The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032659	Lactobacillus pentosus strain ZFM94 chromosome, complete genome	3564833	681	73352	3564833	tRNA,transposase,integrase,protease	Staphylococcus_phage(30.0%)	41	106:117	65306:65317
106:117	attL	TTAACTATATTA	NA	NA	NA	NA
AYG39616.1|681_1233_+|integrase	integrase	integrase	A0A1B0T6D2	Bacillus_phage	42.8	4.6e-29
AYG39617.1|1412_2348_+	phosphatase	NA	B0FIJ9	Escherichia_phage	47.1	3.1e-30
AYG39618.1|2322_3396_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
AYG39619.1|3512_5735_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	40.1	3.6e-125
AYG39620.1|6214_6412_+	hypothetical protein	NA	NA	NA	NA	NA
AYG39621.1|6561_6828_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AYG39622.1|6827_8558_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AYG39623.1|10217_11396_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
AYG39624.1|11448_12471_+	glycosyltransferase	NA	NA	NA	NA	NA
AYG39625.1|12474_13524_+	TIGR00374 family protein	NA	NA	NA	NA	NA
AYG39626.1|13594_14836_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	29.6	6.2e-18
AYG39627.1|14956_16144_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AYG39628.1|16336_16573_+	DUF1797 family protein	NA	NA	NA	NA	NA
AYG39629.1|16729_18835_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	48.1	1.8e-158
AYG39630.1|18993_20256_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AYG39631.1|27424_28687_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AYG39632.1|28838_29048_+	hypothetical protein	NA	NA	NA	NA	NA
AYG39633.1|29118_29604_+	hypothetical protein	NA	NA	NA	NA	NA
AYG39634.1|31400_31958_-	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
AYG39635.1|33004_33523_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYG39636.1|33637_34474_-	metallophosphoesterase	NA	NA	NA	NA	NA
AYG39637.1|34866_35739_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYG39638.1|36028_36919_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	33.3	2.4e-11
AYG39639.1|36931_38146_+	MFS transporter	NA	NA	NA	NA	NA
AYG39640.1|38138_39041_+	ROK family protein	NA	NA	NA	NA	NA
AYG39641.1|39383_40709_-	divalent metal cation transporter MntH	NA	NA	NA	NA	NA
AYG39642.1|40695_41655_-	ferrochelatase	NA	NA	NA	NA	NA
AYG39643.1|42215_43607_-	amino acid permease	NA	NA	NA	NA	NA
AYG39644.1|43720_44635_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AYG39645.1|45229_46738_+	glycosyltransferase	NA	NA	NA	NA	NA
AYG39646.1|46804_47524_-	hypothetical protein	NA	NA	NA	NA	NA
AYG39647.1|47734_48922_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	66.7	6.6e-142
AYG39648.1|49057_50566_+	MFS transporter	NA	NA	NA	NA	NA
AYG39649.1|60166_61018_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.7	2.8e-41
AYG39650.1|61020_61560_-|transposase	transposase	transposase	NA	NA	NA	NA
AYG39651.1|64008_65643_+	glycosyl transferase family 1	NA	NA	NA	NA	NA
65306:65317	attR	TTAACTATATTA	NA	NA	NA	NA
AYG39652.1|67189_68716_+	glycosyltransferase	NA	NA	NA	NA	NA
AYG39653.1|68744_68942_+	hypothetical protein	NA	NA	NA	NA	NA
AYG39654.1|69197_69782_-	SAM-dependent methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	46.0	5.9e-35
AYG39655.1|69794_70445_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AYG39656.1|70925_73352_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.4	0.0e+00
>prophage 2
CP032659	Lactobacillus pentosus strain ZFM94 chromosome, complete genome	3564833	164774	174025	3564833		Lactobacillus_phage(85.71%)	8	NA	NA
AYG39720.1|164774_165935_+	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	61.3	1.8e-131
AYG39721.1|166149_167136_-	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	60.1	6.3e-98
AYG39722.1|167504_168452_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	86.3	8.3e-156
AYG39723.1|168742_169357_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	93.6	6.7e-106
AYG39724.1|169361_171800_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	89.0	0.0e+00
AYG39725.1|171897_172458_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	86.0	7.0e-86
AYG39726.1|172522_172765_+	hypothetical protein	NA	NA	NA	NA	NA
AYG39727.1|173029_174025_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	40.5	7.1e-57
>prophage 3
CP032659	Lactobacillus pentosus strain ZFM94 chromosome, complete genome	3564833	275353	342617	3564833	transposase,protease,tRNA	Bacillus_phage(37.5%)	60	NA	NA
AYG39815.1|275353_276616_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AYG39816.1|276843_277593_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
AYG39817.1|277894_278308_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AYG39818.1|280074_282822_+	CRISPR-associated helicase Cas3'	NA	NA	NA	NA	NA
AYG39819.1|282826_284578_+	type I-E CRISPR-associated protein Cse1/CasA	NA	NA	NA	NA	NA
AYG39820.1|284567_285179_+	type I-E CRISPR-associated protein Cse2/CasB	NA	NA	NA	NA	NA
AYG39821.1|285178_286258_+	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
AYG39822.1|286238_286964_+	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
AYG39823.1|286963_287632_+	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
AYG39824.1|287785_289099_-	glycosyltransferase	NA	NA	NA	NA	NA
AYG39825.1|289102_289585_-	hypothetical protein	NA	NA	NA	NA	NA
AYG39826.1|290414_290945_+	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
AYG39827.1|290941_292078_+	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
AYG39828.1|292163_292478_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
AYG39829.1|292490_293126_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
AYG39830.1|293109_293727_+	HD domain-containing protein	NA	NA	NA	NA	NA
AYG39831.1|293744_294101_+	ribosome silencing factor	NA	NA	NA	NA	NA
AYG39832.1|294097_294832_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYG39833.1|294860_296030_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AYG39834.1|296135_296690_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
AYG39835.1|296749_296929_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
AYG39836.1|296980_297214_-	hypothetical protein	NA	NA	NA	NA	NA
AYG39837.1|297393_297978_+	hypothetical protein	NA	NA	NA	NA	NA
AYG39838.1|298375_299812_+	NADP-dependent phosphogluconate dehydrogenase	NA	E3SPS4	Prochlorococcus_phage	30.3	1.2e-28
AYG39839.1|299995_301345_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	42.8	2.4e-84
AYG39840.1|301536_302223_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	32.4	3.9e-30
AYG39841.1|302222_303866_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.3	1.9e-22
AYG39842.1|304097_305846_+	hypothetical protein	NA	NA	NA	NA	NA
AYG39843.1|306448_307417_+	1,4-dihydroxy-2-naphthoate prenyltransferase	NA	NA	NA	NA	NA
AYG39844.1|307614_310797_-	SMC family ATPase	NA	NA	NA	NA	NA
AYG39845.1|310799_311981_-	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
AYG39846.1|312511_314086_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYG39847.1|314104_314425_+	thioredoxin	NA	NA	NA	NA	NA
AYG39848.1|315744_316341_+	SdpI family protein	NA	NA	NA	NA	NA
AYG39849.1|316542_317472_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
AYG39850.1|317535_317808_-	acylphosphatase	NA	NA	NA	NA	NA
AYG39851.1|318176_318944_+	RNA methyltransferase	NA	NA	NA	NA	NA
AYG39852.1|319044_319554_+	hydrolase	NA	NA	NA	NA	NA
AYG39853.1|319576_319936_+	transcriptional regulator	NA	NA	NA	NA	NA
AYG39854.1|320263_321310_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	37.9	4.0e-26
AYG39855.1|321318_323736_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AYG39856.1|324009_324861_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.7	2.8e-41
AYG39857.1|324863_325403_-|transposase	transposase	transposase	NA	NA	NA	NA
AYG39858.1|325685_326891_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
AYG39859.1|326909_327539_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.6	4.9e-35
AYG39860.1|327648_328131_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AYG39861.1|328648_329356_-	hypothetical protein	NA	NA	NA	NA	NA
AYG39862.1|329356_329812_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
AYG39863.1|329996_330299_+	iron-sulfur cluster biosynthesis protein	NA	NA	NA	NA	NA
AYG39864.1|331438_334090_-	hypothetical protein	NA	NA	NA	NA	NA
AYG39865.1|334289_336326_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
AYG39866.1|336448_336598_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AYG39867.1|336744_337311_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
AYG39868.1|337297_337981_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AYG39869.1|337999_338221_+	DUF910 family protein	NA	NA	NA	NA	NA
AYG39870.1|338238_339201_+	ROK family protein	NA	NA	NA	NA	NA
AYG39871.1|339372_339999_+	dipeptidase	NA	NA	NA	NA	NA
AYG39872.1|341224_341371_-	hypothetical protein	NA	NA	NA	NA	NA
AYG39873.1|341364_342075_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.8	2.1e-34
AYG39874.1|342077_342617_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
CP032659	Lactobacillus pentosus strain ZFM94 chromosome, complete genome	3564833	1381626	1390140	3564833		Synechococcus_phage(33.33%)	9	NA	NA
AYG40750.1|1381626_1382205_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.3	3.1e-20
AYG40751.1|1382197_1383223_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	4.2e-60
AYG40752.1|1383219_1384674_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.2	1.5e-50
AYG40753.1|1384658_1386878_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.1	3.1e-145
AYG40754.1|1386870_1387551_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AYG40755.1|1387550_1387805_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AYG40756.1|1387806_1388538_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	38.6	1.9e-38
AYG40757.1|1388540_1389671_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AYG40758.1|1389654_1390140_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.4	1.7e-16
>prophage 5
CP032659	Lactobacillus pentosus strain ZFM94 chromosome, complete genome	3564833	1884467	1894326	3564833		Streptococcus_phage(14.29%)	7	NA	NA
AYG41178.1|1884467_1885586_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.1	1.7e-38
AYG41179.1|1885722_1887057_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.3	3.9e-26
AYG41180.1|1888154_1889453_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.6	3.8e-18
AYG41181.1|1889769_1891059_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	37.0	4.6e-72
AYG41182.1|1891102_1892080_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	70.9	9.9e-136
AYG41183.1|1892297_1893245_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.5	1.7e-20
AYG41184.1|1893234_1894326_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.9	6.9e-13
>prophage 6
CP032659	Lactobacillus pentosus strain ZFM94 chromosome, complete genome	3564833	2283366	2347421	3564833	capsid,head,portal,integrase,tail,tRNA,terminase	Streptococcus_phage(17.65%)	54	2293084:2293100	2342144:2342160
AYG41504.1|2283366_2285280_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
AYG41505.1|2285298_2286690_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
AYG41506.1|2286921_2288043_-	KH domain-containing protein	NA	NA	NA	NA	NA
AYG41507.1|2288587_2289841_-	amidohydrolase family protein	NA	NA	NA	NA	NA
AYG41508.1|2289973_2291611_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYG41509.1|2292457_2293291_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
2293084:2293100	attL	TGATCAACGTAAAGACG	NA	NA	NA	NA
AYG41510.1|2293306_2293651_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AYG41511.1|2293763_2293898_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AYG41512.1|2294405_2295773_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AYG41513.1|2295948_2297088_+	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	29.9	4.3e-13
AYG41514.1|2297611_2297845_+	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
AYG41515.1|2297845_2298970_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AYG41516.1|2298966_2300913_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.9	1.9e-146
AYG41517.1|2301085_2303695_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	37.3	1.4e-112
AYG41518.1|2304086_2304281_-	hypothetical protein	NA	NA	NA	NA	NA
AYG41519.1|2304863_2305163_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
AYG41520.1|2305199_2305793_+	single-stranded DNA-binding protein	NA	A0A218MNB4	uncultured_virus	72.1	3.6e-40
AYG41521.1|2305831_2306068_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
AYG41522.1|2306244_2308257_+	PAS domain-containing protein	NA	NA	NA	NA	NA
AYG41523.1|2308270_2308723_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
AYG41524.1|2308738_2310169_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.8	6.3e-123
AYG41525.1|2310403_2311627_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	33.3	2.4e-54
AYG41526.1|2311647_2312445_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	38.8	2.3e-45
AYG41527.1|2312468_2313707_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	53.1	9.7e-112
AYG41528.1|2315217_2316834_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYG42651.1|2317293_2319201_+	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
AYG41529.1|2319190_2320330_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
AYG41530.1|2320326_2321499_+	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
AYG41531.1|2321491_2322931_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
AYG41532.1|2322950_2325353_+	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.0	7.9e-09
AYG41533.1|2325369_2327187_+	glycoside hydrolase family 13 protein	NA	NA	NA	NA	NA
AYG41534.1|2327524_2328292_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AYG41535.1|2329322_2330000_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
AYG41536.1|2330017_2332738_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
AYG41537.1|2333121_2333565_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
AYG41538.1|2333764_2333965_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.6	2.8e-21
AYG41539.1|2334053_2334275_+	hypothetical protein	NA	NA	NA	NA	NA
AYG41540.1|2334491_2334713_-	hypothetical protein	NA	NA	NA	NA	NA
AYG41541.1|2334715_2335870_-|integrase	site-specific integrase	integrase	A0A172LN96	Lactococcus_phage	36.7	8.0e-60
AYG41542.1|2335927_2336614_-	XRE family transcriptional regulator	NA	Q20DG0	Lactobacillus_phage	56.5	4.5e-10
AYG41543.1|2336745_2336928_+	DNA-binding protein	NA	NA	NA	NA	NA
AYG41544.1|2336970_2337078_+	hypothetical protein	NA	NA	NA	NA	NA
AYG41545.1|2337196_2337427_+	hypothetical protein	NA	NA	NA	NA	NA
AYG41546.1|2337440_2338241_+	DNA replication protein	NA	NA	NA	NA	NA
AYG41547.1|2338240_2339635_+	virulence protein	NA	Q4ZD27	Staphylococcus_phage	36.0	1.5e-68
AYG41548.1|2339781_2340201_+	hypothetical protein	NA	NA	NA	NA	NA
AYG41549.1|2340224_2340527_+	hypothetical protein	NA	NA	NA	NA	NA
AYG41550.1|2340526_2340865_+|head,tail	head-tail adaptor protein	head,tail	A0A2P0ZLF0	Lactobacillus_phage	36.0	1.9e-09
AYG41551.1|2340857_2341256_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	44.7	6.9e-19
AYG41552.1|2342084_2342558_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
2342144:2342160	attR	TGATCAACGTAAAGACG	NA	NA	NA	NA
AYG41553.1|2344210_2344411_+	hypothetical protein	NA	NA	NA	NA	NA
AYG41554.1|2344411_2345512_+|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	34.0	1.0e-48
AYG41555.1|2345508_2347038_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.5	4.8e-44
AYG41556.1|2347151_2347421_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
>prophage 7
CP032659	Lactobacillus pentosus strain ZFM94 chromosome, complete genome	3564833	2703128	2750332	3564833	bacteriocin,transposase,protease	Bacillus_virus(33.33%)	44	NA	NA
AYG41849.1|2703128_2704391_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AYG41850.1|2704546_2705056_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AYG41851.1|2705086_2706283_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
AYG41852.1|2706393_2706864_+	transcriptional regulator	NA	NA	NA	NA	NA
AYG41853.1|2707471_2708080_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
AYG41854.1|2708341_2709262_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
AYG41855.1|2709398_2710310_+	oxidoreductase	NA	NA	NA	NA	NA
AYG41856.1|2710367_2710814_-	ribonuclease H	NA	NA	NA	NA	NA
AYG41857.1|2711685_2711874_+	hypothetical protein	NA	NA	NA	NA	NA
AYG41858.1|2711921_2713448_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
AYG41859.1|2713447_2714419_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	3.3e-22
AYG41860.1|2714515_2715847_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AYG41861.1|2716836_2718354_+	glycerol kinase	NA	NA	NA	NA	NA
AYG41862.1|2718368_2720198_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
AYG41863.1|2720212_2720935_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	32.3	4.1e-30
AYG41864.1|2721362_2721752_+	DUF2247 family protein	NA	NA	NA	NA	NA
AYG41865.1|2721744_2722520_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	1.6e-27
AYG41866.1|2722559_2722763_+	DUF2247 family protein	NA	NA	NA	NA	NA
AYG41867.1|2722805_2723285_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYG41868.1|2723660_2724176_+	hypothetical protein	NA	NA	NA	NA	NA
AYG41869.1|2724273_2724357_+	hypothetical protein	NA	NA	NA	NA	NA
AYG41870.1|2724364_2724982_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
AYG41871.1|2724985_2726131_-	MFS transporter	NA	NA	NA	NA	NA
AYG41872.1|2726134_2726926_-	HAD family hydrolase	NA	NA	NA	NA	NA
AYG41873.1|2726995_2727868_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYG41874.1|2728027_2728843_+	HAD family phosphatase	NA	NA	NA	NA	NA
AYG41875.1|2729330_2730704_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
AYG41876.1|2730746_2731931_+	cation:proton antiporter	NA	NA	NA	NA	NA
AYG41877.1|2732200_2732869_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYG41878.1|2733400_2733712_+	hypothetical protein	NA	NA	NA	NA	NA
AYG41879.1|2734262_2735009_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYG41880.1|2735087_2735372_+	hypothetical protein	NA	NA	NA	NA	NA
AYG41881.1|2735404_2735590_+	hypothetical protein	NA	NA	NA	NA	NA
AYG41882.1|2735893_2736268_+	hypothetical protein	NA	NA	NA	NA	NA
AYG41883.1|2736463_2737789_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
AYG41884.1|2737881_2739219_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
AYG41885.1|2739223_2739985_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYG41886.1|2740870_2742199_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
AYG41887.1|2742199_2742946_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYG41888.1|2743929_2745096_+	hypothetical protein	NA	NA	NA	NA	NA
AYG41889.1|2745487_2746639_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
AYG41890.1|2746643_2747864_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
AYG41891.1|2748170_2748944_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYG41892.1|2749663_2750332_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 9
CP032659	Lactobacillus pentosus strain ZFM94 chromosome, complete genome	3564833	2923233	2961649	3564833	capsid,protease,portal,head,holin,integrase,tail,transposase,terminase	Lactobacillus_phage(91.89%)	44	2923068:2923083	2962183:2962198
2923068:2923083	attL	AATCTTCTTGGCCGCA	NA	NA	NA	NA
AYG42027.1|2923233_2924391_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	95.8	5.3e-213
AYG42028.1|2924561_2924924_-	hypothetical protein	NA	E9LUS2	Lactobacillus_phage	95.8	1.1e-58
AYG42029.1|2925081_2925270_-	hypothetical protein	NA	E9LUS5	Lactobacillus_phage	98.4	1.8e-25
AYG42030.1|2925847_2926030_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	65.5	6.7e-14
AYG42031.1|2926522_2926723_-	hypothetical protein	NA	E9LUS6	Lactobacillus_phage	98.5	6.5e-26
AYG42032.1|2926783_2927191_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1B0Y2S4	Lactobacillus_phage	47.8	5.2e-30
AYG42033.1|2927183_2927516_-	XRE family transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	58.1	6.7e-28
AYG42034.1|2927778_2927967_+	hypothetical protein	NA	NA	NA	NA	NA
AYG42035.1|2928001_2928286_+	hypothetical protein	NA	NA	NA	NA	NA
AYG42036.1|2928538_2929246_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	61.4	3.1e-70
AYG42037.1|2929257_2929467_+	hypothetical protein	NA	NA	NA	NA	NA
AYG42038.1|2929480_2929708_+	hypothetical protein	NA	NA	NA	NA	NA
AYG42039.1|2929723_2929945_-	hypothetical protein	NA	NA	NA	NA	NA
AYG42671.1|2930039_2930318_+	hypothetical protein	NA	A0A2P0ZLA9	Lactobacillus_phage	77.0	6.4e-32
AYG42040.1|2930453_2930693_+	tagatose-bisphosphate aldolase	NA	E9LUT6	Lactobacillus_phage	83.5	4.5e-34
AYG42041.1|2931549_2932344_+	replisome organizer	NA	Q9AZA0	Lactobacillus_prophage	69.7	1.9e-52
AYG42042.1|2932337_2933213_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	40.9	2.4e-48
AYG42043.1|2933369_2933669_+	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	86.9	1.8e-43
AYG42044.1|2933671_2933839_+	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	83.6	1.1e-15
AYG42045.1|2934362_2934596_+	hypothetical protein	NA	NA	NA	NA	NA
AYG42046.1|2934841_2935270_+	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	73.8	8.3e-55
AYG42047.1|2936241_2936769_+	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	85.8	3.8e-73
AYG42048.1|2936746_2937277_+	endonuclease	NA	U5U4N5	Lactobacillus_phage	43.7	3.2e-32
AYG42049.1|2937407_2937866_+|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	97.4	1.6e-80
AYG42050.1|2939447_2940223_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	1.6e-27
AYG42051.1|2940611_2940806_+	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	96.9	9.7e-27
AYG42052.1|2940808_2942002_+|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	99.2	6.2e-225
AYG42053.1|2941979_2942735_+|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	92.0	1.7e-122
AYG42054.1|2942734_2943967_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	92.6	2.9e-209
AYG42055.1|2944039_2944372_+|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	85.2	1.4e-44
AYG42056.1|2944361_2944709_+|head,tail	head-tail adaptor protein	head,tail	A0A2P0ZLF0	Lactobacillus_phage	72.2	2.0e-43
AYG42057.1|2944711_2945119_+	HK97 gp10 family phage protein	NA	A0A2P0ZLE6	Lactobacillus_phage	89.2	1.7e-60
AYG42058.1|2945118_2945499_+	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	90.5	2.2e-59
AYG42059.1|2945514_2946168_+|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	93.5	6.7e-112
AYG42060.1|2946240_2946615_+	hypothetical protein	NA	A0A2P0ZLH4	Lactobacillus_phage	93.5	2.7e-57
AYG42061.1|2946653_2946845_+	hypothetical protein	NA	NA	NA	NA	NA
AYG42062.1|2946876_2951799_+	peptidase M23	NA	A0A2P0ZLG0	Lactobacillus_phage	62.6	0.0e+00
AYG42063.1|2951875_2953648_+|tail	phage tail protein	tail	A0A2P0ZLH2	Lactobacillus_phage	94.2	0.0e+00
AYG42064.1|2953717_2956129_+	hypothetical protein	NA	A0A2P0ZLF8	Lactobacillus_phage	94.3	0.0e+00
AYG42065.1|2958898_2959150_+	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	97.2	1.2e-29
AYG42066.1|2959298_2959658_+	hypothetical protein	NA	E9LUR7	Lactobacillus_phage	78.2	1.1e-44
AYG42067.1|2959670_2960843_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	100.0	3.1e-216
AYG42068.1|2960842_2961106_+|holin	holin	holin	E9LUR9	Lactobacillus_phage	100.0	2.0e-38
AYG42069.1|2961118_2961649_+|holin	holin	holin	E9LUS0	Lactobacillus_phage	100.0	2.9e-41
2962183:2962198	attR	AATCTTCTTGGCCGCA	NA	NA	NA	NA
>prophage 10
CP032659	Lactobacillus pentosus strain ZFM94 chromosome, complete genome	3564833	3017650	3026398	3564833		Streptococcus_phage(66.67%)	11	NA	NA
AYG42120.1|3017650_3019354_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	36.7	2.0e-54
AYG42121.1|3019375_3019684_+	nucleoid-associated protein, YbaB/EbfC family	NA	NA	NA	NA	NA
AYG42122.1|3019699_3020299_+	recombination protein RecR	NA	NA	NA	NA	NA
AYG42123.1|3020311_3020563_+	DUF2508 family protein	NA	NA	NA	NA	NA
AYG42124.1|3021061_3021727_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	53.7	1.3e-54
AYG42125.1|3021723_3022053_+	hypothetical protein	NA	NA	NA	NA	NA
AYG42126.1|3022096_3023116_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	32.8	6.9e-31
AYG42127.1|3023140_3023488_+	initiation-control protein YabA	NA	M1PFV3	Streptococcus_phage	34.3	1.1e-12
AYG42128.1|3023584_3024481_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	3.4e-82
AYG42129.1|3024484_3025270_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
AYG42130.1|3025402_3026398_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.5	3.1e-52
>prophage 11
CP032659	Lactobacillus pentosus strain ZFM94 chromosome, complete genome	3564833	3498036	3505782	3564833	integrase	Escherichia_phage(50.0%)	9	3491088:3491103	3510138:3510153
3491088:3491103	attL	AATGTTCAAGATGCGG	NA	NA	NA	NA
AYG42529.1|3498036_3498906_+	glucose-1-phosphate thymidylyltransferase	NA	K7QKA7	Escherichia_phage	60.8	7.8e-100
AYG42530.1|3498909_3499491_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	45.6	3.9e-39
AYG42531.1|3499500_3500529_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.1	6.4e-69
AYG42532.1|3500598_3501441_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.9	3.4e-36
AYG42533.1|3501587_3502190_-|integrase	integrase	integrase	D2XR58	Bacillus_phage	41.3	1.3e-32
AYG42534.1|3502546_3503317_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYG42535.1|3503328_3504057_+	tyrosine-protein kinase family protein	NA	NA	NA	NA	NA
AYG42536.1|3504043_3504817_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
AYG42537.1|3504834_3505782_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1V0SAI6	Catovirus	34.2	5.8e-40
3510138:3510153	attR	AATGTTCAAGATGCGG	NA	NA	NA	NA
>prophage 1
CP032660	Lactobacillus pentosus strain ZFM94 plasmid unnamed1, complete sequence	84802	12419	72422	84802	transposase,integrase	Lactobacillus_phage(16.0%)	48	25706:25739	79686:79719
AYG42689.1|12419_13634_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	52.3	7.8e-114
AYG42690.1|13831_14359_+	hypothetical protein	NA	NA	NA	NA	NA
AYG42691.1|15848_16931_+	theronine dehydrogenase	NA	A0A2K9L339	Tupanvirus	31.2	2.4e-18
AYG42692.1|18263_18980_-	LysM domain-containing protein	NA	K4ID66	Lactobacillus_phage	55.7	3.6e-10
AYG42693.1|19362_20388_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	7.1e-44
AYG42694.1|20768_21962_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	9.9e-29
AYG42695.1|21961_22801_+	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
AYG42696.1|22808_23726_+	glycine/betaine ABC transporter	NA	NA	NA	NA	NA
AYG42697.1|23845_24061_-	hypothetical protein	NA	A0A1S5SBP9	Streptococcus_phage	49.1	1.8e-05
AYG42698.1|24503_24674_-	hypothetical protein	NA	NA	NA	NA	NA
AYG42750.1|24807_25458_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	31.7	7.3e-18
25706:25739	attL	GTAGATTGTAAAATTAATCCGAACGCTGTTCGGA	NA	NA	NA	NA
AYG42699.1|25966_27229_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.1	3.4e-35
AYG42700.1|27413_27851_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYG42701.1|28234_30271_-	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	33.2	3.0e-62
AYG42702.1|30370_30982_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	35.5	2.4e-18
AYG42703.1|31275_32196_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.9	2.1e-50
AYG42704.1|32578_32668_+	hypothetical protein	NA	NA	NA	NA	NA
AYG42705.1|33004_34573_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
AYG42706.1|34695_35850_-	cation:proton antiporter	NA	NA	NA	NA	NA
AYG42707.1|37190_38033_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.9	5.7e-156
AYG42708.1|38086_38338_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	2.1e-37
AYG42709.1|39025_39838_-	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	51.0	4.6e-62
AYG42710.1|42186_42276_+	hypothetical protein	NA	NA	NA	NA	NA
AYG42711.1|42834_43287_+	ribonucleotide reductase assembly protein NrdI	NA	NA	NA	NA	NA
AYG42712.1|43293_45462_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.3	8.1e-255
AYG42713.1|45568_46495_+	ribonucleoside-diphosphate reductase	NA	A0A2H4P8A9	Corynebacterium_phage	32.1	5.9e-37
AYG42714.1|46509_47460_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	54.3	4.7e-98
AYG42715.1|47588_48335_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	29.4	6.6e-15
AYG42716.1|48513_49146_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	33.2	2.8e-14
AYG42717.1|49232_50135_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	40.3	1.1e-51
AYG42718.1|50720_51068_-	hypothetical protein	NA	NA	NA	NA	NA
AYG42719.1|51069_51870_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	50.6	1.6e-67
AYG42720.1|52300_52507_-	hypothetical protein	NA	NA	NA	NA	NA
AYG42721.1|52721_53000_+	hypothetical protein	NA	NA	NA	NA	NA
AYG42722.1|53111_53294_-	hypothetical protein	NA	A0A2P0ZLG6	Lactobacillus_phage	66.0	2.7e-07
AYG42723.1|54982_55279_+	hypothetical protein	NA	NA	NA	NA	NA
AYG42724.1|55727_56255_+	hypothetical protein	NA	NA	NA	NA	NA
AYG42725.1|57784_58072_-	type III secretion system protein PrgO	NA	NA	NA	NA	NA
AYG42751.1|58055_59009_-	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	28.3	3.5e-21
AYG42726.1|59751_61290_+	plasmid replication protein	NA	NA	NA	NA	NA
AYG42727.1|63284_64068_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AYG42728.1|65184_67989_+	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.7	2.0e-72
AYG42729.1|68048_68321_+	hypothetical protein	NA	NA	NA	NA	NA
AYG42730.1|68356_68824_+	replication initiation protein RepA	NA	NA	NA	NA	NA
AYG42731.1|69185_70355_-	relaxase	NA	NA	NA	NA	NA
AYG42732.1|71155_71425_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYG42733.1|71411_71783_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AYG42734.1|71834_72422_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	34.3	2.2e-21
79686:79719	attR	TCCGAACAGCGTTCGGATTAATTTTACAATCTAC	NA	NA	NA	NA
