The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032648	Lactobacillus plantarum strain ZFM4 chromosome, complete genome	3213092	169100	178938	3213092		Lactobacillus_phage(87.5%)	9	NA	NA
AYG26630.1|169100_170096_-	glycosyltransferase	NA	S5FKN0	Shigella_phage	38.8	3.1e-52
AYG26631.1|170722_170860_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AYG26632.1|170955_171396_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	99.3	8.0e-77
AYG26633.1|171466_172027_-	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	100.0	2.7e-101
AYG26634.1|172114_174553_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.5	0.0e+00
AYG26635.1|174555_175170_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
AYG26636.1|175513_176461_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
AYG26637.1|176646_177618_+	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	98.5	2.9e-180
AYG26638.1|177708_178938_-	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	97.7	2.7e-215
>prophage 2
CP032648	Lactobacillus plantarum strain ZFM4 chromosome, complete genome	3213092	579943	644373	3213092	integrase,transposase,protease,bacteriocin,tRNA	Lactobacillus_phage(23.08%)	54	618004:618025	620838:620859
AYG26982.1|579943_580273_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYG26983.1|580408_581737_-	glucarate dehydratase	NA	NA	NA	NA	NA
AYG26984.1|581885_582779_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYG26985.1|582927_583905_+	4-phosphoerythronate dehydrogenase	NA	A0A285PXZ1	Cedratvirus	32.3	2.1e-32
AYG26986.1|583919_585317_+	hypothetical protein	NA	NA	NA	NA	NA
AYG26987.1|585619_586395_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
AYG26988.1|586728_588063_-	gluconate permease	NA	NA	NA	NA	NA
AYG26989.1|588312_589527_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	33.8	2.5e-48
AYG26990.1|589542_590685_+	lactonase family protein	NA	NA	NA	NA	NA
AYG26991.1|590777_591446_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AYG29319.1|591577_592147_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYG26992.1|592197_592962_-	YibE/F family protein	NA	NA	NA	NA	NA
AYG26993.1|592958_594209_-	YibE/F family protein	NA	NA	NA	NA	NA
AYG26994.1|594172_595174_-	hypothetical protein	NA	NA	NA	NA	NA
AYG26995.1|595593_596358_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
AYG26996.1|596710_597037_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AYG26997.1|597228_598110_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AYG26998.1|598152_599961_-	DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	36.1	1.0e-77
AYG26999.1|600218_600434_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYG27000.1|600635_600902_+	hypothetical protein	NA	NA	NA	NA	NA
AYG27001.1|600952_602185_+	hypothetical protein	NA	NA	NA	NA	NA
AYG27002.1|602220_603627_+	C69 family dipeptidase	NA	NA	NA	NA	NA
AYG27003.1|604078_605086_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	43.0	1.4e-63
AYG27004.1|605124_606420_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.2	7.1e-57
AYG27005.1|606480_607098_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AYG27006.1|607206_607680_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYG27007.1|607955_609845_-	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	26.2	5.2e-16
AYG27008.1|610031_610958_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.8	3.2e-19
AYG27009.1|611028_611580_-	helix-turn-helix domain-containing protein	NA	X2CXD8	Lactobacillus_phage	48.4	8.4e-07
AYG27010.1|611679_612432_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYG27011.1|613081_613204_-	hypothetical protein	NA	NA	NA	NA	NA
AYG27012.1|617093_617624_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AYG27013.1|617937_618171_-	hypothetical protein	NA	NA	NA	NA	NA
618004:618025	attL	CTCATTGGCAGCGATAAGGTTA	NA	NA	NA	NA
AYG27014.1|618137_618542_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AYG27015.1|618546_619128_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AYG27016.1|619138_620056_-|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	44.7	2.7e-74
AYG27017.1|626095_628630_-	M1 family peptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.4	3.5e-68
620838:620859	attR	CTCATTGGCAGCGATAAGGTTA	NA	NA	NA	NA
AYG27018.1|628811_629384_-	alpha-L-rhamnosidase	NA	NA	NA	NA	NA
AYG27019.1|629489_629822_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AYG27020.1|630183_631194_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
AYG27021.1|631325_632156_-	FAA hydrolase family protein	NA	NA	NA	NA	NA
AYG27022.1|632329_632770_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AYG27023.1|632830_633253_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AYG27024.1|633267_633450_-	hypothetical protein	NA	NA	NA	NA	NA
AYG27025.1|633462_634008_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
AYG27026.1|634019_634274_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AYG27027.1|634514_636362_-	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	23.7	5.8e-20
AYG27028.1|636351_636735_-	hypothetical protein	NA	NA	NA	NA	NA
AYG27029.1|637219_639727_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AYG27030.1|640000_641299_+	MFS transporter	NA	NA	NA	NA	NA
AYG27031.1|641375_642251_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	28.9	2.8e-20
AYG27032.1|642259_642967_-|transposase	transposase	transposase	NA	NA	NA	NA
AYG27033.1|643122_643467_-	transcriptional regulator	NA	NA	NA	NA	NA
AYG27034.1|643686_644373_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
CP032648	Lactobacillus plantarum strain ZFM4 chromosome, complete genome	3213092	843746	852370	3213092		Streptococcus_phage(66.67%)	11	NA	NA
AYG27199.1|843746_844742_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.9	7.7e-51
AYG27200.1|844880_845666_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
AYG27201.1|845669_846566_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.3	1.9e-80
AYG27202.1|846664_847012_-	initiation-control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
AYG27203.1|847036_848056_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
AYG27204.1|848072_848402_-	hypothetical protein	NA	NA	NA	NA	NA
AYG27205.1|848398_849064_-	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
AYG27206.1|849461_849713_-	DUF2508 family protein	NA	NA	NA	NA	NA
AYG27207.1|849727_850327_-	recombination protein RecR	NA	NA	NA	NA	NA
AYG27208.1|850342_850651_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AYG27209.1|850672_852370_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
>prophage 4
CP032648	Lactobacillus plantarum strain ZFM4 chromosome, complete genome	3213092	871890	943465	3213092	integrase,portal,protease,lysis,terminase,capsid,tRNA,tail	Lactobacillus_phage(89.36%)	77	938960:938975	947059:947074
AYG27232.1|871890_873303_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.0	3.1e-45
AYG27233.1|873580_875071_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AYG27234.1|875396_876572_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
AYG27235.1|876587_877967_-	DNA repair protein RadA	NA	NA	NA	NA	NA
AYG27236.1|878108_878315_+	hypothetical protein	NA	NA	NA	NA	NA
AYG27237.1|879093_879630_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	45.8	2.4e-35
AYG27238.1|879768_880065_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYG27239.1|880073_880757_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
AYG27240.1|880832_882164_+	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.3	5.4e-68
AYG29327.1|884124_884817_-	peptidase M10	NA	NA	NA	NA	NA
AYG27241.1|885235_885913_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AYG27242.1|886062_887088_-	EamA family transporter	NA	NA	NA	NA	NA
AYG27243.1|887520_888483_-	AEC family transporter	NA	NA	NA	NA	NA
AYG27244.1|888792_889986_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AYG27245.1|890053_890827_-	hypothetical protein	NA	NA	NA	NA	NA
AYG27246.1|890819_891623_-	acetyl-CoA carboxyl transferase	NA	NA	NA	NA	NA
AYG27247.1|891619_892942_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AYG27248.1|892944_893346_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
AYG27249.1|893356_894328_-	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
AYG27250.1|894491_895010_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
AYG27251.1|895006_895426_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AYG27252.1|895496_898346_-	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
AYG27253.1|898652_899039_-	DUF956 family protein	NA	NA	NA	NA	NA
AYG27254.1|899167_900100_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
AYG27255.1|900118_900928_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AYG27256.1|900963_901938_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AYG27257.1|902228_903083_-	hypothetical protein	NA	NA	NA	NA	NA
AYG27258.1|903510_904443_-	lysin	NA	A0A2P0ZLG2	Lactobacillus_phage	92.3	6.9e-171
AYG27259.1|904442_904727_-|lysis	lysis protein	lysis	A0A2P0ZLE8	Lactobacillus_phage	97.9	4.1e-42
AYG27260.1|904726_904936_-	hypothetical protein	NA	A0A2P0ZLG4	Lactobacillus_phage	58.0	9.8e-09
AYG27261.1|904941_905322_-	hypothetical protein	NA	A0A2P0ZLF7	Lactobacillus_phage	76.0	3.2e-50
AYG27262.1|905338_905773_-	hypothetical protein	NA	A0A2P0ZLE9	Lactobacillus_phage	79.9	9.7e-59
AYG27263.1|905774_906266_-	DUF1617 family protein	NA	A0A2P0ZLE0	Lactobacillus_phage	62.5	2.8e-46
AYG27264.1|906289_911155_-	hypothetical protein	NA	A0A2P0ZLE1	Lactobacillus_phage	52.0	0.0e+00
AYG27265.1|911174_911996_-|tail	phage tail protein	tail	A0A2P0ZLE2	Lactobacillus_phage	95.6	1.3e-149
AYG27266.1|911999_916592_-|tail	phage tail tape measure protein	tail	A0A2P0ZLF1	Lactobacillus_phage	78.6	0.0e+00
AYG27267.1|916610_916853_-|tail	phage tail tape measure protein	tail	A0A2P0ZLD9	Lactobacillus_phage	98.6	3.3e-32
AYG27268.1|916855_917170_-	hypothetical protein	NA	A0A2P0ZLF3	Lactobacillus_phage	96.2	2.4e-51
AYG27269.1|917263_917875_-|tail	phage tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	96.1	9.6e-105
AYG27270.1|917889_918312_-	hypothetical protein	NA	A0A2P0ZLE4	Lactobacillus_phage	97.9	2.8e-71
AYG27271.1|918308_918716_-	hypothetical protein	NA	A0A2P0ZLD7	Lactobacillus_phage	93.3	1.0e-65
AYG27272.1|918712_919102_-	hypothetical protein	NA	A0A2P0ZLD1	Lactobacillus_phage	90.7	1.5e-63
AYG27273.1|919082_919388_-	hypothetical protein	NA	A0A2P0ZLD5	Lactobacillus_phage	95.0	1.2e-47
AYG27274.1|919526_920699_-|capsid	phage major capsid protein	capsid	A0A2P0ZLD6	Lactobacillus_phage	54.5	6.6e-110
AYG27275.1|920721_921444_-|protease	Clp protease ClpP	protease	A0A2P0ZLE3	Lactobacillus_phage	75.4	9.7e-96
AYG27276.1|921430_922573_-|portal	phage portal protein	portal	A0A2P0ZLC9	Lactobacillus_phage	97.6	4.0e-213
AYG27277.1|922591_924271_-|terminase	terminase large subunit	terminase	A0A2P0ZLE5	Lactobacillus_phage	98.0	0.0e+00
AYG29328.1|924267_924555_-	hypothetical protein	NA	A0A2P0ZLC8	Lactobacillus_phage	95.8	1.1e-42
AYG27278.1|924664_924907_-	hypothetical protein	NA	A0A2P0ZLD2	Lactobacillus_phage	100.0	5.6e-40
AYG27279.1|924924_925167_-	hypothetical protein	NA	A0A2P0ZLD3	Lactobacillus_phage	83.8	8.6e-33
AYG27280.1|925166_925505_-	HNH endonuclease	NA	A0A2P0ZLC6	Lactobacillus_phage	96.4	2.8e-61
AYG27281.1|925488_925725_-	hypothetical protein	NA	A0A2P0ZLC2	Lactobacillus_phage	72.9	1.8e-19
AYG27282.1|926108_927380_-	hypothetical protein	NA	NA	NA	NA	NA
AYG27283.1|927395_928265_-	DNA adenine methylase	NA	A0A1S5PRR3	Streptococcus_phage	51.4	8.9e-80
AYG27284.1|928600_929032_-	hypothetical protein	NA	A0A2P0ZLC0	Lactobacillus_phage	93.4	2.5e-67
AYG27285.1|929043_929352_-	hypothetical protein	NA	A0A2P0ZLD0	Lactobacillus_phage	90.1	1.7e-46
AYG29329.1|929483_929969_-	adenine methyltransferase	NA	A0A2P0ZL79	Lactobacillus_phage	93.8	2.1e-78
AYG27286.1|930036_930528_-	methyltransferase domain-containing protein	NA	O03918	Lactobacillus_phage	89.9	5.8e-84
AYG27287.1|930926_931124_-	hypothetical protein	NA	A0A2P0ZLB7	Lactobacillus_phage	95.4	7.3e-30
AYG27288.1|931104_931446_-	VRR-NUC domain-containing protein	NA	A0A2P0ZLB6	Lactobacillus_phage	95.6	1.5e-59
AYG27289.1|931700_932966_-	helicase	NA	A0A2P0ZLC4	Lactobacillus_phage	94.1	5.8e-229
AYG27290.1|932962_933757_-	DNA primase	NA	A0A2P0ZLB0	Lactobacillus_phage	92.0	2.1e-136
AYG27291.1|933827_934460_-	hypothetical protein	NA	A0A2P0ZLB9	Lactobacillus_phage	97.3	4.6e-102
AYG27292.1|934462_935179_-	NTP-binding protein	NA	A0A2P0ZLB2	Lactobacillus_phage	97.7	1.5e-112
AYG27293.1|935175_936435_-	DEAD/DEAH box helicase	NA	A0A2P0ZLA5	Lactobacillus_phage	96.7	8.0e-231
AYG27294.1|936586_937066_-	RNA helicase	NA	A0A2P0ZLB3	Lactobacillus_phage	89.9	1.8e-77
AYG27295.1|937336_937567_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYG27296.1|937873_938155_-	hypothetical protein	NA	NA	NA	NA	NA
AYG27297.1|938292_938565_-	hypothetical protein	NA	A0A2P0ZLA9	Lactobacillus_phage	100.0	1.2e-43
AYG27298.1|938564_938768_-	hypothetical protein	NA	A0A2P0ZLA4	Lactobacillus_phage	98.5	1.5e-30
AYG27299.1|938839_939328_+	DUF2321 domain-containing protein	NA	Q6SEF3	Lactobacillus_prophage	43.5	2.7e-33
938960:938975	attL	TGCCCAAAATGTGATT	NA	NA	NA	NA
AYG27300.1|939455_939665_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYG27301.1|939916_940324_+	XRE family transcriptional regulator	NA	Q9T1J3	Lactobacillus_phage	36.0	1.2e-10
AYG27302.1|940333_940807_+	hypothetical protein	NA	NA	NA	NA	NA
AYG27303.1|940897_941578_+	hypothetical protein	NA	NA	NA	NA	NA
AYG27304.1|941774_942137_+	hypothetical protein	NA	E9LUS2	Lactobacillus_phage	94.2	1.4e-58
AYG27305.1|942307_943465_+|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	98.2	3.6e-217
947059:947074	attR	AATCACATTTTGGGCA	NA	NA	NA	NA
>prophage 5
CP032648	Lactobacillus plantarum strain ZFM4 chromosome, complete genome	3213092	1028924	1089534	3213092	tRNA,protease,transposase	uncultured_Mediterranean_phage(20.0%)	55	NA	NA
AYG27371.1|1028924_1030196_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.7	4.5e-96
AYG27372.1|1030662_1032276_-	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	1.2e-143
AYG27373.1|1032448_1033057_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
AYG27374.1|1033101_1033542_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
AYG27375.1|1033904_1034837_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
AYG27376.1|1034851_1036204_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.9	5.2e-26
AYG27377.1|1036223_1037033_+	sugar-phosphatase	NA	NA	NA	NA	NA
AYG27378.1|1037202_1038189_-	hypothetical protein	NA	NA	NA	NA	NA
AYG27379.1|1038271_1039294_-	YdcF family protein	NA	NA	NA	NA	NA
AYG27380.1|1039582_1040563_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.3	4.9e-42
AYG27381.1|1040928_1041753_-	serine hydrolase	NA	NA	NA	NA	NA
AYG27382.1|1041988_1043371_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A2K9L140	Tupanvirus	33.2	5.7e-28
AYG27383.1|1043439_1044276_-	pur operon repressor	NA	NA	NA	NA	NA
AYG27384.1|1044768_1045032_-	hypothetical protein	NA	NA	NA	NA	NA
AYG27385.1|1045046_1045589_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
AYG27386.1|1046138_1046414_-	hypothetical protein	NA	NA	NA	NA	NA
AYG27387.1|1046769_1047573_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AYG27388.1|1047559_1048258_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.8	1.2e-15
AYG27389.1|1048525_1049470_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYG27390.1|1049779_1050646_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AYG27391.1|1050778_1051030_-	hypothetical protein	NA	NA	NA	NA	NA
AYG27392.1|1051134_1052025_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
AYG27393.1|1052021_1052585_-	ribonuclease M5	NA	NA	NA	NA	NA
AYG27394.1|1052571_1053348_-	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
AYG27395.1|1053732_1054508_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
AYG27396.1|1054532_1054943_-	hypothetical protein	NA	NA	NA	NA	NA
AYG27397.1|1055505_1056396_+	transcriptional regulator	NA	NA	NA	NA	NA
AYG27398.1|1056429_1057614_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
AYG27399.1|1057943_1058270_-	hypothetical protein	NA	NA	NA	NA	NA
AYG27400.1|1058748_1060800_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
AYG27401.1|1061121_1061511_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AYG27402.1|1062105_1062948_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
AYG27403.1|1062947_1063652_-	NAD-dependent protein deacetylase	NA	NA	NA	NA	NA
AYG27404.1|1063673_1064633_-	IpaB/EvcA family protein	NA	NA	NA	NA	NA
AYG27405.1|1064625_1065900_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
AYG27406.1|1065945_1066863_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
AYG27407.1|1067262_1068276_-|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
AYG27408.1|1068388_1069135_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AYG27409.1|1069284_1070181_-	ROK family protein	NA	NA	NA	NA	NA
AYG27410.1|1070301_1071738_-	glycosyl hydrolase family protein	NA	A0A0B5JD41	Pandoravirus	25.5	9.7e-31
AYG29332.1|1071755_1073111_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AYG27411.1|1073333_1073756_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
AYG27412.1|1073745_1073934_-	hypothetical protein	NA	NA	NA	NA	NA
AYG27413.1|1073940_1075302_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AYG27414.1|1075374_1076085_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYG27415.1|1076490_1077507_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AYG27416.1|1077940_1078717_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
AYG27417.1|1078975_1081285_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
AYG27418.1|1081379_1081583_-	hypothetical protein	NA	NA	NA	NA	NA
AYG27419.1|1081720_1082407_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYG27420.1|1082500_1083181_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYG27421.1|1083267_1083936_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYG27422.1|1084003_1084693_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYG27423.1|1084779_1086159_-	HlyD family secretion protein	NA	NA	NA	NA	NA
AYG27424.1|1088610_1089534_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	6.7e-33
>prophage 6
CP032648	Lactobacillus plantarum strain ZFM4 chromosome, complete genome	3213092	1772706	1782074	3213092	bacteriocin	Planktothrix_phage(16.67%)	7	NA	NA
AYG28017.1|1772706_1774728_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	3.5e-18
AYG28018.1|1774820_1775798_-	guanosine monophosphate reductase	NA	Q4ZCY7	Staphylococcus_virus	71.2	1.4e-137
AYG28019.1|1775840_1777130_-	adenylosuccinate synthetase	NA	L7Y4J5	Megavirus	37.0	3.5e-72
AYG28020.1|1777446_1778745_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.6	3.8e-18
AYG28021.1|1778967_1779297_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYG28022.1|1779491_1780826_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	7.9e-27
AYG28023.1|1780961_1782074_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.3	1.3e-35
>prophage 7
CP032648	Lactobacillus plantarum strain ZFM4 chromosome, complete genome	3213092	2265831	2274345	3213092		Synechococcus_phage(33.33%)	9	NA	NA
AYG28432.1|2265831_2266317_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
AYG28433.1|2266300_2267431_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AYG28434.1|2267433_2268165_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	38.6	1.2e-37
AYG28435.1|2268166_2268421_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AYG28436.1|2268420_2269101_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AYG28437.1|2269093_2271313_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	38.9	1.0e-143
AYG28438.1|2271297_2272752_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.8	7.3e-50
AYG28439.1|2272748_2273774_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	1.2e-59
AYG28440.1|2273766_2274345_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
>prophage 8
CP032648	Lactobacillus plantarum strain ZFM4 chromosome, complete genome	3213092	2470562	2509575	3213092	integrase,portal,holin,plate,terminase,capsid,tail	Lactobacillus_phage(54.17%)	47	2467854:2467871	2477628:2477645
2467854:2467871	attL	AATGCTGATAAGCAGATT	NA	NA	NA	NA
AYG28618.1|2470562_2471684_-|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	32.4	9.9e-47
AYG28619.1|2471932_2473126_-	hypothetical protein	NA	A0A141E0C6	Streptococcus_phage	25.9	5.4e-19
AYG28620.1|2473745_2474447_-	DUF3862 domain-containing protein	NA	A0A0P0IXE0	Lactobacillus_phage	80.8	2.0e-05
AYG28621.1|2474554_2474809_-	hypothetical protein	NA	NA	NA	NA	NA
AYG28622.1|2474818_2475610_-	hypothetical protein	NA	NA	NA	NA	NA
AYG29363.1|2476081_2476780_-	hypothetical protein	NA	NA	NA	NA	NA
AYG28623.1|2476964_2477933_-	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
2477628:2477645	attR	AATCTGCTTATCAGCATT	NA	NA	NA	NA
AYG28624.1|2477988_2478411_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AYG28625.1|2478425_2478944_-	XRE family transcriptional regulator	NA	S6C481	Thermus_phage	34.1	1.6e-15
AYG28626.1|2479085_2479274_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYG28627.1|2479355_2480168_+	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	49.6	1.2e-73
AYG28628.1|2480248_2481157_+	DnaD domain protein	NA	NA	NA	NA	NA
AYG28629.1|2481153_2481441_+	hypothetical protein	NA	NA	NA	NA	NA
AYG28630.1|2481437_2481956_+	hypothetical protein	NA	O03915	Lactobacillus_phage	68.4	3.5e-55
AYG28631.1|2481952_2482333_+	hypothetical protein	NA	NA	NA	NA	NA
AYG28632.1|2482543_2483005_+	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	1.1e-39
AYG28633.1|2483269_2483887_-	hypothetical protein	NA	NA	NA	NA	NA
AYG28634.1|2484782_2484980_+	hypothetical protein	NA	NA	NA	NA	NA
AYG28635.1|2484957_2485134_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	57.4	9.1e-08
AYG28636.1|2485102_2485360_+	hypothetical protein	NA	A0A0N9SKC5	Staphylococcus_phage	47.6	1.3e-15
AYG28637.1|2485413_2485953_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	75.3	1.0e-49
AYG28638.1|2485933_2487259_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1S5SA45	Streptococcus_phage	55.7	4.5e-139
AYG28639.1|2487306_2488857_+|portal	phage portal protein	portal	B5LPR1	Bacillus_virus	38.2	8.2e-84
AYG28640.1|2488849_2489044_+	hypothetical protein	NA	NA	NA	NA	NA
AYG28641.1|2489040_2489934_+	hypothetical protein	NA	A0A1B1P858	Bacillus_phage	35.3	2.1e-36
AYG28642.1|2489997_2490609_+	hypothetical protein	NA	NA	NA	NA	NA
AYG28643.1|2490622_2491570_+|capsid	N4-gp56 family major capsid protein	capsid	A8ASJ6	Listeria_phage	59.1	4.4e-88
AYG28644.1|2491929_2492334_+	hypothetical protein	NA	A5GYM1	Lactococcus_phage	27.5	2.0e-05
AYG28645.1|2492334_2492724_+	hypothetical protein	NA	NA	NA	NA	NA
AYG28646.1|2492720_2493122_+	hypothetical protein	NA	NA	NA	NA	NA
AYG28647.1|2493121_2493547_+	hypothetical protein	NA	NA	NA	NA	NA
AYG28648.1|2493564_2494173_+	hypothetical protein	NA	NA	NA	NA	NA
AYG28649.1|2494291_2494810_+	hypothetical protein	NA	NA	NA	NA	NA
AYG28650.1|2494806_2495448_+	hypothetical protein	NA	U3PFU8	Lactobacillus_phage	27.5	1.3e-06
AYG28651.1|2495463_2501112_+|tail	phage tail tape measure protein	tail	Q5ULL6	Lactobacillus_virus	70.0	3.6e-36
AYG28652.1|2501112_2501931_+|tail	phage tail family protein	tail	NA	NA	NA	NA
AYG28653.1|2501942_2503070_+	hypothetical protein	NA	O03938	Lactobacillus_phage	42.0	3.1e-72
AYG28654.1|2503062_2503311_+	hypothetical protein	NA	NA	NA	NA	NA
AYG28655.1|2503285_2503639_+	hypothetical protein	NA	NA	NA	NA	NA
AYG29364.1|2504135_2504939_+	SGNH/GDSL hydrolase family protein	NA	Q597U1	Lactobacillus_virus	84.3	1.4e-127
AYG28656.1|2504952_2505507_+|plate	phage baseplate upper protein	plate	O03968	Lactobacillus_phage	61.8	4.9e-55
AYG28657.1|2505503_2507339_+	hypothetical protein	NA	Q597U3	Lactobacillus_virus	52.4	7.5e-185
AYG28658.1|2507350_2507620_+	hypothetical protein	NA	NA	NA	NA	NA
AYG28659.1|2507612_2507744_+	XkdX family protein	NA	NA	NA	NA	NA
AYG28660.1|2507759_2508914_+	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	37.5	2.6e-42
AYG28661.1|2508914_2509211_+	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	77.6	1.2e-39
AYG28662.1|2509197_2509575_+|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	77.5	4.1e-21
>prophage 9
CP032648	Lactobacillus plantarum strain ZFM4 chromosome, complete genome	3213092	2798863	2881183	3213092	portal,tail,protease,holin,terminase,head,tRNA,capsid	Lactobacillus_phage(79.59%)	87	NA	NA
AYG28922.1|2798863_2799226_-	hypothetical protein	NA	E9LUS2	Lactobacillus_phage	95.8	2.1e-59
AYG28923.1|2799382_2799571_-	hypothetical protein	NA	E9LUS5	Lactobacillus_phage	100.0	2.1e-26
AYG28924.1|2799888_2800089_-	hypothetical protein	NA	E9LUS6	Lactobacillus_phage	97.0	5.5e-25
AYG28925.1|2800270_2800969_-	hypothetical protein	NA	Q9AZW5	Lactococcus_phage	36.8	2.1e-18
AYG28926.1|2800977_2801364_-	hypothetical protein	NA	NA	NA	NA	NA
AYG29374.1|2801421_2801700_-	hypothetical protein	NA	D2KRD5	Lactobacillus_phage	59.3	1.3e-21
AYG28927.1|2801709_2802048_-	XRE family transcriptional regulator	NA	Q8W5Y0	Listeria_phage	42.2	1.0e-15
AYG28928.1|2802293_2802515_+	hypothetical protein	NA	NA	NA	NA	NA
AYG29375.1|2802520_2803228_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	62.2	6.8e-70
AYG28929.1|2803239_2803449_+	hypothetical protein	NA	NA	NA	NA	NA
AYG28930.1|2803564_2803891_-	RNA polymerase III	NA	E9LUT2	Lactobacillus_phage	98.1	2.7e-53
AYG28931.1|2803948_2804209_+	hypothetical protein	NA	NA	NA	NA	NA
AYG28932.1|2804351_2804600_+	tagatose-bisphosphate aldolase	NA	E9LUT6	Lactobacillus_phage	84.1	1.9e-35
AYG28933.1|2804602_2804803_+	hypothetical protein	NA	E9LUT7	Lactobacillus_phage	89.4	1.7e-26
AYG28934.1|2804814_2805039_+	hypothetical protein	NA	E9LUT8	Lactobacillus_phage	86.3	1.2e-28
AYG28935.1|2805257_2805515_+	hypothetical protein	NA	NA	NA	NA	NA
AYG28936.1|2805619_2806423_+	replisome organizer	NA	E9LUM6	Lactobacillus_phage	56.9	6.4e-40
AYG28937.1|2806416_2807292_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	41.6	2.2e-49
AYG28938.1|2807754_2808066_+	hypothetical protein	NA	A0A2P0ZLB4	Lactobacillus_phage	87.4	3.0e-46
AYG28939.1|2809027_2809429_+	hypothetical protein	NA	K4I239	Lactobacillus_phage	54.5	5.5e-32
AYG28940.1|2809501_2809927_+	DUF1642 domain-containing protein	NA	E9LUP3	Lactobacillus_phage	61.7	2.2e-39
AYG28941.1|2810429_2810858_+	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	86.5	1.1e-65
AYG28942.1|2811191_2811371_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	86.4	3.1e-19
AYG28943.1|2811339_2811849_+	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	91.5	2.2e-78
AYG28944.1|2812045_2812501_+|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	97.4	9.4e-81
AYG28945.1|2812510_2814409_+|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	94.0	0.0e+00
AYG28946.1|2814398_2814593_+	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	93.8	3.7e-26
AYG28947.1|2814595_2815789_+|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	98.7	3.1e-224
AYG28948.1|2815766_2816522_+|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	93.2	3.9e-124
AYG28949.1|2816521_2817754_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	94.1	4.3e-213
AYG28950.1|2817826_2818165_+|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	91.1	5.8e-51
AYG28951.1|2818148_2818511_+|head,tail	head-tail adaptor protein	head,tail	E9LUQ5	Lactobacillus_phage	97.5	6.4e-64
AYG28952.1|2818500_2818941_+|tail	phage tail protein	tail	E9LUQ6	Lactobacillus_phage	97.9	4.2e-78
AYG28953.1|2818937_2819321_+	DUF806 family protein	NA	E9LUQ7	Lactobacillus_phage	96.9	1.0e-64
AYG28954.1|2819321_2819960_+|tail	phage tail protein	tail	E9LUQ8	Lactobacillus_phage	93.9	1.4e-109
AYG28955.1|2820161_2820545_+	hypothetical protein	NA	E9LUQ9	Lactobacillus_phage	99.2	2.0e-63
AYG28956.1|2820541_2820733_+	hypothetical protein	NA	E9LUR0	Lactobacillus_phage	98.4	1.5e-27
AYG28957.1|2820745_2825968_+|tail	phage tail protein	tail	E9LUR1	Lactobacillus_phage	76.9	0.0e+00
AYG28958.1|2826039_2827812_+|tail	phage tail protein	tail	E9LUR2	Lactobacillus_phage	96.6	0.0e+00
AYG28959.1|2827878_2830248_+	hypothetical protein	NA	E9LUR3	Lactobacillus_phage	92.9	0.0e+00
AYG28960.1|2830264_2833063_+|tail	phage tail protein	tail	E9LUR4	Lactobacillus_phage	73.2	3.1e-222
AYG28961.1|2833055_2833298_+	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	92.5	6.2e-31
AYG28962.1|2833446_2834544_+	collagen-like protein	NA	A0A2P0ZLF6	Lactobacillus_phage	87.1	8.1e-62
AYG28963.1|2834540_2834753_+	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	80.3	2.0e-17
AYG28964.1|2834764_2835943_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	89.0	6.9e-200
AYG28965.1|2835942_2836206_+|holin	holin	holin	E9LUR9	Lactobacillus_phage	100.0	2.0e-38
AYG28966.1|2836215_2836590_+|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	76.2	2.6e-20
AYG28967.1|2837377_2838589_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
AYG28968.1|2840828_2841620_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	4.5e-30
AYG28969.1|2841600_2842785_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AYG28970.1|2842936_2843509_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYG28971.1|2844208_2845150_-	glycosyltransferase	NA	V9QJB1	Oenococcus_phage	48.7	3.1e-78
AYG28972.1|2845595_2845988_-	hypothetical protein	NA	NA	NA	NA	NA
AYG28973.1|2846151_2846544_+	hypothetical protein	NA	NA	NA	NA	NA
AYG28974.1|2846579_2847749_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
AYG28975.1|2847798_2848428_-	hypothetical protein	NA	NA	NA	NA	NA
AYG28976.1|2848731_2848962_+	hypothetical protein	NA	NA	NA	NA	NA
AYG28977.1|2849051_2849684_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	56.2	2.3e-16
AYG28978.1|2849835_2850075_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
AYG28979.1|2850172_2850409_+	YneF family protein	NA	NA	NA	NA	NA
AYG28980.1|2850465_2851101_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AYG28981.1|2851212_2851971_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
AYG28982.1|2851954_2852260_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
AYG28983.1|2852344_2853343_+	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	2.3e-47
AYG28984.1|2853632_2854355_-	HAD family hydrolase	NA	NA	NA	NA	NA
AYG28985.1|2854579_2855383_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
AYG28986.1|2855485_2856364_+	elongation factor Ts	NA	NA	NA	NA	NA
AYG28987.1|2856563_2857286_+	UMP kinase	NA	NA	NA	NA	NA
AYG28988.1|2857287_2857851_+	ribosome-recycling factor	NA	NA	NA	NA	NA
AYG28989.1|2857970_2858750_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.1	1.8e-23
AYG28990.1|2858765_2859551_+	CDP-archaeol synthase	NA	NA	NA	NA	NA
AYG28991.1|2859588_2860866_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AYG28992.1|2860905_2862615_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AYG28993.1|2863108_2867422_+	DNA polymerase III subunit alpha	NA	A0A1X9SH08	Bradyrhizobium_phage	34.0	1.0e-14
AYG28994.1|2867717_2868194_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AYG28995.1|2868214_2869432_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AYG28996.1|2869476_2869776_+	YlxR family protein	NA	NA	NA	NA	NA
AYG28997.1|2869765_2870071_+	hypothetical protein	NA	NA	NA	NA	NA
AYG28998.1|2870085_2872662_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.3	9.6e-21
AYG28999.1|2872684_2873038_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
AYG29000.1|2873686_2875141_+	MFS transporter	NA	NA	NA	NA	NA
AYG29001.1|2875133_2876303_+	chorismate synthase	NA	NA	NA	NA	NA
AYG29002.1|2876311_2876839_+	amino acid biosynthesis protein	NA	NA	NA	NA	NA
AYG29003.1|2876852_2878151_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AYG29004.1|2878153_2879251_+	prephenate dehydrogenase	NA	NA	NA	NA	NA
AYG29005.1|2879253_2879775_+	shikimate kinase	NA	NA	NA	NA	NA
AYG29006.1|2880259_2881183_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 1
CP032649	Lactobacillus plantarum strain ZFM4 plasmid unnamed1, complete sequence	41517	30031	37755	41517	transposase	Enterococcus_phage(28.57%)	7	NA	NA
AYG29405.1|30031_32200_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.3	5.2e-254
AYG29406.1|32306_33233_+	ribonucleoside-diphosphate reductase	NA	A0A2H4P8A9	Corynebacterium_phage	31.1	1.2e-34
AYG29407.1|33247_34198_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	54.6	9.4e-99
AYG29408.1|34325_35138_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	29.0	9.4e-15
AYG29409.1|35251_35884_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	33.2	3.6e-14
AYG29410.1|35970_36873_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	40.3	8.2e-52
AYG29411.1|36980_37755_+|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
