B5	Pectobacterium_phage	67.2	2.2e-17
AYH34510.1|3352062_3352389_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	60.7	1.9e-22
AYH32950.1|3352345_3352927_-	hypothetical protein	NA	H9C1B8	Pectobacterium_phage	54.9	3.8e-58
AYH32951.1|3352936_3355003_-|tail	phage tail protein	tail	H9C1B7	Pectobacterium_phage	58.6	5.6e-205
AYH32952.1|3355068_3357015_-	hypothetical protein	NA	A0A2D2W7C0	Pectobacterium_phage	33.0	1.4e-43
AYH34511.1|3357017_3357767_-	hypothetical protein	NA	H9C1B4	Pectobacterium_phage	54.4	7.0e-57
AYH32953.1|3357992_3358832_-	hypothetical protein	NA	P79672	Haemophilus_phage	29.1	2.5e-18
AYH32954.1|3358843_3360040_-	hypothetical protein	NA	Q6IWQ3	Burkholderia_phage	48.3	7.0e-83
AYH32955.1|3360032_3360383_-	hypothetical protein	NA	Q6IWQ2	Burkholderia_phage	48.6	5.1e-18
AYH32956.1|3360391_3361072_-	hypothetical protein	NA	Q6IWQ1	Burkholderia_phage	46.3	1.6e-44
AYH32957.1|3361050_3361896_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.9	1.4e-50
AYH32958.1|3361892_3362195_-	hypothetical protein	NA	NA	NA	NA	NA
AYH32959.1|3362191_3362722_-	hypothetical protein	NA	Q6IWP8	Burkholderia_phage	36.6	2.6e-21
AYH32960.1|3362718_3364272_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	26.0	5.6e-24
AYH32961.1|3364375_3364810_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	56.3	1.1e-30
AYH32962.1|3364809_3365253_-	hypothetical protein	NA	A0A0F6SJB3	Pseudomonas_phage	53.8	3.1e-36
AYH32963.1|3365266_3366760_-	DUF3383 domain-containing protein	NA	I7B2P4	Escherichia_phage	40.6	1.8e-88
AYH32964.1|3366773_3367316_-	hypothetical protein	NA	NA	NA	NA	NA
AYH32965.1|3367312_3367678_-	hypothetical protein	NA	A0A0S3UGD4	Pseudomonas_phage	30.4	5.0e-08
AYH32966.1|3367674_3368178_-	hypothetical protein	NA	NA	NA	NA	NA
AYH32967.1|3368177_3368615_-	DUF4054 domain-containing protein	NA	A0A0K0L9X6	Pseudomonas_phage	45.5	3.6e-29
AYH32968.1|3368624_3368993_-	hypothetical protein	NA	NA	NA	NA	NA
AYH32969.1|3369049_3370189_-	hypothetical protein	NA	Q6IWU6	Burkholderia_phage	46.3	2.0e-95
AYH32970.1|3370201_3370699_-	hypothetical protein	NA	A1Z022	Burkholderia_virus	32.0	6.8e-08
AYH32971.1|3370698_3371889_-	hypothetical protein	NA	Q6IWU4	Burkholderia_phage	40.4	4.0e-46
AYH32972.1|3371885_3372761_-|head	head morphogenesis protein	head	Q6IWU3	Burkholderia_phage	38.2	4.8e-49
AYH32973.1|3372708_3374253_-|head	phage head protein	head	Q6IWU2	Burkholderia_phage	45.8	1.4e-112
AYH32974.1|3374257_3375865_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	74.0	1.3e-236
AYH32975.1|3376084_3376558_-	hypothetical protein	NA	F1C5D6	Cronobacter_phage	69.1	2.6e-49
AYH32976.1|3376588_3377227_-	hypothetical protein	NA	H9C189	Pectobacterium_phage	95.3	2.4e-122
AYH32977.1|3377343_3377589_-	hypothetical protein	NA	NA	NA	NA	NA
AYH32978.1|3377681_3378233_-	hypothetical protein	NA	H9C185	Pectobacterium_phage	76.2	1.8e-65
AYH32979.1|3378229_3378670_-	muraminidase	NA	A0A0M4R365	Salmonella_phage	69.1	5.8e-51
AYH32980.1|3378653_3378995_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
AYH32981.1|3379092_3379500_-	antitoxin	NA	F1C593	Cronobacter_phage	63.7	5.5e-40
AYH32982.1|3379548_3379725_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	62.1	5.5e-13
AYH32983.1|3379785_3380511_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	65.2	9.1e-86
AYH32984.1|3380744_3381149_-	antitermination protein	NA	U5P0A5	Shigella_phage	52.1	5.1e-30
AYH32985.1|3381148_3382006_-	helix-turn-helix domain containing protein	NA	F1C596	Cronobacter_phage	62.7	1.3e-102
AYH32986.1|3381995_3383387_-	helicase	NA	Q8W640	Enterobacteria_phage	53.0	9.5e-132
AYH32987.1|3383383_3384253_-	hypothetical protein	NA	K7PLU3	Enterobacteria_phage	44.7	4.0e-56
AYH32988.1|3384249_3385173_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	47.2	2.6e-37
AYH32989.1|3385169_3385469_-	hypothetical protein	NA	NA	NA	NA	NA
AYH32990.1|3385465_3386332_-	hypothetical protein	NA	Q8W644	Enterobacteria_phage	77.6	8.4e-70
AYH32991.1|3386614_3386848_-	transcriptional regulator	NA	G8C7U2	Escherichia_phage	52.1	3.3e-13
AYH32992.1|3386980_3387667_+	hypothetical protein	NA	A0A2I6PIE7	Escherichia_phage	52.8	1.7e-57
AYH32993.1|3387829_3388135_+	hypothetical protein	NA	NA	NA	NA	NA
AYH32994.1|3388139_3388406_+	hypothetical protein	NA	NA	NA	NA	NA
AYH32995.1|3388392_3388764_+	hypothetical protein	NA	NA	NA	NA	NA
AYH32996.1|3388914_3389232_+	hypothetical protein	NA	NA	NA	NA	NA
AYH32997.1|3389224_3389497_+	hypothetical protein	NA	NA	NA	NA	NA
AYH32998.1|3389652_3389853_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	45.6	5.7e-06
AYH32999.1|3389845_3390079_+	hypothetical protein	NA	NA	NA	NA	NA
AYH33000.1|3390068_3390575_+	hypothetical protein	NA	F1C5A2	Cronobacter_phage	43.5	1.6e-33
>prophage 7
CP026979	Pectobacterium parmentieri strain IFB5432 chromosome, complete genome	5010533	3624957	3705274	5010533	lysis,portal,integrase,holin,coat	Enterobacteria_phage(18.33%)	99	3660018:3660062	3701092:3701136
AYH33184.1|3624957_3626217_+|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	44.3	3.0e-84
AYH33185.1|3627119_3627341_-	DNA-binding protein	NA	A0A2I7S995	Vibrio_phage	63.2	2.1e-17
AYH33186.1|3627461_3627722_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYH33187.1|3627825_3628092_+	transcriptional regulator	NA	NA	NA	NA	NA
AYH34520.1|3628765_3629101_+	hypothetical protein	NA	NA	NA	NA	NA
AYH33188.1|3629087_3630038_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
AYH33189.1|3630177_3631899_-	ATPase	NA	NA	NA	NA	NA
AYH33190.1|3631909_3632923_-	SIR2 family protein	NA	NA	NA	NA	NA
AYH33191.1|3633635_3634895_+|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.2	1.8e-76
AYH33192.1|3635001_3635196_-	hypothetical protein	NA	A0A0K2FIR8	Escherichia_phage	43.1	3.8e-07
AYH33193.1|3635381_3635723_+	hypothetical protein	NA	NA	NA	NA	NA
AYH33194.1|3635892_3636576_+	hypothetical protein	NA	NA	NA	NA	NA
AYH33195.1|3636627_3637371_+	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
AYH33196.1|3637429_3637648_+	hypothetical protein	NA	NA	NA	NA	NA
AYH33197.1|3637650_3637956_+	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AYH33198.1|3638284_3638671_+	hypothetical protein	NA	NA	NA	NA	NA
AYH33199.1|3639146_3639641_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYH33200.1|3639637_3639931_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AYH33201.1|3640118_3640805_-	DNA primase	NA	A0A0K0N7B5	Gordonia_phage	53.5	8.0e-07
AYH33202.1|3641367_3642597_+|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	44.1	8.5e-84
AYH33203.1|3642630_3642894_+	transcriptional regulator	NA	NA	NA	NA	NA
AYH33204.1|3643300_3645271_+	hypothetical protein	NA	C6ZR20	Salmonella_phage	35.1	2.0e-63
AYH33205.1|3645954_3646311_-	hypothetical protein	NA	A0A0A0YSY3	Erwinia_phage	50.6	9.5e-12
AYH33206.1|3648705_3649197_+	hypothetical protein	NA	NA	NA	NA	NA
AYH33207.1|3649189_3649774_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
AYH33208.1|3649947_3652275_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	60.6	3.3e-270
AYH33209.1|3652285_3652627_-	hypothetical protein	NA	NA	NA	NA	NA
AYH33210.1|3652623_3652890_-	hypothetical protein	NA	NA	NA	NA	NA
AYH33211.1|3652886_3653618_-	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	52.5	2.7e-05
AYH33212.1|3653626_3653851_-	hypothetical protein	NA	NA	NA	NA	NA
AYH33213.1|3653847_3654108_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	54.5	8.7e-15
AYH33214.1|3654653_3655385_+	hypothetical protein	NA	NA	NA	NA	NA
AYH33215.1|3655381_3655630_+	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	61.9	1.4e-14
AYH33216.1|3655523_3655760_-	hypothetical protein	NA	NA	NA	NA	NA
AYH33217.1|3655748_3655955_+	hypothetical protein	NA	NA	NA	NA	NA
AYH33218.1|3656065_3656965_-	hypothetical protein	NA	NA	NA	NA	NA
AYH33219.1|3656961_3658617_-	hypothetical protein	NA	K7PHD1	Enterobacteria_phage	26.1	1.1e-14
AYH33220.1|3658689_3659856_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	64.0	1.5e-146
AYH33221.1|3659854_3660070_+	hypothetical protein	NA	NA	NA	NA	NA
3660018:3660062	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAA	NA	NA	NA	NA
AYH33222.1|3660340_3662203_-	hypothetical protein	NA	C6ZR19	Salmonella_phage	74.0	2.3e-56
AYH33223.1|3663233_3663395_-	transcriptional regulator	NA	A8CG91	Salmonella_phage	71.7	5.4e-15
AYH33224.1|3663483_3663732_+	toxin-antitoxin system HicB family antitoxin	NA	A5VW60	Enterobacteria_phage	81.0	5.9e-29
AYH34521.1|3664135_3664525_+	hypothetical protein	NA	I6S5X4	Salmonella_phage	58.1	3.2e-37
AYH34522.1|3664542_3666285_-	injection protein	NA	A0A2I7QQN9	Vibrio_phage	36.5	9.5e-89
AYH33225.1|3666854_3668261_-	acyltransferase	NA	I6RSG0	Salmonella_phage	37.5	4.4e-60
AYH33226.1|3668260_3668935_-	DNA transfer protein	NA	A0A0A0P253	Enterobacteria_phage	52.5	8.0e-44
AYH33227.1|3668918_3669311_-	hypothetical protein	NA	NA	NA	NA	NA
AYH33228.1|3669319_3670186_-	hypothetical protein	NA	Q716G6	Shigella_phage	65.1	3.9e-51
AYH33229.1|3670186_3671605_-	hypothetical protein	NA	A0A075B8I2	Enterobacteria_phage	77.5	3.8e-221
AYH33230.1|3671576_3672068_-	hypothetical protein	NA	C6ZR12	Salmonella_phage	86.5	7.1e-74
AYH33231.1|3672051_3672282_-	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	71.7	1.3e-14
AYH33232.1|3672285_3672537_-	hypothetical protein	NA	A0A141E1X7	Streptococcus_phage	60.0	9.3e-22
AYH33233.1|3672587_3673871_-|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	72.3	1.1e-179
AYH33234.1|3673870_3674779_-	scaffolding protein	NA	G5DA98	Enterobacteria_phage	73.9	2.1e-116
AYH33235.1|3674792_3676961_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	76.6	2.2e-300
AYH33236.1|3676960_3678409_-	DNA packaging protein	NA	Q2A0C1	Sodalis_phage	70.2	4.1e-202
AYH33237.1|3678377_3678830_-	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	57.1	3.6e-32
AYH33238.1|3678840_3679107_-	hypothetical protein	NA	A0A286N2R1	Klebsiella_phage	50.0	8.6e-10
AYH33239.1|3679231_3679510_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	57.5	3.0e-21
AYH33240.1|3679728_3680163_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	52.3	5.5e-30
AYH33241.1|3680141_3680621_-	lysozyme	NA	B6SD29	Bacteriophage	60.6	5.9e-49
AYH33242.1|3680617_3680803_-|holin	holin	holin	B6SD15	Bacteriophage	73.1	1.1e-16
AYH33243.1|3680934_3681141_+	hypothetical protein	NA	NA	NA	NA	NA
AYH33244.1|3681164_3681455_+	hypothetical protein	NA	NA	NA	NA	NA
AYH33245.1|3681723_3682215_-	antiterminator	NA	I6S672	Salmonella_phage	76.7	1.7e-67
AYH33246.1|3682214_3682727_-	Fis family transcriptional regulator	NA	Q7Y5K0	Xanthomonas_virus	47.7	4.4e-34
AYH33247.1|3682985_3683192_-	hypothetical protein	NA	NA	NA	NA	NA
AYH33248.1|3683188_3683992_-	HNH endonuclease	NA	A0A2I7QND8	Vibrio_phage	47.0	6.8e-42
AYH33249.1|3683988_3684351_-	hypothetical protein	NA	E5AGG1	Erwinia_phage	69.2	1.2e-41
AYH33250.1|3684347_3684638_-	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	78.1	1.9e-39
AYH33251.1|3684630_3684831_-	hypothetical protein	NA	NA	NA	NA	NA
AYH33252.1|3684814_3685186_-	Eaf protein	NA	T1SA95	Salmonella_phage	49.6	3.5e-25
AYH33253.1|3685182_3685362_-	NinE family protein	NA	I6RSI9	Salmonella_phage	55.2	2.9e-09
AYH34523.1|3685345_3686056_-	Dcm methylase	NA	A0A2I7R4M7	Vibrio_phage	63.9	6.2e-79
AYH33254.1|3686067_3686370_-	hypothetical protein	NA	NA	NA	NA	NA
AYH33255.1|3686377_3686827_-	hypothetical protein	NA	A0A2R2Z328	Escherichia_phage	63.8	4.8e-53
AYH33256.1|3687068_3687266_-	hypothetical protein	NA	NA	NA	NA	NA
AYH33257.1|3687258_3687642_-	hypothetical protein	NA	NA	NA	NA	NA
AYH34524.1|3687702_3689118_-	helicase DnaB	NA	F1C5C4	Cronobacter_phage	62.4	5.1e-165
AYH33258.1|3689107_3690007_-	DNA replication protein	NA	A0A0N7C1Z7	Escherichia_phage	63.9	3.4e-98
AYH33259.1|3690166_3690466_-	hypothetical protein	NA	E5AGE8	Erwinia_phage	70.7	7.4e-34
AYH33260.1|3690572_3690761_-	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	82.3	4.5e-21
AYH33261.1|3690864_3691578_+	LexA family transcriptional repressor	NA	A0A286S2B2	Klebsiella_phage	64.1	1.2e-74
AYH33262.1|3692014_3692224_+	hypothetical protein	NA	NA	NA	NA	NA
AYH33263.1|3692280_3692502_+	hypothetical protein	NA	NA	NA	NA	NA
AYH33264.1|3692774_3693824_+	hypothetical protein	NA	A0A0U4B0I3	Pseudomonas_phage	46.7	2.5e-28
AYH33265.1|3694177_3695116_+	hypothetical protein	NA	K7P6J9	Enterobacteria_phage	76.3	1.4e-41
AYH33266.1|3695306_3695630_+	hypothetical protein	NA	NA	NA	NA	NA
AYH33267.1|3695629_3696559_+	recombinase RecT	NA	F1C5B8	Cronobacter_phage	82.5	1.5e-149
AYH33268.1|3696555_3697236_+	exonuclease	NA	F1C5B7	Cronobacter_phage	80.5	1.4e-109
AYH33269.1|3697286_3697646_+	hypothetical protein	NA	NA	NA	NA	NA
AYH33270.1|3697649_3698588_+	hypothetical protein	NA	A0A1U9HZ41	Salmonella_phage	55.1	8.9e-25
AYH33271.1|3698590_3698818_+	hypothetical protein	NA	A0A193GYL4	Enterobacter_phage	57.3	1.1e-16
AYH33272.1|3698889_3699117_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	70.4	1.7e-19
AYH33273.1|3699205_3699397_+	hypothetical protein	NA	NA	NA	NA	NA
AYH33274.1|3699464_3699686_+	hypothetical protein	NA	A0A2H4J398	uncultured_Caudovirales_phage	66.2	1.1e-18
AYH33275.1|3699913_3701074_+|integrase	integrase	integrase	U5P434	Shigella_phage	82.4	8.9e-192
AYH33276.1|3701835_3703902_+	L-ascorbate oxidase	NA	NA	NA	NA	NA
3701092:3701136	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAA	NA	NA	NA	NA
AYH33277.1|3704020_3705274_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.2	4.1e-94
>prophage 8
CP026979	Pectobacterium parmentieri strain IFB5432 chromosome, complete genome	5010533	4380912	4389604	5010533		Dickeya_phage(42.86%)	7	NA	NA
AYH33826.1|4380912_4382037_+	pectate lyase	NA	A0A140XB77	Dickeya_phage	71.7	1.7e-54
AYH33827.1|4382704_4383829_+	pectate lyase	NA	A0A140XB77	Dickeya_phage	73.2	1.8e-56
AYH33828.1|4384536_4385661_+	pectate lyase	NA	A0A140XB77	Dickeya_phage	77.5	1.7e-59
AYH33829.1|4385823_4387101_+	pectate lyase	NA	A0A1B1IPS8	uncultured_Mediterranean_phage	32.9	2.9e-34
AYH33830.1|4387185_4387755_-	peptidylprolyl isomerase A	NA	A0A1V0S9I2	Catovirus	31.9	3.9e-07
AYH33831.1|4387958_4388768_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	1.3e-29
AYH33832.1|4388779_4389604_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.8e-13
