The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032515	Escherichia coli strain 118UI chromosome, complete genome	5205677	199570	272659	5205677	plate,tRNA,transposase,protease	Emiliania_huxleyi_virus(10.0%)	59	NA	NA
AYE14232.1|199570_200923_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
AYE14233.1|200952_203385_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AYE14234.1|203506_203992_+	chaperone protein Skp	NA	NA	NA	NA	NA
AYE14235.1|203995_205021_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AYE14236.1|205125_205581_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AYE14237.1|205584_206373_+	acyl-[acyl-carrier-protein]--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AYE14238.1|206372_207521_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AYE14239.1|207517_208114_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
AYE14240.1|208150_211633_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
AYE14241.1|211645_212605_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AYE14242.1|212703_214845_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
AYE14243.1|214901_215291_+	VOC family protein	NA	NA	NA	NA	NA
AYE14244.1|215355_216651_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AYE18848.1|216699_216954_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
AYE14245.1|216946_217147_-	YaeP family protein	NA	NA	NA	NA	NA
AYE14246.1|217312_217858_+	YaeQ family protein	NA	NA	NA	NA	NA
AYE14247.1|217854_218277_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AYE14248.1|218290_219001_+	copper homeostasis/adhesion lipoprotein NlpE	NA	NA	NA	NA	NA
AYE14249.1|219030_219855_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
AYE14250.1|219907_221626_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AYE14251.1|221736_222444_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AYE14252.1|222440_222845_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
AYE14253.1|222962_223778_-	methionine ABC transporter substrate-binding protein MetQ	NA	NA	NA	NA	NA
AYE14254.1|223817_224471_-	methionine ABC transporter	NA	NA	NA	NA	NA
AYE14255.1|224463_225495_-	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
AYE14256.1|225682_226255_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AYE14257.1|232016_232820_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SKP9	Klosneuvirus	31.4	4.4e-33
AYE14258.1|232816_233731_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYE14259.1|233971_234772_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AYE14260.1|234848_235619_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYE14261.1|235666_237025_-	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
AYE14262.1|237096_237852_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AYE14263.1|237885_238608_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYE14264.1|238604_239072_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AYE18849.1|239136_239868_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
AYE14265.1|240403_241189_+	hypothetical protein	NA	NA	NA	NA	NA
AYE14266.1|241528_242008_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AYE14267.1|242025_243384_-	hypothetical protein	NA	NA	NA	NA	NA
AYE14268.1|243394_246922_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AYE14269.1|246941_248450_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AYE14270.1|248388_249132_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AYE14271.1|249128_251861_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.1	1.4e-83
AYE14272.1|251870_252644_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AYE14273.1|252648_253995_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AYE14274.1|253997_254522_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AYE18850.1|254518_255799_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AYE14275.1|255815_256865_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AYE14276.1|256828_258688_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AYE14277.1|258675_259101_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AYE14278.1|259105_260590_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AYE14279.1|260612_261116_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AYE14280.1|261818_262337_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AYE14281.1|262557_264516_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	1.9e-24
AYE14282.1|264512_265355_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AYE14283.1|265376_266948_+	hypothetical protein	NA	NA	NA	NA	NA
AYE14284.1|267014_268025_+	hypothetical protein	NA	NA	NA	NA	NA
AYE14285.1|269321_269462_-	hypothetical protein	NA	NA	NA	NA	NA
AYE14286.1|269825_271076_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.1	3.6e-29
AYE14287.1|271522_272659_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP032515	Escherichia coli strain 118UI chromosome, complete genome	5205677	636641	706389	5205677	protease,portal,integrase,terminase,lysis,transposase,capsid,head,tRNA,tail	Enterobacteria_phage(50.0%)	90	646793:646839	693320:693366
AYE14611.1|636641_638027_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	5.1e-45
AYE14612.1|638062_638584_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYE14613.1|638691_638904_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AYE14614.1|638905_639772_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AYE14615.1|640242_640785_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AYE14616.1|641004_641697_+	molecular chaperone FimC	NA	NA	NA	NA	NA
AYE14617.1|641727_644337_+	outer membrane usher protein	NA	NA	NA	NA	NA
AYE14618.1|644349_645357_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AYE14619.1|645367_645883_+	fimbriae assembly protein	NA	NA	NA	NA	NA
AYE14620.1|645885_646518_-	DNA-binding response regulator	NA	NA	NA	NA	NA
646793:646839	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AYE14621.1|646852_648016_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
AYE14622.1|647871_648243_-	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
AYE14623.1|648214_648493_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.7	2.4e-47
AYE14624.1|648540_648759_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
AYE14625.1|648857_649139_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
AYE14626.1|649149_649341_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
AYE14627.1|649313_649496_-	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	95.0	9.1e-27
AYE14628.1|649492_650173_-	exonuclease	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.6	4.6e-132
AYE14629.1|650169_650955_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AYE14630.1|650960_651257_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
AYE14631.1|651332_651539_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	83.8	3.5e-27
AYE14632.1|652021_652954_-	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	54.4	2.8e-87
AYE14633.1|652950_653424_-	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	61.6	1.3e-53
AYE14634.1|653505_654261_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AYE14635.1|654299_654530_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AYE14636.1|654599_655139_+	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	1.5e-61
AYE14637.1|655135_656155_+	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	63.8	8.8e-111
AYE14638.1|656151_656853_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	97.9	9.3e-128
AYE14639.1|656849_657152_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	96.8	2.7e-44
AYE14640.1|657082_657292_+	hypothetical protein	NA	NA	NA	NA	NA
AYE14641.1|657400_658903_-	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	53.7	3.8e-62
AYE14642.1|659278_659452_+	hypothetical protein	NA	NA	NA	NA	NA
AYE14643.1|659715_660324_+	hypothetical protein	NA	Q7Y5X0	Haemophilus_phage	42.1	6.3e-32
AYE14644.1|660559_661069_+	hypothetical protein	NA	NA	NA	NA	NA
AYE14645.1|661165_661267_+	hypothetical protein	NA	NA	NA	NA	NA
AYE14646.1|661263_661719_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	68.2	2.2e-61
AYE14647.1|661718_661889_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AYE14648.1|661881_662172_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.7e-46
AYE14649.1|662168_662531_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	5.6e-60
AYE14650.1|662527_662668_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
AYE14651.1|662753_663137_+	antitermination protein	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
AYE14652.1|663326_664409_-	porin	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
AYE14653.1|664982_665198_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AYE14654.1|665197_665695_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	95.2	5.6e-87
AYE14655.1|665691_666159_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
AYE14656.1|666146_666299_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
AYE14657.1|666440_666605_-	hypothetical protein	NA	NA	NA	NA	NA
AYE14658.1|666650_667061_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	9.8e-53
AYE14659.1|667118_667352_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.1	1.5e-21
AYE14660.1|667740_668286_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.1e-94
AYE14661.1|668260_670186_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
AYE14662.1|670182_670389_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AYE14663.1|670385_671987_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	3.2e-309
AYE14664.1|671967_673287_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
AYE14665.1|673296_673629_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AYE14666.1|673684_674710_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.4	5.2e-188
AYE14667.1|674751_675147_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
AYE14668.1|675158_675512_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	2.6e-62
AYE14669.1|675523_676102_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	1.7e-79
AYE14670.1|676098_676494_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.2e-70
AYE18858.1|676501_677242_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	96.7	1.2e-128
AYE14671.1|677257_677680_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	2.0e-69
AYE14672.1|677661_678096_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.0e-63
AYE14673.1|678088_680668_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.9	0.0e+00
AYE14674.1|680664_680994_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	6.8e-57
AYE14675.1|680993_681692_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	1.2e-130
AYE14676.1|681697_682441_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	3.3e-147
AYE14677.1|682338_682986_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.1e-111
AYE14678.1|686602_688972_+|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	43.7	9.3e-87
AYE14679.1|688968_689250_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	1.2e-17
AYE14680.1|689259_689964_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.1	6.6e-57
AYE14681.1|689974_690268_+	hypothetical protein	NA	NA	NA	NA	NA
AYE14682.1|690943_691693_+	transcriptional regulator	NA	NA	NA	NA	NA
AYE14683.1|691942_692896_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
AYE14684.1|693299_693416_-	hypothetical protein	NA	NA	NA	NA	NA
693320:693366	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AYE14685.1|693409_694171_-	porin thermoregulatory protein EnvY	NA	NA	NA	NA	NA
AYE14686.1|694353_695244_-	DUF4434 family protein	NA	NA	NA	NA	NA
AYE14687.1|695244_698217_-	phage receptor	NA	NA	NA	NA	NA
AYE14688.1|698203_700441_-	bacteriophage N4 adsorption protein B	NA	NA	NA	NA	NA
AYE14689.1|700777_701002_-	hypothetical protein	NA	NA	NA	NA	NA
AYE14690.1|700988_701159_+	hypothetical protein	NA	NA	NA	NA	NA
AYE14691.1|701378_701807_-	hypothetical protein	NA	NA	NA	NA	NA
AYE14692.1|701834_702281_-	hypothetical protein	NA	NA	NA	NA	NA
AYE14693.1|702611_702854_-	hypothetical protein	NA	NA	NA	NA	NA
AYE14694.1|702887_703124_-	hypothetical protein	NA	NA	NA	NA	NA
AYE14695.1|703101_704238_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AYE14696.1|704316_704586_-	hypothetical protein	NA	NA	NA	NA	NA
AYE14697.1|704603_705065_-	hypothetical protein	NA	NA	NA	NA	NA
AYE14698.1|705067_705268_-	hypothetical protein	NA	NA	NA	NA	NA
AYE14699.1|705252_706389_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP032515	Escherichia coli strain 118UI chromosome, complete genome	5205677	1043520	1145358	5205677	protease,portal,integrase,terminase,lysis,holin,capsid,transposase,head,plate,tRNA,tail	Escherichia_phage(37.29%)	92	1057364:1057384	1151611:1151631
AYE15014.1|1043520_1043841_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AYE15015.1|1043871_1046148_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AYE15016.1|1046265_1046664_-	hypothetical protein	NA	NA	NA	NA	NA
AYE15017.1|1047308_1047527_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AYE15018.1|1047811_1048516_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AYE15019.1|1048557_1050279_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	3.8e-21
AYE15020.1|1050279_1052046_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
AYE15021.1|1052168_1053134_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
AYE15022.1|1053679_1054174_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AYE15023.1|1054308_1058415_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
1057364:1057384	attL	ATCTGGCGAAAATGCCGCACT	NA	NA	NA	NA
AYE15024.1|1058573_1059185_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AYE15025.1|1059195_1060539_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AYE15026.1|1060629_1061922_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AYE15027.1|1062160_1064605_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
AYE15028.1|1064615_1065233_+	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AYE15029.1|1065234_1066098_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AYE15030.1|1066133_1066760_-	hydrolase	NA	NA	NA	NA	NA
AYE15031.1|1067074_1068223_+	MFS transporter	NA	NA	NA	NA	NA
AYE15032.1|1068432_1069863_+	amino acid permease	NA	NA	NA	NA	NA
AYE15033.1|1070072_1070870_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
AYE15034.1|1070901_1071897_-|integrase	site-specific integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
AYE15035.1|1071990_1072290_-	XRE family transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
AYE18866.1|1072398_1072755_+	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
AYE15036.1|1072738_1072936_+	hypothetical protein	NA	A0A0F7LDS9	Escherichia_phage	100.0	2.8e-29
AYE15037.1|1072932_1073433_+	replication protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
AYE15038.1|1073496_1073721_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	8.0e-33
AYE15039.1|1073720_1074020_+	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	93.9	5.6e-42
AYE15040.1|1074022_1074247_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
AYE15041.1|1074243_1074519_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
AYE15042.1|1074508_1076788_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.2	0.0e+00
AYE15043.1|1076903_1077392_+	phosphohistidine phosphatase	NA	NA	NA	NA	NA
AYE15044.1|1077406_1078492_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYE15045.1|1079102_1080137_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.4	2.1e-200
AYE15046.1|1080136_1081909_-	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
AYE15047.1|1082082_1082937_+|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
AYE15048.1|1082995_1084069_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.7	1.9e-201
AYE15049.1|1084072_1084816_+|terminase	terminase	terminase	Q94MK1	Enterobacteria_phage	98.8	1.2e-120
AYE15050.1|1084915_1085425_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AYE15051.1|1085424_1085628_+|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	98.5	2.6e-30
AYE15052.1|1085631_1085913_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AYE15053.1|1085912_1086410_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
AYE15054.1|1086424_1086850_+	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	95.0	8.0e-58
AYE15055.1|1086837_1087281_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	4.9e-66
AYE15056.1|1087234_1087408_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
AYE15057.1|1087370_1087838_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	8.7e-82
AYE15058.1|1087830_1088283_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	3.1e-76
AYE15059.1|1088349_1088985_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	1.3e-112
AYE15060.1|1088981_1089329_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	1.1e-57
AYE15061.1|1089333_1090242_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	100.0	1.5e-162
AYE15062.1|1090234_1090765_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	98.9	3.9e-102
AYE15063.1|1090775_1093535_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	77.4	0.0e+00
AYE15064.1|1093538_1094066_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	93.1	2.2e-89
AYE15065.1|1094287_1094881_+	lysogenic conversion protein	NA	Q858S7	Enterobacteria_phage	100.0	1.2e-107
AYE15066.1|1095210_1096401_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	1.6e-225
AYE15067.1|1096413_1096932_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AYE15068.1|1096988_1097264_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
AYE15069.1|1097296_1097416_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AYE15070.1|1097408_1099856_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	95.6	0.0e+00
AYE15071.1|1099870_1100350_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	1.1e-84
AYE15072.1|1100349_1101513_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.7	3.8e-203
AYE15073.1|1101558_1101813_+	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AYE15074.1|1102131_1104414_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
AYE15075.1|1104468_1105326_-	formate transporter FocA	NA	NA	NA	NA	NA
AYE15076.1|1105731_1107492_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AYE15077.1|1107621_1108314_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AYE15078.1|1108512_1109601_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	4.5e-81
AYE15079.1|1109671_1110955_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AYE15080.1|1111124_1111889_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYE15081.1|1112061_1112745_+	cytidylate kinase	NA	NA	NA	NA	NA
AYE15082.1|1112855_1114529_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
AYE15083.1|1114688_1114973_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
AYE15084.1|1115179_1117444_+	ComEC family protein	NA	NA	NA	NA	NA
AYE15085.1|1117480_1119229_+	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
AYE15086.1|1119225_1120212_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AYE15087.1|1120248_1121481_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYE15088.1|1121532_1121715_+	protein YcaR	NA	NA	NA	NA	NA
AYE15089.1|1121711_1122458_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AYE15090.1|1122611_1123505_+	hypothetical protein	NA	NA	NA	NA	NA
AYE15091.1|1123481_1124261_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AYE15092.1|1124396_1125182_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AYE15093.1|1125178_1126501_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
AYE15094.1|1126481_1127186_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
AYE15095.1|1127185_1131646_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
AYE15096.1|1131906_1133754_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AYE18867.1|1133934_1134483_+	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
AYE15097.1|1134509_1135157_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYE15098.1|1135207_1136398_-	aspartate aminotransferase	NA	NA	NA	NA	NA
AYE15099.1|1136582_1137671_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	3.1e-98
AYE15100.1|1138273_1139674_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
AYE15101.1|1139842_1141045_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AYE15102.1|1141310_1143923_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	9.1e-19
AYE15103.1|1144010_1145358_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
1151611:1151631	attR	ATCTGGCGAAAATGCCGCACT	NA	NA	NA	NA
>prophage 4
CP032515	Escherichia coli strain 118UI chromosome, complete genome	5205677	1322162	1381960	5205677	portal,integrase,terminase,lysis,holin,transposase,capsid,head,tRNA,tail	Enterobacteria_phage(53.23%)	79	1325893:1325915	1376656:1376678
AYE15282.1|1322162_1323269_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AYE15283.1|1323322_1323784_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AYE15284.1|1323793_1324447_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AYE15285.1|1324618_1325869_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
1325893:1325915	attL	AACGGGCGTGTTATACGCCCGTT	NA	NA	NA	NA
AYE15286.1|1325982_1327125_-|integrase	integrase	integrase	O21929	Phage_21	99.4	3.1e-205
AYE15287.1|1327114_1327351_-	excisionase	NA	NA	NA	NA	NA
AYE15288.1|1327490_1327730_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	93.7	2.0e-37
AYE15289.1|1327777_1327996_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	1.7e-35
AYE15290.1|1328088_1328376_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	1.2e-44
AYE15291.1|1328386_1328578_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	95.2	1.2e-24
AYE15292.1|1328550_1328733_-	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	3.7e-28
AYE15293.1|1328729_1329410_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	4.6e-132
AYE15294.1|1329406_1330192_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
AYE15295.1|1330197_1330614_-	Host-nuclease inhibitor protein gam	NA	C6ZCV5	Enterobacteria_phage	98.6	5.1e-73
AYE15296.1|1330568_1330838_-	host cell division inhibitory peptide Kil	NA	M1FN78	Enterobacteria_phage	100.0	1.7e-42
AYE15297.1|1330917_1331286_-	lambda prophage-derived protein ea10	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
AYE15298.1|1331546_1332128_+	superinfection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	99.5	3.4e-99
AYE15299.1|1332144_1332537_-	regulator	NA	A0A075B8K6	Enterobacteria_phage	70.6	1.7e-30
AYE15300.1|1332538_1332712_-	hypothetical protein	NA	NA	NA	NA	NA
AYE15301.1|1332895_1333795_-	hypothetical protein	NA	NA	NA	NA	NA
AYE15302.1|1333924_1334632_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	98.7	2.2e-132
AYE15303.1|1334710_1334938_+	DNA-binding protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
AYE15304.1|1335044_1335344_+	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	96.0	2.0e-47
AYE15305.1|1335376_1336276_+	Replication protein O	NA	M1FN81	Enterobacteria_phage	100.0	1.7e-174
AYE15306.1|1336272_1336974_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
AYE15307.1|1336970_1337261_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
AYE15308.1|1337316_1337775_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.3e-81
AYE15309.1|1337771_1338299_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
AYE15310.1|1338295_1338472_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
AYE15311.1|1338432_1338816_+	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	95.7	3.7e-62
AYE15312.1|1338808_1339003_+	protein ninF	NA	NA	NA	NA	NA
AYE15313.1|1339251_1340465_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
AYE15314.1|1340521_1340698_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	96.2	6.5e-22
AYE15315.1|1340694_1340835_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
AYE15316.1|1340920_1341298_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	85.0	1.3e-54
AYE15317.1|1341454_1341979_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.1	4.2e-48
AYE15318.1|1342344_1343573_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.7	1.9e-168
AYE15319.1|1344776_1345517_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYE15320.1|1345684_1345900_+|holin	holin	holin	M1FN85	Enterobacteria_phage	94.4	4.5e-33
AYE15321.1|1345899_1346397_+	lysozyme	NA	A5LH83	Enterobacteria_phage	98.8	4.9e-91
AYE15322.1|1346393_1346855_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	99.3	2.4e-76
AYE15323.1|1346886_1347180_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
AYE15324.1|1347539_1347734_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	4.8e-26
AYE15325.1|1348122_1348668_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.1e-94
AYE15326.1|1348642_1350568_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
AYE15327.1|1350564_1350771_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AYE15328.1|1350767_1352369_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.4e-309
AYE15329.1|1352349_1353669_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
AYE15330.1|1353678_1354011_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AYE15331.1|1354066_1355092_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.4	5.2e-188
AYE15332.1|1355192_1356521_+|transposase	IS4 family transposase IS4	transposase	NA	NA	NA	NA
AYE15333.1|1356571_1356967_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	1.8e-56
AYE15334.1|1356978_1357332_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	2.6e-62
AYE15335.1|1357343_1357922_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	1.7e-79
AYE15336.1|1357918_1358314_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.2e-70
AYE18878.1|1358321_1359062_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	96.7	1.2e-128
AYE15337.1|1359077_1359500_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	2.0e-69
AYE15338.1|1359481_1359916_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.0e-63
AYE15339.1|1359908_1362488_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	89.2	0.0e+00
AYE15340.1|1362484_1362814_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	6.8e-57
AYE15341.1|1362813_1363512_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	1.2e-130
AYE15342.1|1363517_1364261_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	5.9e-149
AYE15343.1|1364158_1364806_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	2.5e-111
AYE15344.1|1364865_1368348_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
AYE15345.1|1368406_1370428_+|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.5	3.8e-182
AYE15346.1|1370424_1370703_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
AYE15347.1|1370715_1371009_+	hypothetical protein	NA	NA	NA	NA	NA
AYE15348.1|1371100_1371958_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AYE15349.1|1371954_1372812_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AYE15350.1|1372808_1373636_-	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.0	7.6e-12
AYE15351.1|1373635_1374550_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYE15352.1|1375237_1376008_+	hypothetical protein	NA	NA	NA	NA	NA
AYE15353.1|1376130_1376286_+	hypothetical protein	NA	NA	NA	NA	NA
AYE15354.1|1376479_1376632_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
AYE15355.1|1376734_1377058_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	63.6	1.3e-39
1376656:1376678	attR	AACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
AYE15356.1|1377760_1378165_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AYE15357.1|1378385_1379117_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
AYE15358.1|1379321_1380533_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AYE15359.1|1380943_1381960_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	1.1e-185
>prophage 5
CP032515	Escherichia coli strain 118UI chromosome, complete genome	5205677	1486543	1555720	5205677	protease,portal,integrase,terminase,lysis,holin,transposase,capsid,head,tail	Escherichia_phage(34.62%)	83	1479294:1479308	1508297:1508311
1479294:1479308	attL	CCCAGCAGCCAGCAG	NA	NA	NA	NA
AYE15459.1|1486543_1487674_-|integrase	integrase	integrase	O21940	Phage_21	51.4	3.4e-103
AYE15460.1|1487651_1487900_-	excisionase	NA	NA	NA	NA	NA
AYE15461.1|1487964_1490436_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.9e-58
AYE15462.1|1490528_1490720_-	DUF1482 family protein	NA	NA	NA	NA	NA
AYE15463.1|1490716_1490905_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AYE18885.1|1490813_1491053_+	hypothetical protein	NA	NA	NA	NA	NA
AYE15464.1|1491476_1491755_+	hypothetical protein	NA	NA	NA	NA	NA
AYE15465.1|1491714_1492116_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	81.6	1.0e-09
AYE15466.1|1492138_1492357_-	hypothetical protein	NA	NA	NA	NA	NA
AYE15467.1|1492386_1492557_-	hypothetical protein	NA	NA	NA	NA	NA
AYE15468.1|1492516_1492672_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
AYE15469.1|1492925_1493387_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	99.3	7.6e-78
AYE15470.1|1493494_1493770_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	97.6	1.1e-39
AYE15471.1|1493753_1494179_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AYE15472.1|1494189_1494393_-	hypothetical protein	NA	NA	NA	NA	NA
AYE15473.1|1495079_1495745_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.4e-79
AYE15474.1|1495778_1496549_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	6.7e-87
AYE15475.1|1496564_1496990_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
AYE15476.1|1497164_1497830_+	hypothetical protein	NA	NA	NA	NA	NA
AYE15477.1|1498010_1498223_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	91.4	3.1e-26
AYE15478.1|1498388_1499039_+	hypothetical protein	NA	NA	NA	NA	NA
AYE15479.1|1499019_1500123_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AYE15480.1|1500232_1500454_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	63.8	6.7e-16
AYE15481.1|1500513_1500786_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	1.0e-10
AYE15482.1|1500787_1501834_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	4.5e-110
AYE15483.1|1501846_1502206_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.8	3.5e-38
AYE15484.1|1502202_1502892_+	antiterminator	NA	I6PDF8	Cronobacter_phage	45.1	1.1e-51
AYE15485.1|1503798_1504542_+	protein phosphatase	NA	I6PCV8	Cronobacter_phage	43.1	1.6e-48
AYE15486.1|1504709_1504979_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	3.3e-41
AYE15487.1|1505492_1506706_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
AYE15488.1|1506804_1507026_+	hypothetical protein	NA	NA	NA	NA	NA
AYE15489.1|1507566_1509420_+	DUF1737 domain-containing protein	NA	Q08JA2	Stx2-converting_phage	90.2	0.0e+00
1508297:1508311	attR	CCCAGCAGCCAGCAG	NA	NA	NA	NA
AYE15490.1|1509570_1509786_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
AYE15491.1|1509790_1510135_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
AYE15492.1|1510100_1510373_-	hypothetical protein	NA	NA	NA	NA	NA
AYE15493.1|1510478_1511012_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	3.6e-100
AYE15494.1|1511135_1511351_+	hypothetical protein	NA	NA	NA	NA	NA
AYE18886.1|1511499_1511967_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	85.1	3.0e-66
AYE15495.1|1512317_1512458_+	hypothetical protein	NA	NA	NA	NA	NA
AYE15496.1|1512590_1512776_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
AYE15497.1|1513163_1513712_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.0	6.7e-57
AYE15498.1|1513641_1515612_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	2.1e-262
AYE15499.1|1515595_1515802_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AYE15500.1|1515798_1517391_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	3.8e-185
AYE15501.1|1517380_1518886_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	2.7e-100
AYE15502.1|1518922_1519270_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	3.7e-21
AYE15503.1|1519327_1520356_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
AYE15504.1|1520407_1520791_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
AYE15505.1|1520783_1521137_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
AYE15506.1|1521152_1521728_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	5.8e-51
AYE15507.1|1521724_1522120_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AYE15508.1|1522127_1522880_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
AYE15509.1|1522893_1523325_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	78.1	3.7e-42
AYE15510.1|1523351_1523765_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
AYE15511.1|1523745_1526319_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.2	0.0e+00
AYE15512.1|1526315_1526645_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AYE15513.1|1526644_1527343_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
AYE15514.1|1527414_1528627_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
AYE15515.1|1528687_1529410_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.5	4.3e-144
AYE15516.1|1529307_1529988_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.1	9.1e-112
AYE15517.1|1530331_1533805_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.5	0.0e+00
AYE15518.1|1533872_1534472_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.5	4.5e-107
AYE15519.1|1534623_1537650_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	54.5	7.0e-55
AYE15520.1|1537649_1538234_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
AYE15521.1|1538206_1538344_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AYE18887.1|1538288_1538915_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYE15522.1|1539013_1539283_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
AYE15523.1|1540056_1540563_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AYE15524.1|1540608_1541109_-	YciE/YciF family protein	NA	NA	NA	NA	NA
AYE15525.1|1541194_1541374_-	hypothetical protein	NA	NA	NA	NA	NA
AYE15526.1|1541754_1542561_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AYE15527.1|1542560_1543754_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AYE18888.1|1543765_1545124_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
AYE15528.1|1545127_1546723_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.3e-52
AYE15529.1|1546722_1548285_-	anthranilate synthase component I	NA	NA	NA	NA	NA
AYE18889.1|1548376_1548421_-	trp operon leader peptide	NA	NA	NA	NA	NA
AYE15530.1|1548558_1549440_+	phosphatase	NA	NA	NA	NA	NA
AYE15531.1|1549436_1550057_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AYE15532.1|1550084_1551980_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
AYE15533.1|1552190_1553066_+	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AYE15534.1|1553105_1553696_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AYE15535.1|1553692_1554451_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	9.7e-06
AYE15536.1|1554670_1555720_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.0	3.5e-22
>prophage 6
CP032515	Escherichia coli strain 118UI chromosome, complete genome	5205677	1815619	1868472	5205677	protease,terminase,lysis,transposase,tail	Enterobacteria_phage(46.81%)	65	NA	NA
AYE15767.1|1815619_1815853_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AYE15768.1|1816169_1816760_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AYE15769.1|1816857_1817433_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	2.9e-103
AYE15770.1|1817432_1820348_-	hypothetical protein	NA	Q6H9S9	Enterobacteria_phage	98.3	2.5e-57
AYE15771.1|1820468_1820978_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	3.2e-13
AYE18897.1|1820883_1821102_-	hypothetical protein	NA	NA	NA	NA	NA
AYE15772.1|1821123_1821723_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	99.0	6.7e-111
AYE15773.1|1821789_1825188_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
AYE15774.1|1825248_1825896_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	2.5e-111
AYE15775.1|1825793_1826537_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	5.9e-149
AYE15776.1|1826542_1827241_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
AYE15777.1|1827250_1827580_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
AYE15778.1|1827579_1830645_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
AYE15779.1|1830616_1830946_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AYE18898.1|1830954_1831341_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
AYE15780.1|1831401_1832145_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
AYE15781.1|1832156_1832558_-|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
AYE15782.1|1832554_1833133_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
AYE15783.1|1833144_1833420_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AYE15784.1|1833412_1833781_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	9.7e-52
AYE15785.1|1833822_1835946_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
AYE15786.1|1837302_1837515_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AYE15787.1|1837511_1839614_-|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.9	0.0e+00
AYE15788.1|1839613_1840108_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
AYE15789.1|1840670_1840877_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
AYE15790.1|1841031_1841232_+	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	68.0	1.7e-10
AYE15791.1|1841177_1841588_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.0	2.1e-63
AYE18899.1|1841739_1841913_-	protein GnsB	NA	NA	NA	NA	NA
AYE15792.1|1842084_1842357_-	hypothetical protein	NA	NA	NA	NA	NA
AYE15793.1|1842387_1842576_-	cold-shock protein	NA	NA	NA	NA	NA
AYE15794.1|1842586_1842799_-	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AYE15795.1|1843162_1843660_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
AYE15796.1|1843656_1844190_-	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AYE15797.1|1844186_1844519_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.3	1.1e-25
AYE15798.1|1844502_1844718_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AYE15799.1|1845471_1845687_-	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AYE15800.1|1845987_1846200_+	cold-shock protein CspF	NA	NA	NA	NA	NA
AYE15801.1|1846621_1847374_-	antitermination protein	NA	Q8SBE4	Shigella_phage	95.2	2.5e-131
AYE15802.1|1847387_1848437_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	56.7	6.9e-111
AYE15803.1|1848438_1848717_-	hypothetical protein	NA	NA	NA	NA	NA
AYE15804.1|1848783_1849035_-	hypothetical protein	NA	NA	NA	NA	NA
AYE15805.1|1849251_1849464_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	84.3	1.7e-24
AYE15806.1|1849622_1849826_-	hypothetical protein	NA	NA	NA	NA	NA
AYE15807.1|1850081_1851869_+	DUF4209 domain-containing protein	NA	Q2P9X5	Enterobacteria_phage	23.1	9.3e-15
AYE15808.1|1852087_1852489_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
AYE15809.1|1852529_1853549_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.8e-56
AYE15810.1|1853475_1853997_-	hypothetical protein	NA	NA	NA	NA	NA
AYE15811.1|1853980_1854208_-	transcriptional regulator	NA	NA	NA	NA	NA
AYE15812.1|1854234_1854693_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.8e-24
AYE15813.1|1854885_1855041_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AYE15814.1|1855000_1855618_+	hypothetical protein	NA	NA	NA	NA	NA
AYE15815.1|1856104_1856293_+	division inhibition protein DicB	NA	NA	NA	NA	NA
AYE15816.1|1856289_1856481_+	DUF1482 family protein	NA	NA	NA	NA	NA
AYE15817.1|1856574_1859046_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	55.6	2.1e-57
AYE15818.1|1859118_1859370_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AYE15819.1|1859389_1860685_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	1.9e-155
AYE15820.1|1860704_1860815_-	transporter	NA	NA	NA	NA	NA
AYE15821.1|1860872_1861892_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AYE15822.1|1861903_1863118_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AYE15823.1|1863323_1863650_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
AYE15824.1|1863784_1864126_+	DUF1283 family protein	NA	NA	NA	NA	NA
AYE15825.1|1864160_1864721_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AYE18900.1|1864723_1865434_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AYE15826.1|1865541_1865847_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AYE15827.1|1866045_1868472_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	2.3e-213
>prophage 7
CP032515	Escherichia coli strain 118UI chromosome, complete genome	5205677	2456838	2466281	5205677		Enterobacteria_phage(85.71%)	10	NA	NA
AYE16359.1|2456838_2457975_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.3e-163
AYE16360.1|2457971_2459972_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
AYE16361.1|2460096_2460558_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AYE16362.1|2460599_2461070_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AYE16363.1|2461116_2461836_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYE16364.1|2461832_2463518_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
AYE16365.1|2463739_2464471_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
AYE16366.1|2464530_2464638_+	protein YohO	NA	NA	NA	NA	NA
AYE16367.1|2464618_2465350_-	ABC transporter permease	NA	NA	NA	NA	NA
AYE16368.1|2465354_2466281_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	1.1e-22
>prophage 8
CP032515	Escherichia coli strain 118UI chromosome, complete genome	5205677	2669754	2752891	5205677	protease,portal,terminase,transposase,capsid,holin,head,tRNA,tail	Escherichia_phage(16.0%)	97	NA	NA
AYE16540.1|2669754_2670645_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	44.5	1.4e-67
AYE16541.1|2670840_2671614_-	histidine transport ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
AYE16542.1|2671621_2672338_-	histidine ABC transporter permease HisM	NA	NA	NA	NA	NA
AYE16543.1|2672334_2673021_-	histidine ABC transporter permease	NA	NA	NA	NA	NA
AYE16544.1|2673110_2673893_-	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
AYE16545.1|2674113_2674896_-	lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT	NA	NA	NA	NA	NA
AYE16546.1|2675161_2675731_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
AYE16547.1|2675825_2677343_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
AYE16548.1|2677379_2677868_-	colicin V production protein	NA	NA	NA	NA	NA
AYE16549.1|2678126_2678789_-	cell division protein DedD	NA	NA	NA	NA	NA
AYE16550.1|2678778_2680047_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AYE16551.1|2680116_2681031_-	acetyl-CoA carboxylase carboxyl transferase subunit beta	NA	NA	NA	NA	NA
AYE16552.1|2681186_2681846_-	DedA family protein	NA	NA	NA	NA	NA
AYE16553.1|2681928_2682741_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AYE16554.1|2682740_2683754_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYE16555.1|2683819_2684956_-	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	5.0e-22
AYE16556.1|2685054_2686050_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AYE16557.1|2686046_2687225_-	arabinose transporter	NA	NA	NA	NA	NA
AYE18932.1|2687166_2687388_+	hypothetical protein	NA	NA	NA	NA	NA
AYE16558.1|2687509_2688730_-	3-oxoacyl-ACP synthase I	NA	NA	NA	NA	NA
AYE16559.1|2688888_2690895_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AYE16560.1|2691015_2691294_-	YfcL family protein	NA	NA	NA	NA	NA
AYE16561.1|2691327_2691876_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AYE16562.1|2691875_2692685_-	hypothetical protein	NA	NA	NA	NA	NA
AYE16563.1|2692684_2693509_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AYE16564.1|2693512_2694598_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
AYE16565.1|2694632_2695565_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AYE16566.1|2695730_2696282_+	endonuclease SmrB	NA	NA	NA	NA	NA
AYE16567.1|2696422_2697271_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
AYE16568.1|2697272_2697797_-	fimbrial protein	NA	NA	NA	NA	NA
AYE16569.1|2697793_2698264_-	fimbrial protein	NA	NA	NA	NA	NA
AYE16570.1|2698260_2698875_-	fimbrial protein	NA	NA	NA	NA	NA
AYE16571.1|2698783_2699533_-	fimbrial protein	NA	NA	NA	NA	NA
AYE16572.1|2699552_2702192_-	outer membrane usher protein	NA	NA	NA	NA	NA
AYE16573.1|2702275_2702842_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYE16574.1|2703503_2703989_-	phosphohistidine phosphatase	NA	NA	NA	NA	NA
AYE16575.1|2704191_2706336_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AYE16576.1|2706335_2707646_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AYE16577.1|2707826_2708111_-	DUF406 family protein	NA	NA	NA	NA	NA
AYE16578.1|2708482_2709823_+	long-chain fatty acid transporter	NA	NA	NA	NA	NA
AYE16579.1|2710189_2711437_+	hypothetical protein	NA	NA	NA	NA	NA
AYE16580.1|2711615_2712371_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AYE16581.1|2712396_2712567_-	hypothetical protein	NA	NA	NA	NA	NA
AYE16582.1|2712664_2713597_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
AYE16583.1|2713861_2714740_-	acyltransferase	NA	NA	NA	NA	NA
AYE16584.1|2714861_2715074_-	hypothetical protein	NA	NA	NA	NA	NA
AYE16585.1|2715081_2717184_-|tail	phage tail protein	tail	A0A2H4YDP3	Escherichia_virus	45.4	2.5e-104
AYE16586.1|2717240_2720318_-	kinase	NA	A0A286S259	Klebsiella_phage	53.0	1.6e-309
AYE16587.1|2720314_2720695_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	77.8	3.7e-54
AYE16588.1|2720704_2721187_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	67.9	1.6e-57
AYE16589.1|2721183_2721651_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	57.0	4.8e-48
AYE16590.1|2721655_2724931_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	54.7	5.0e-240
AYE16591.1|2724976_2725324_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	73.9	1.0e-39
AYE16592.1|2725379_2725679_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	61.6	1.0e-27
AYE18933.1|2725690_2726059_-|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	62.6	4.0e-37
AYE16593.1|2726091_2726802_-|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	66.9	1.0e-81
AYE16594.1|2726859_2727207_-	DUF3168 domain-containing protein	NA	K7PM93	Enterobacterial_phage	60.2	1.5e-30
AYE16595.1|2727203_2727653_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	74.5	1.1e-57
AYE16596.1|2727649_2727988_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	75.9	4.4e-43
AYE16597.1|2727996_2728317_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	41.8	1.5e-16
AYE16598.1|2728313_2728520_-	hypothetical protein	NA	S5FNU1	Shigella_phage	47.7	1.1e-07
AYE16599.1|2728558_2729773_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	83.0	1.6e-191
AYE16600.1|2729786_2730440_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	84.6	1.3e-102
AYE16601.1|2730426_2731656_-|portal	phage portal protein	portal	U5P411	Shigella_phage	82.9	1.5e-205
AYE16602.1|2731655_2731841_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	64.4	5.6e-16
AYE16603.1|2731850_2733602_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	71.5	9.1e-257
AYE16604.1|2733605_2734103_-|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	72.7	6.9e-61
AYE16605.1|2734250_2734601_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	79.3	2.4e-52
AYE16606.1|2734662_2734860_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	89.2	6.4e-26
AYE16607.1|2734889_2735081_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	77.6	1.5e-16
AYE16608.1|2735031_2735310_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	70.5	2.5e-20
AYE16609.1|2735306_2735849_-	hypothetical protein	NA	A0A0U2I1S0	Escherichia_phage	71.2	5.4e-75
AYE16610.1|2735848_2736130_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	84.9	1.1e-39
AYE16611.1|2736116_2736512_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	90.1	1.7e-57
AYE16612.1|2736666_2737719_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	74.6	1.3e-157
AYE16613.1|2737869_2738061_-	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	85.7	2.9e-23
AYE16614.1|2738239_2738644_-	antitermination protein	NA	S5M7R9	Escherichia_phage	53.6	1.9e-32
AYE16615.1|2738633_2739278_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	67.3	6.0e-81
AYE16616.1|2739274_2739892_-	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	60.7	3.9e-45
AYE16617.1|2739888_2740860_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	60.9	5.1e-108
AYE16618.1|2740856_2742386_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	68.0	6.4e-206
AYE16619.1|2742378_2742654_-	hypothetical protein	NA	NA	NA	NA	NA
AYE16620.1|2742816_2743095_-	hypothetical protein	NA	A0A0P0ZFQ0	Escherichia_phage	43.9	6.3e-11
AYE16621.1|2743135_2743639_-	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	47.8	5.1e-35
AYE16622.1|2743631_2743877_-	cell division protein	NA	NA	NA	NA	NA
AYE16623.1|2743972_2744617_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	35.8	1.1e-34
AYE16624.1|2745782_2746142_+	hypothetical protein	NA	NA	NA	NA	NA
AYE16625.1|2746182_2746995_+	DUF2303 family protein	NA	NA	NA	NA	NA
AYE16626.1|2747073_2747934_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	56.2	6.6e-75
AYE16627.1|2747930_2748278_+	hypothetical protein	NA	NA	NA	NA	NA
AYE16628.1|2748696_2748942_+	hypothetical protein	NA	A0A0M3ULJ3	Salmonella_phage	79.7	9.3e-35
AYE16629.1|2748943_2749159_+	hypothetical protein	NA	K7P6F8	Enterobacteria_phage	75.4	2.3e-21
AYE16630.1|2749268_2749484_+	hypothetical protein	NA	NA	NA	NA	NA
AYE16631.1|2749538_2750108_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	65.4	7.4e-67
AYE16632.1|2750118_2750304_+	DNA-binding protein	NA	A0A2R2Z2X2	Escherichia_phage	57.9	1.2e-13
AYE16633.1|2750348_2751665_-	hypothetical protein	NA	NA	NA	NA	NA
AYE16634.1|2751724_2752891_-	DUF4102 domain-containing protein	NA	A0A2R2Z2Y0	Escherichia_phage	76.5	2.3e-184
>prophage 9
CP032515	Escherichia coli strain 118UI chromosome, complete genome	5205677	2882585	2940290	5205677	protease,integrase,terminase,transposase,holin,tail	Escherichia_phage(50.0%)	67	2898127:2898143	2937176:2937192
AYE16746.1|2882585_2884049_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
AYE16747.1|2884069_2884429_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
AYE16748.1|2884534_2885281_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
AYE16749.1|2885330_2886620_-	uracil/xanthine transporter	NA	Q9KX94	Enterobacteria_phage	37.1	6.6e-63
AYE16750.1|2886705_2887332_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AYE16751.1|2887656_2888694_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
AYE16752.1|2888693_2889332_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
AYE16753.1|2889503_2891570_+	polyphosphate kinase	NA	NA	NA	NA	NA
AYE16754.1|2891574_2893116_+	exopolyphosphatase	NA	NA	NA	NA	NA
AYE16755.1|2893154_2895398_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AYE16756.1|2895579_2895732_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
AYE16757.1|2895749_2895941_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AYE16758.1|2896251_2896770_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	6.5e-62
AYE16759.1|2896785_2897325_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	95.0	2.2e-44
AYE16760.1|2897472_2897982_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	3.2e-13
2898127:2898143	attL	AATCATTCCCACTCAAT	NA	NA	NA	NA
AYE16761.1|2898230_2898728_-	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	70.2	9.7e-55
AYE16762.1|2898724_2899354_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	96.7	2.6e-113
AYE16763.1|2899343_2899652_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	93.1	4.6e-47
AYE16764.1|2899638_2900043_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	97.0	2.7e-63
AYE18940.1|2900245_2900530_-	hypothetical protein	NA	NA	NA	NA	NA
AYE16765.1|2900538_2902728_-|tail	phage tail protein	tail	A0A2H4YDP3	Escherichia_virus	46.5	5.7e-131
AYE16766.1|2902924_2903182_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	97.6	3.7e-42
AYE16767.1|2903204_2903933_-	hypothetical protein	NA	NA	NA	NA	NA
AYE16768.1|2904327_2905014_+	anti-repressor protein	NA	G9L6E2	Escherichia_phage	81.8	3.5e-103
AYE16769.1|2905295_2905739_+	hypothetical protein	NA	NA	NA	NA	NA
AYE16770.1|2905832_2905994_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
AYE18941.1|2906025_2906322_-	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	99.0	5.6e-50
AYE16771.1|2906518_2908993_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	99.4	0.0e+00
AYE16772.1|2908998_2910801_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.5	0.0e+00
AYE16773.1|2910797_2913311_-	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	99.2	0.0e+00
AYE16774.1|2913310_2913856_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	98.3	1.4e-91
AYE16775.1|2913855_2914320_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	98.7	1.2e-83
AYE16776.1|2914319_2916791_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.3	0.0e+00
AYE16777.1|2916790_2917396_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.5	8.1e-112
AYE16778.1|2917395_2917719_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
AYE16779.1|2917769_2918105_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
AYE16780.1|2918115_2918553_-	hypothetical protein	NA	G9L6C6	Escherichia_phage	99.3	6.3e-74
AYE16781.1|2918604_2919591_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	99.7	5.6e-187
AYE16782.1|2919605_2920301_-	peptidase	NA	G9L6C4	Escherichia_phage	97.8	2.1e-92
AYE16783.1|2920303_2920600_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
AYE16784.1|2920596_2922276_-|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	99.1	3.1e-302
AYE16785.1|2922290_2922497_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
AYE16786.1|2923204_2923576_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	99.2	1.1e-63
AYE16787.1|2923666_2925142_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	98.8	3.8e-296
AYE16788.1|2925138_2925813_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	100.0	9.0e-120
AYE16789.1|2925853_2926192_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	99.1	6.4e-58
AYE16790.1|2926184_2926466_-	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	98.9	1.5e-49
AYE16791.1|2926465_2926726_-	eaa protein	NA	A0A1B0V7L4	Salmonella_phage	96.5	7.1e-41
AYE16792.1|2926722_2927295_-	DUF551 domain-containing protein	NA	Q9G077	Enterobacteria_phage	60.6	7.0e-49
AYE16793.1|2927296_2927722_-	ead/Ea22-like family protein	NA	A0A2D1GLY5	Escherichia_phage	58.8	3.0e-44
AYE16794.1|2927718_2928345_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.6	6.7e-53
AYE16795.1|2928406_2928751_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	97.4	3.1e-60
AYE18942.1|2928868_2929654_-	replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	3.6e-152
AYE16796.1|2929650_2930490_-	primosomal protein	NA	Q286X4	Escherichia_phage	96.1	1.4e-117
AYE16797.1|2930505_2930706_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
AYE16798.1|2930856_2931087_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	98.7	1.0e-38
AYE16799.1|2931241_2931826_+	XRE family transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
AYE16800.1|2932134_2932434_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	100.0	3.4e-47
AYE16801.1|2932430_2933252_+	exodeoxyribonuclease VIII	NA	G9L6A3	Escherichia_phage	98.2	3.0e-162
AYE16802.1|2933248_2934190_+	recombinase RecT	NA	A0A0F6TJP0	Escherichia_coli_O157_typing_phage	99.7	1.7e-177
AYE16803.1|2934239_2934488_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	98.8	1.0e-41
AYE18943.1|2934645_2934897_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
AYE16804.1|2934889_2935540_+	adenine methylase	NA	G9L699	Escherichia_phage	98.1	1.2e-126
AYE16805.1|2935536_2935731_+	DUF1382 family protein	NA	G9L698	Escherichia_phage	98.4	5.7e-27
AYE16806.1|2935737_2936985_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.3	1.0e-238
AYE16807.1|2937177_2938755_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
2937176:2937192	attR	AATCATTCCCACTCAAT	NA	NA	NA	NA
AYE16808.1|2938823_2940290_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
>prophage 10
CP032515	Escherichia coli strain 118UI chromosome, complete genome	5205677	4969994	5023817	5205677	tRNA,holin,transposase,protease	Vibrio_phage(23.08%)	51	NA	NA
AYE18626.1|4969994_4971347_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AYE18627.1|4971529_4971916_+	soluble cytochrome b562	NA	NA	NA	NA	NA
AYE18628.1|4971960_4972425_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	1.1e-52
AYE18629.1|4972582_4974721_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
AYE18630.1|4975114_4976770_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
AYE18631.1|4976819_4978241_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
AYE18632.1|4978359_4979307_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
AYE19010.1|4979491_4979545_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
AYE18633.1|4979685_4982382_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
AYE18634.1|4982587_4982974_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AYE18635.1|4983046_4983508_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AYE18636.1|4983520_4984456_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
AYE18637.1|4984459_4984594_-	pyrBI operon leader peptide	NA	NA	NA	NA	NA
AYE18638.1|4984874_4985270_-	RidA family protein	NA	NA	NA	NA	NA
AYE18639.1|4985400_4986114_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYE18640.1|4986184_4986778_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYE18641.1|4986922_4987375_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
AYE18642.1|4987496_4988471_+	DNA-binding protein	NA	NA	NA	NA	NA
AYE18643.1|4988486_4988840_+	hypothetical protein	NA	NA	NA	NA	NA
AYE18644.1|4988826_4989057_+	hypothetical protein	NA	NA	NA	NA	NA
AYE18645.1|4989157_4990162_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AYE18646.1|4990323_4990740_+	regulator of ribonuclease activity B	NA	NA	NA	NA	NA
AYE18647.1|4990785_4991289_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYE18648.1|4991481_4992678_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
AYE18649.1|4992733_4995589_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
AYE18650.1|4995588_4996032_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AYE18651.1|4996287_4997799_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AYE18652.1|4998065_4999166_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AYE18653.1|4999165_5000248_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AYE18654.1|5000408_5001911_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.2	4.6e-84
AYE18655.1|5001988_5002987_-	transcriptional regulator	NA	NA	NA	NA	NA
AYE18656.1|5003053_5004373_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
AYE18657.1|5004434_5005199_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
AYE18658.1|5005222_5006254_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
AYE18659.1|5006470_5007034_+	thermosensitive gluconokinase	NA	NA	NA	NA	NA
AYE18660.1|5007037_5008057_-	aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.1e-44
AYE19011.1|5008597_5009788_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.3	3.2e-72
AYE18661.1|5011299_5011530_-	hypothetical protein	NA	NA	NA	NA	NA
AYE18662.1|5011545_5011740_+	hypothetical protein	NA	NA	NA	NA	NA
AYE18663.1|5012443_5012587_+	hypothetical protein	NA	NA	NA	NA	NA
AYE18664.1|5012614_5013943_-|transposase	IS4 family transposase IS4	transposase	NA	NA	NA	NA
AYE18665.1|5014569_5015787_+	MFS transporter	NA	NA	NA	NA	NA
AYE19012.1|5015798_5016917_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AYE18666.1|5016959_5017085_+	hypothetical protein	NA	NA	NA	NA	NA
AYE18667.1|5017137_5017395_-	hypothetical protein	NA	NA	NA	NA	NA
AYE18668.1|5017708_5018875_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
AYE18669.1|5018810_5019224_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AYE18670.1|5019183_5019342_-|holin	choline transporter	holin	NA	NA	NA	NA
AYE18671.1|5019286_5021290_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AYE18672.1|5022340_5023492_-|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AYE18673.1|5023448_5023817_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
CP032516	Escherichia coli strain 118UI plasmid pEco118UIb, complete sequence	90328	1262	63918	90328	transposase,integrase	Enterobacteria_phage(37.5%)	56	NA	NA
AYE19023.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
AYE19024.1|2123_2312_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AYE19025.1|2673_3843_+	hypothetical protein	NA	NA	NA	NA	NA
AYE19026.1|4740_5969_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.7	1.9e-168
AYE19027.1|6250_8221_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
AYE19028.1|8227_9019_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
AYE19029.1|9808_10609_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	98.9	2.8e-144
AYE19030.1|12934_13354_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
AYE19031.1|13555_13885_+	hypothetical protein	NA	NA	NA	NA	NA
AYE19032.1|14039_14681_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	41.1	9.6e-39
AYE19033.1|14679_15892_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
AYE19034.1|16964_17063_-	hemolysin activation protein	NA	NA	NA	NA	NA
AYE19035.1|17081_17447_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE19036.1|17569_18783_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
AYE19037.1|19635_20910_-	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
AYE19038.1|20879_23141_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AYE19039.1|23309_24086_-	energy transducer TonB	NA	NA	NA	NA	NA
AYE19040.1|24093_25011_-	iron-regulated protein	NA	NA	NA	NA	NA
AYE19041.1|26118_26475_-	hypothetical protein	NA	NA	NA	NA	NA
AYE19042.1|27232_28891_-	CoA-disulfide reductase	NA	NA	NA	NA	NA
AYE19043.1|29051_29399_+	transcriptional regulator	NA	NA	NA	NA	NA
AYE19044.1|29940_30150_+	hypothetical protein	NA	NA	NA	NA	NA
AYE19045.1|31731_32532_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	98.9	2.8e-144
AYE19046.1|32816_33041_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	43.2	1.1e-05
AYE19047.1|33037_33424_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	50.4	2.5e-26
AYE19048.1|34201_35926_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	34.6	1.6e-19
AYE19049.1|38124_38313_-	hypothetical protein	NA	NA	NA	NA	NA
AYE19050.1|38968_39316_-	colicin transporter	NA	NA	NA	NA	NA
AYE19051.1|39426_39774_+	hypothetical protein	NA	NA	NA	NA	NA
AYE19052.1|39791_40388_-	hypothetical protein	NA	NA	NA	NA	NA
AYE19053.1|40375_40645_-	hypothetical protein	NA	NA	NA	NA	NA
AYE19054.1|40672_40888_-	hypothetical protein	NA	NA	NA	NA	NA
AYE19055.1|40788_40995_+	hypothetical protein	NA	NA	NA	NA	NA
AYE19103.1|40959_41238_-	hypothetical protein	NA	NA	NA	NA	NA
AYE19056.1|41239_41458_+	antitoxin CcdA	NA	NA	NA	NA	NA
AYE19057.1|41459_41765_+	toxin CcdB	NA	NA	NA	NA	NA
AYE19104.1|43250_43952_-	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	32.2	1.7e-25
AYE19058.1|44602_45808_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	9.5e-205
AYE19059.1|45804_46776_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.9	1.5e-112
AYE19060.1|48120_49119_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AYE19061.1|49171_49876_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYE19062.1|51047_51236_+	hypothetical protein	NA	NA	NA	NA	NA
AYE19063.1|51724_51967_+	relaxase	NA	NA	NA	NA	NA
AYE19064.1|51998_52676_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYE19065.1|52754_53954_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AYE19066.1|53985_54846_-	EamA family transporter	NA	NA	NA	NA	NA
AYE19067.1|54830_55574_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYE19068.1|55612_56320_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AYE19069.1|56316_56553_-	mercury resistance protein	NA	NA	NA	NA	NA
AYE19070.1|56549_56912_-	transcriptional regulator	NA	NA	NA	NA	NA
AYE19071.1|56929_58624_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYE19105.1|58675_59098_-	mercury transporter MerC	NA	NA	NA	NA	NA
AYE19072.1|59133_59409_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
AYE19073.1|59422_59773_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
AYE19074.1|59844_60279_+	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AYE19075.1|63213_63918_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
