The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032637	Lactobacillus paracasei strain ZFM54 chromosome, complete genome	3015887	200	47754	3015887	capsid,protease,integrase,portal,holin,tail,terminase,transposase,head	Lactobacillus_phage(68.29%)	60	2609:2622	55389:55402
AYG21645.1|200_770_+	hypothetical protein	NA	Q7Y5K0	Xanthomonas_virus	44.1	4.3e-06
AYG21646.1|771_1290_+	DUF669 domain-containing protein	NA	A0A0P0IQI1	Lactobacillus_phage	96.5	5.9e-95
AYG21647.1|1301_3602_+	DNA primase	NA	A0A0P0IX98	Lactobacillus_phage	97.5	0.0e+00
2609:2622	attL	TGATTTATCTGATG	NA	NA	NA	NA
AYG21648.1|3846_4173_+	VRR-NUC domain-containing protein	NA	A0A0P0IJK0	Lactobacillus_phage	97.2	3.2e-54
AYG21649.1|4163_4352_+	hypothetical protein	NA	A0A0P0IZE4	Lactobacillus_phage	87.7	6.3e-23
AYG21650.1|4348_4813_+	endonuclease	NA	A0A0P0IXF6	Lactobacillus_phage	97.3	1.5e-12
AYG21651.1|4824_5535_+	SAM-dependent DNA methyltransferase	NA	A8YQM7	Lactobacillus_phage	97.8	2.6e-125
AYG21652.1|5521_6445_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	44.9	9.9e-69
AYG21653.1|6455_7034_+	hypothetical protein	NA	NA	NA	NA	NA
AYG21654.1|7057_7168_+	acetyltransferase	NA	A0A2D1GP93	Lactobacillus_phage	91.7	4.6e-10
AYG21655.1|7164_7692_+	DUF1642 domain-containing protein	NA	Q8LTB6	Lactobacillus_phage	51.7	3.1e-35
AYG21656.1|7675_7897_+	hypothetical protein	NA	B4XYT5	Lactobacillus_phage	98.6	3.2e-34
AYG21657.1|7883_8129_+	hypothetical protein	NA	NA	NA	NA	NA
AYG21658.1|8142_8349_+	hypothetical protein	NA	B4XYT6	Lactobacillus_phage	98.5	1.5e-33
AYG21659.1|8345_8741_+	hypothetical protein	NA	C1KFE5	Lactobacillus_virus	85.5	2.5e-61
AYG21660.1|8737_9046_+	hypothetical protein	NA	Q8LTB2	Lactobacillus_phage	95.8	3.4e-50
AYG21661.1|9042_9468_+	hypothetical protein	NA	B4XYT8	Lactobacillus_phage	60.7	2.7e-37
AYG24430.1|9634_9706_+	hypothetical protein	NA	NA	NA	NA	NA
AYG21662.1|10135_10579_+	transcriptional regulator	NA	A0A0P0IZI6	Lactobacillus_phage	95.2	1.4e-76
AYG21663.1|11097_11409_+	hypothetical protein	NA	NA	NA	NA	NA
AYG21664.1|11788_13006_+	hypothetical protein	NA	A8YQN3	Lactobacillus_phage	97.5	2.9e-238
AYG21665.1|12992_13523_+	endonuclease	NA	U5U4N5	Lactobacillus_phage	64.8	5.1e-62
AYG21666.1|13527_13851_+	ribonucleoside-diphosphate reductase	NA	A0A2D1GPM6	Lactobacillus_phage	87.6	2.2e-47
AYG21667.1|14021_14357_+	HNH endonuclease	NA	A0A2H4J213	uncultured_Caudovirales_phage	53.8	6.4e-26
AYG24431.1|14591_14810_+	hypothetical protein	NA	D2XR14	Bacillus_phage	41.1	1.2e-06
AYG21668.1|14806_16498_+|terminase	terminase large subunit	terminase	A0A2P0ZLE5	Lactobacillus_phage	52.7	5.6e-171
AYG21669.1|16512_17679_+|portal	phage portal protein	portal	A0A059T6F0	Listeria_phage	42.3	6.2e-84
AYG21670.1|17656_18385_+|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	40.4	1.9e-38
AYG21671.1|18406_19576_+|capsid	phage major capsid protein	capsid	A0A2P0ZLD6	Lactobacillus_phage	50.4	5.0e-102
AYG24432.1|19572_19719_+	hypothetical protein	NA	NA	NA	NA	NA
AYG21672.1|19711_20002_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1S5SF81	Streptococcus_phage	47.3	1.8e-16
AYG21673.1|19994_20375_+	hypothetical protein	NA	M9QX19	Staphylococcus_phage	31.7	1.4e-08
AYG21674.1|20371_20785_+	hypothetical protein	NA	A0A2P0ZLD7	Lactobacillus_phage	52.6	3.3e-32
AYG21675.1|20781_21159_+	hypothetical protein	NA	A0A059T681	Listeria_phage	42.4	3.2e-18
AYG21676.1|21173_21764_+|tail	phage tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	41.2	3.3e-33
AYG24433.1|21781_22018_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	56.4	9.1e-11
AYG21677.1|22092_22410_+	hypothetical protein	NA	NA	NA	NA	NA
AYG21678.1|22589_26561_+|tail	phage tail tape measure protein	tail	E9LUJ2	Lactobacillus_phage	36.8	1.4e-10
AYG21679.1|26557_28636_+|tail	phage tail protein	tail	Q6J1X4	Lactobacillus_phage	48.0	4.4e-165
AYG21680.1|28636_31117_+|tail	phage tail protein	tail	A8YQK1	Lactobacillus_phage	64.9	0.0e+00
AYG21681.1|31134_31425_+	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	82.3	1.5e-39
AYG21682.1|31417_31549_+	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	100.0	6.5e-19
AYG21683.1|31579_31966_+	hypothetical protein	NA	U5U712	Lactobacillus_phage	99.2	8.0e-65
AYG21684.1|31946_32156_+	hypothetical protein	NA	A0A2D1GPJ3	Lactobacillus_phage	100.0	1.5e-12
AYG21685.1|32148_32595_+|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	95.9	4.9e-66
AYG24434.1|32707_33769_+	LysM peptidoglycan-binding domain-containing protein	NA	Q6J1W8	Lactobacillus_phage	67.9	3.1e-135
AYG21686.1|33950_34556_+	hypothetical protein	NA	NA	NA	NA	NA
AYG21687.1|34567_34909_+	hypothetical protein	NA	NA	NA	NA	NA
AYG24435.1|35043_35346_+	hypothetical protein	NA	NA	NA	NA	NA
AYG21688.1|35966_36719_+	acyltransferase	NA	NA	NA	NA	NA
AYG21689.1|36917_37409_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
AYG21690.1|37395_39507_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
AYG21691.1|39542_39710_+	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
AYG21692.1|39924_41592_+	phosphoenolpyruvate carboxykinase (ATP)	NA	NA	NA	NA	NA
AYG21693.1|41762_42080_+	glutaredoxin	NA	NA	NA	NA	NA
AYG21694.1|42188_43325_-	alpha-L-fucosidase	NA	NA	NA	NA	NA
AYG21695.1|43419_44850_-	melibiose symporter	NA	NA	NA	NA	NA
AYG21696.1|45412_45835_+	hypothetical protein	NA	NA	NA	NA	NA
AYG21697.1|45974_46349_+	hypothetical protein	NA	NA	NA	NA	NA
AYG21698.1|46509_47754_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.4	2.0e-11
55389:55402	attR	TGATTTATCTGATG	NA	NA	NA	NA
>prophage 2
CP032637	Lactobacillus paracasei strain ZFM54 chromosome, complete genome	3015887	693790	759975	3015887	capsid,integrase,holin,portal,tail,transposase,terminase,head	Lactobacillus_phage(79.03%)	87	716019:716078	760100:760177
AYG22315.1|693790_694546_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	37.7	3.9e-31
AYG22316.1|694521_695418_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	36.3	6.7e-30
AYG22317.1|695949_697836_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.0	1.4e-61
AYG22318.1|697835_699566_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	9.9e-46
AYG22319.1|699622_700273_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYG22320.1|700456_701179_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AYG22321.1|701329_701665_+	hypothetical protein	NA	NA	NA	NA	NA
AYG22322.1|701657_701843_+	hypothetical protein	NA	NA	NA	NA	NA
AYG22323.1|702122_703553_+	C69 family dipeptidase	NA	NA	NA	NA	NA
AYG22324.1|703672_704275_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
AYG22325.1|704479_705673_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	35.7	3.6e-55
AYG22326.1|705855_706002_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22327.1|706202_706685_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
AYG22328.1|707580_708048_-	nucleoside deaminase	NA	NA	NA	NA	NA
AYG22329.1|708160_709078_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AYG22330.1|709464_710628_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AYG22331.1|710763_711510_+	DNA-entry nuclease	NA	NA	NA	NA	NA
AYG22332.1|711506_712358_+	DNA/RNA endonuclease	NA	NA	NA	NA	NA
AYG22333.1|712438_712969_+	hypothetical protein	NA	NA	NA	NA	NA
AYG22334.1|713151_713439_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AYG22335.1|714415_714973_+	hypothetical protein	NA	Q6SEA3	Lactobacillus_prophage	39.3	6.4e-23
AYG22336.1|714994_715786_+	DUF1829 domain-containing protein	NA	Q6SEA4	Lactobacillus_prophage	39.9	1.1e-49
716019:716078	attL	ATTAAAGCCGTGCGTTCAATTCCTTGGTCATATCCTCATAACCCGGACGGCCGAGCAATG	NA	NA	NA	NA
AYG22337.1|716384_717533_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0P0HRN9	Lactobacillus_phage	52.7	9.0e-88
AYG22338.1|717543_717990_-|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	94.6	2.4e-65
AYG22339.1|718012_718552_-	hypothetical protein	NA	A0A2P0ZL23	Lactobacillus_phage	63.6	2.1e-50
AYG22340.1|718556_719552_-	hypothetical protein	NA	A0A0N7IR76	Lactobacillus_phage	89.1	2.6e-123
AYG22341.1|719548_719758_-	hypothetical protein	NA	A0A2D1GPJ3	Lactobacillus_phage	100.0	1.5e-12
AYG22342.1|719738_720125_-	hypothetical protein	NA	U5U712	Lactobacillus_phage	99.2	3.3e-66
AYG22343.1|720155_720287_-	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	93.0	1.6e-17
AYG22344.1|720279_720570_-	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	54.2	7.4e-23
AYG22345.1|720571_723007_-|tail	phage tail protein	tail	Q6J1X1	Lactobacillus_phage	72.5	0.0e+00
AYG22346.1|723007_725062_-|tail	phage tail protein	tail	Q7Y4B1	Lactobacillus_phage	43.9	8.8e-134
AYG22347.1|725062_728152_-|tail	phage tail tape measure protein	tail	A0A0N7IR83	Lactobacillus_phage	89.9	5.5e-265
AYG22348.1|728144_728498_-	hypothetical protein	NA	A0A0P0I7N9	Lactobacillus_phage	97.4	2.4e-55
AYG22349.1|728602_728935_-	hypothetical protein	NA	A0A0P0IQQ6	Lactobacillus_phage	95.5	3.7e-50
AYG22350.1|729021_729624_-|tail	phage tail protein	tail	A0A0P0ID88	Lactobacillus_phage	92.5	7.0e-100
AYG22351.1|729635_730040_-	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	98.5	3.0e-70
AYG22352.1|730040_730406_-|tail	phage tail protein	tail	A0A0P0I3G7	Lactobacillus_phage	95.9	2.0e-57
AYG22353.1|730402_730705_-	hypothetical protein	NA	A0A0N7IR97	Lactobacillus_phage	93.0	1.1e-48
AYG22354.1|730709_731084_-	hypothetical protein	NA	A0A0P0IZF6	Lactobacillus_phage	94.4	4.0e-61
AYG22355.1|731153_731405_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22356.1|731419_732439_-|capsid	major capsid protein	capsid	A0A0P0IZJ7	Lactobacillus_phage	95.9	2.7e-184
AYG22357.1|732452_732767_-	hypothetical protein	NA	A0A0P0IJQ8	Lactobacillus_phage	98.1	5.9e-50
AYG22358.1|732779_733412_-	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	84.0	3.9e-77
AYG22359.1|733536_734529_-|head	phage head morphogenesis protein	head	A0A0P0ID43	Lactobacillus_phage	97.0	1.7e-180
AYG22360.1|734494_735922_-|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	94.5	1.0e-250
AYG22361.1|735926_737282_-|terminase	PBSX family phage terminase large subunit	terminase	A4L7R3	Lactococcus_phage	58.2	1.0e-146
AYG22362.1|737259_737793_-|terminase	terminase small subunit	terminase	A0A0P0IUY4	Lactobacillus_phage	95.6	3.2e-64
AYG22363.1|737928_739146_-	hypothetical protein	NA	A0A2D1GPQ9	Lactobacillus_phage	98.0	1.7e-238
AYG22364.1|739696_739948_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
AYG22365.1|740001_740844_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.9	1.5e-156
AYG22366.1|741385_741826_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22367.1|742444_742873_-	transcriptional regulator	NA	NA	NA	NA	NA
AYG24452.1|743250_743322_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22368.1|743318_743561_-	hypothetical protein	NA	U5U734	Lactobacillus_phage	87.5	3.5e-34
AYG22369.1|743553_743940_-	hypothetical protein	NA	A0A2D1GPA7	Lactobacillus_phage	59.1	1.1e-37
AYG22370.1|744159_744369_-	hypothetical protein	NA	D6PSV2	Lactobacillus_phage	91.3	4.2e-28
AYG22371.1|744365_744626_-	hypothetical protein	NA	B4XYT7	Lactobacillus_phage	48.7	2.3e-07
AYG22372.1|744622_744949_-	hypothetical protein	NA	Q6J1U7	Lactobacillus_phage	43.7	1.4e-17
AYG22373.1|744938_745208_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22374.1|745194_745743_-	hypothetical protein	NA	B4XYT4	Lactobacillus_phage	43.4	3.8e-28
AYG22375.1|745739_745991_-	hypothetical protein	NA	B4XYT2	Lactobacillus_phage	48.3	8.7e-12
AYG22376.1|746098_746464_-	endodeoxyribonuclease	NA	A0A0P0HRU0	Lactobacillus_phage	99.2	6.9e-66
AYG22377.1|746460_746715_-	hypothetical protein	NA	A0A0P0IQP0	Lactobacillus_phage	98.8	5.9e-40
AYG22378.1|746761_747211_-	hypothetical protein	NA	A0A0P0ID70	Lactobacillus_phage	98.0	3.9e-71
AYG22379.1|747207_747540_-	hypothetical protein	NA	Q6J1V4	Lactobacillus_phage	79.1	1.5e-40
AYG22380.1|747536_748319_-	ATP-binding protein	NA	Q6J1V5	Lactobacillus_phage	91.9	1.1e-132
AYG22381.1|748305_749157_-	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	97.0	3.2e-106
AYG22382.1|749172_749973_-	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	93.2	4.7e-144
AYG22383.1|749953_750820_-	recombinase RecT	NA	A0A0P0IJP1	Lactobacillus_phage	94.1	2.2e-150
AYG24453.1|750832_751240_-	hypothetical protein	NA	A0A0P0IXE5	Lactobacillus_phage	95.6	2.5e-72
AYG22384.1|751339_751468_-	hypothetical protein	NA	A0A0P0IQL2	Lactobacillus_phage	90.5	4.3e-15
AYG22385.1|751480_751702_-	DNA-binding protein	NA	A0A0P0ID64	Lactobacillus_phage	100.0	1.4e-37
AYG22386.1|751680_752229_-	hypothetical protein	NA	A0A1B0YE60	Lactobacillus_phage	98.9	4.1e-99
AYG22387.1|752528_752756_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
AYG22388.1|752904_753147_-	XRE family transcriptional regulator	NA	A0A059T7X5	Listeria_phage	54.4	2.7e-10
AYG22389.1|753282_753714_+	XRE family transcriptional regulator	NA	A0A2P1JU09	Anoxybacillus_phage	39.9	9.4e-22
AYG22390.1|753714_754161_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AYG22391.1|754207_754801_+	hypothetical protein	NA	NA	NA	NA	NA
AYG22392.1|754860_755562_+	DUF3862 domain-containing protein	NA	A9D9J1	Lactobacillus_prophage	36.9	2.2e-20
AYG22393.1|755642_756413_+	DUF4393 domain-containing protein	NA	E9LUL1	Lactobacillus_phage	27.6	4.3e-17
AYG22394.1|756389_756545_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22395.1|756682_757108_+	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	86.5	2.7e-61
AYG22396.1|757131_757335_+	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	94.0	2.3e-31
AYG22397.1|757444_758446_+	hypothetical protein	NA	A0A1S5SA20	Streptococcus_phage	23.9	2.2e-05
AYG22398.1|758413_758620_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22399.1|758790_759975_+|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	99.5	5.6e-226
760100:760177	attR	ATTAAAGCCGTGCGTTCAATTCCTTGGTCATATCCTCATAACCCGGACGGCCGAGCAATGCGAACATGTTCTTCTTGT	NA	NA	NA	NA
>prophage 3
CP032637	Lactobacillus paracasei strain ZFM54 chromosome, complete genome	3015887	1300908	1384503	3015887	holin,transposase,protease	Lactobacillus_phage(34.48%)	85	NA	NA
AYG22876.1|1300908_1301829_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
AYG22877.1|1303205_1304165_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.9	8.8e-28
AYG22878.1|1305969_1306754_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AYG22879.1|1307063_1307153_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22880.1|1309116_1310439_+	MFS transporter	NA	NA	NA	NA	NA
AYG22881.1|1310546_1311317_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AYG22882.1|1311313_1311964_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	4.3e-18
AYG22883.1|1311924_1312188_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22884.1|1312741_1313425_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.3	1.8e-59
AYG22885.1|1313516_1314188_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYG22886.1|1314192_1315440_-	ABC transporter permease	NA	NA	NA	NA	NA
AYG22887.1|1315417_1316161_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	1.5e-27
AYG22888.1|1316858_1317646_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AYG22889.1|1317684_1317960_-	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
AYG22890.1|1319208_1319805_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	36.5	5.1e-26
AYG22891.1|1319927_1320251_+	ArsR family transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	42.7	5.2e-17
AYG22892.1|1320299_1322033_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AYG22893.1|1322075_1323371_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	61.9	2.0e-144
AYG22894.1|1323407_1323743_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AYG22895.1|1323765_1324182_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	56.9	3.9e-33
AYG22896.1|1325152_1325836_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.3	3.1e-59
AYG22897.1|1327009_1327438_-	FMN-binding protein	NA	NA	NA	NA	NA
AYG22898.1|1327706_1328975_-	NADPH-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	48.2	2.2e-50
AYG22899.1|1328985_1329594_-	NADPH-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	52.8	1.4e-50
AYG22900.1|1329740_1330658_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
AYG24474.1|1330651_1330852_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22901.1|1330969_1331812_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.9	4.3e-156
AYG22902.1|1331991_1332117_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	92.7	1.4e-15
AYG22903.1|1332380_1332941_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22904.1|1333168_1334011_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	97.9	3.1e-154
AYG24475.1|1334064_1334343_-	hypothetical protein	NA	Q6J1X3	Lactobacillus_phage	94.3	3.9e-29
AYG22905.1|1334556_1335024_+	DNA starvation/stationary phase protection protein	NA	A0A222Z0F3	Streptomyces_phage	29.2	1.6e-06
AYG22906.1|1335181_1335286_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYG22907.1|1335318_1335669_+	hypothetical protein	NA	NA	NA	NA	NA
AYG22908.1|1335963_1336332_+	YxeA family protein	NA	NA	NA	NA	NA
AYG22909.1|1336539_1338318_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AYG22910.1|1338434_1338746_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22911.1|1339061_1340846_-	helicase	NA	A0A2K5B253	Erysipelothrix_phage	35.0	3.1e-18
AYG22912.1|1340899_1341043_+	RepR protein	NA	NA	NA	NA	NA
AYG24476.1|1341112_1341229_+	DNA methyltransferase	NA	NA	NA	NA	NA
AYG22913.1|1342324_1342834_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22914.1|1344443_1345352_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
AYG22915.1|1347337_1349452_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.0	1.8e-118
AYG22916.1|1349458_1349560_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYG22917.1|1350484_1351690_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	44.2	1.6e-90
AYG22918.1|1351890_1352034_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AYG22919.1|1352240_1354778_-	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
AYG22920.1|1354764_1355013_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22921.1|1355051_1356296_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22922.1|1356288_1356726_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22923.1|1356715_1356970_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22924.1|1357010_1357190_-	plasmid replication protein	NA	NA	NA	NA	NA
AYG22925.1|1357211_1357412_+	hypothetical protein	NA	NA	NA	NA	NA
AYG22926.1|1357792_1358614_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22927.1|1358603_1359011_-	thioredoxin	NA	NA	NA	NA	NA
AYG22928.1|1359007_1359652_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22929.1|1359667_1360678_-	hydrolase	NA	A0A1X9SGZ2	Bradyrhizobium_phage	38.6	4.0e-15
AYG22930.1|1360679_1362608_-	ATP-binding protein	NA	NA	NA	NA	NA
AYG22931.1|1362588_1363185_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22932.1|1363168_1363504_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22933.1|1363509_1365567_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22934.1|1365563_1368020_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
AYG22935.1|1368046_1368625_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22936.1|1368633_1369053_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AYG22937.1|1369062_1370613_-	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
AYG22938.1|1370590_1371832_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22939.1|1371874_1372102_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22940.1|1372103_1372280_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22941.1|1372298_1372565_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22942.1|1372576_1372975_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22943.1|1373063_1373222_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22944.1|1373536_1374400_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	4.1e-24
AYG22945.1|1374445_1375387_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.2	4.0e-17
AYG22946.1|1375320_1376049_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	40.1	5.8e-32
AYG22947.1|1376078_1376411_-|transposase	transposase	transposase	NA	NA	NA	NA
AYG22948.1|1376423_1376534_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22949.1|1376530_1376866_-	ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	90.6	6.8e-52
AYG22950.1|1378398_1378617_+	CsbD family protein	NA	NA	NA	NA	NA
AYG22951.1|1378812_1379811_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.5	2.0e-54
AYG22952.1|1379773_1379992_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22953.1|1380455_1381376_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
AYG22954.1|1381741_1381939_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22955.1|1382283_1382727_-	transcriptional regulator	NA	A0A0P0IZI6	Lactobacillus_phage	97.3	1.2e-77
AYG22956.1|1383241_1383574_-	hypothetical protein	NA	NA	NA	NA	NA
AYG22957.1|1383582_1384503_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
>prophage 4
CP032637	Lactobacillus paracasei strain ZFM54 chromosome, complete genome	3015887	1834818	1883600	3015887	transposase,protease	Burkholderia_virus(20.0%)	53	NA	NA
AYG23344.1|1834818_1835739_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
AYG23345.1|1836817_1837684_-	DMT family transporter	NA	NA	NA	NA	NA
AYG23346.1|1837676_1838090_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AYG23347.1|1838376_1838754_-	hypothetical protein	NA	NA	NA	NA	NA
AYG23348.1|1838813_1838957_+	hypothetical protein	NA	NA	NA	NA	NA
AYG23349.1|1838949_1840008_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYG23350.1|1840011_1841019_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
AYG23351.1|1841020_1842400_-	aspartate kinase	NA	NA	NA	NA	NA
AYG23352.1|1843113_1844460_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
AYG23353.1|1844470_1845175_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
AYG23354.1|1845182_1846334_+	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
AYG23355.1|1846477_1847383_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AYG23356.1|1847379_1848147_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AYG23357.1|1848218_1848365_-	hypothetical protein	NA	NA	NA	NA	NA
AYG23358.1|1848626_1849871_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.0	1.3e-10
AYG23359.1|1850042_1850549_-	hypothetical protein	NA	NA	NA	NA	NA
AYG24493.1|1850573_1850768_-	hypothetical protein	NA	NA	NA	NA	NA
AYG23360.1|1851227_1851497_+	hypothetical protein	NA	NA	NA	NA	NA
AYG23361.1|1851493_1851859_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
AYG24494.1|1852389_1852623_-	hypothetical protein	NA	NA	NA	NA	NA
AYG23362.1|1852681_1853368_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.0	1.0e-25
AYG23363.1|1853364_1854279_+	ABC transporter	NA	NA	NA	NA	NA
AYG23364.1|1854283_1855516_+	ABC transporter	NA	NA	NA	NA	NA
AYG23365.1|1855715_1856438_+	hypothetical protein	NA	NA	NA	NA	NA
AYG23366.1|1856421_1856796_-	hypothetical protein	NA	NA	NA	NA	NA
AYG23367.1|1856917_1857496_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYG23368.1|1857654_1859481_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
AYG23369.1|1859612_1860752_-	hypothetical protein	NA	NA	NA	NA	NA
AYG24495.1|1861303_1861486_-	acetyltransferase	NA	NA	NA	NA	NA
AYG23370.1|1861473_1861581_+	anthranilate phosphoribosyltransferase	NA	NA	NA	NA	NA
AYG23371.1|1861577_1862603_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.3	6.0e-59
AYG23372.1|1862599_1863382_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	39.5	7.6e-38
AYG23373.1|1863409_1864075_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AYG23374.1|1863992_1865213_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AYG23375.1|1865205_1866000_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AYG23376.1|1866157_1866337_-	hypothetical protein	NA	NA	NA	NA	NA
AYG23377.1|1866613_1867273_-	transcriptional regulator flp	NA	NA	NA	NA	NA
AYG23378.1|1867421_1868006_-	DNA-binding protein	NA	NA	NA	NA	NA
AYG23379.1|1868153_1868381_-	copper chaperone	NA	NA	NA	NA	NA
AYG23380.1|1868400_1870257_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.0	1.1e-66
AYG23381.1|1870293_1870524_+	hypothetical protein	NA	NA	NA	NA	NA
AYG23382.1|1870601_1870823_+	hypothetical protein	NA	NA	NA	NA	NA
AYG23383.1|1870888_1871542_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYG23384.1|1872164_1873418_+	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	43.0	1.5e-14
AYG23385.1|1873420_1874050_+	ABC transporter permease	NA	NA	NA	NA	NA
AYG23386.1|1874061_1874991_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYG23387.1|1874990_1875653_+	ABC transporter permease	NA	NA	NA	NA	NA
AYG23388.1|1875866_1876127_+	hypothetical protein	NA	NA	NA	NA	NA
AYG23389.1|1876377_1876980_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYG23390.1|1876976_1880294_+	MMPL family transporter	NA	NA	NA	NA	NA
AYG23391.1|1880478_1881723_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	1.1e-11
AYG23392.1|1881972_1882869_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	36.3	6.7e-30
AYG23393.1|1882844_1883600_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	37.7	3.9e-31
>prophage 5
CP032637	Lactobacillus paracasei strain ZFM54 chromosome, complete genome	3015887	2476257	2524998	3015887	bacteriocin,transposase,protease	Bacillus_phage(40.0%)	58	NA	NA
AYG24518.1|2476257_2476491_+|bacteriocin	class IIb bacteriocin	bacteriocin	NA	NA	NA	NA
AYG23949.1|2476487_2476703_+|bacteriocin	class IIb bacteriocin	bacteriocin	NA	NA	NA	NA
AYG23950.1|2476838_2477147_+	hypothetical protein	NA	NA	NA	NA	NA
AYG23951.1|2477136_2477325_-	hypothetical protein	NA	NA	NA	NA	NA
AYG23952.1|2477417_2478014_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
AYG23953.1|2478132_2478468_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYG23954.1|2478780_2478972_+	hypothetical protein	NA	NA	NA	NA	NA
AYG23955.1|2479222_2479555_+	hypothetical protein	NA	NA	NA	NA	NA
AYG23956.1|2480067_2480913_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYG23957.1|2481277_2481448_+	hypothetical protein	NA	NA	NA	NA	NA
AYG23958.1|2481479_2481704_-	hypothetical protein	NA	NA	NA	NA	NA
AYG23959.1|2482025_2482199_+|bacteriocin	ComC/BlpC family peptide pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
AYG23960.1|2482228_2482411_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AYG23961.1|2482654_2482924_-	hypothetical protein	NA	NA	NA	NA	NA
AYG23962.1|2483359_2483557_+	hypothetical protein	NA	NA	NA	NA	NA
AYG24519.1|2483889_2484090_-	hypothetical protein	NA	NA	NA	NA	NA
AYG23963.1|2485169_2485349_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AYG23964.1|2485656_2485839_+	hypothetical protein	NA	NA	NA	NA	NA
AYG23965.1|2486015_2486438_+	hypothetical protein	NA	NA	NA	NA	NA
AYG23966.1|2486739_2487546_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYG23967.1|2487550_2488849_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
AYG23968.1|2489461_2491654_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	3.1e-36
AYG23969.1|2491664_2493044_+|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
AYG23970.1|2493217_2493568_+	hypothetical protein	NA	NA	NA	NA	NA
AYG23971.1|2493658_2493952_+	hypothetical protein	NA	NA	NA	NA	NA
AYG23972.1|2494257_2495613_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
AYG23973.1|2495717_2496014_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYG23974.1|2496206_2496491_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYG23975.1|2496514_2496793_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYG23976.1|2496837_2497626_-	hypothetical protein	NA	NA	NA	NA	NA
AYG23977.1|2497678_2498467_-	hypothetical protein	NA	NA	NA	NA	NA
AYG23978.1|2498463_2498793_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AYG23979.1|2498928_2499576_-	XRE family transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	37.5	1.7e-06
AYG23980.1|2499662_2499881_-	hypothetical protein	NA	NA	NA	NA	NA
AYG23981.1|2499846_2500902_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
AYG23982.1|2501110_2502307_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
AYG23983.1|2502401_2502959_+	hypothetical protein	NA	NA	NA	NA	NA
AYG23984.1|2503236_2506242_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AYG23985.1|2506243_2507566_+	pilus assembly protein	NA	NA	NA	NA	NA
AYG23986.1|2507562_2509122_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
AYG23987.1|2509128_2509956_+	class C sortase	NA	NA	NA	NA	NA
AYG24520.1|2509928_2510183_-	hypothetical protein	NA	NA	NA	NA	NA
AYG23988.1|2510544_2511768_+	hypothetical protein	NA	NA	NA	NA	NA
AYG23989.1|2511956_2512493_+	hypothetical protein	NA	NA	NA	NA	NA
AYG23990.1|2512746_2512941_+	hypothetical protein	NA	NA	NA	NA	NA
AYG23991.1|2513257_2514091_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	9.6e-47
AYG23992.1|2514179_2515436_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	56.8	7.3e-99
AYG24521.1|2515514_2516747_-	MFS transporter	NA	NA	NA	NA	NA
AYG23993.1|2516771_2516948_-	hypothetical protein	NA	NA	NA	NA	NA
AYG23994.1|2517074_2517326_+	hypothetical protein	NA	NA	NA	NA	NA
AYG23995.1|2517550_2517757_+	hypothetical protein	NA	NA	NA	NA	NA
AYG23996.1|2517827_2518085_+	hypothetical protein	NA	NA	NA	NA	NA
AYG23997.1|2518217_2518424_+	CsbD family protein	NA	NA	NA	NA	NA
AYG23998.1|2519916_2520201_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
AYG23999.1|2520214_2521336_-	bacitracin ABC transporter permease	NA	NA	NA	NA	NA
AYG24000.1|2521847_2522519_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AYG24001.1|2523018_2523642_+	CBS domain-containing protein	NA	NA	NA	NA	NA
AYG24002.1|2523753_2524998_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	1.1e-11
>prophage 6
CP032637	Lactobacillus paracasei strain ZFM54 chromosome, complete genome	3015887	2779722	2841000	3015887	transposase,integrase	Listeria_phage(18.18%)	60	2778848:2778867	2780758:2780777
2778848:2778867	attL	AACCTTATCGCTGCAACTCA	NA	NA	NA	NA
AYG24229.1|2779722_2780649_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	48.7	4.7e-79
AYG24230.1|2780696_2781890_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
2780758:2780777	attR	TGAGTTGCAGCGATAAGGTT	NA	NA	NA	NA
AYG24231.1|2781951_2784087_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AYG24232.1|2784134_2784941_+	hypothetical protein	NA	NA	NA	NA	NA
AYG24233.1|2785943_2786756_+	sugar kinase	NA	NA	NA	NA	NA
AYG24234.1|2787374_2787980_-	hypothetical protein	NA	NA	NA	NA	NA
AYG24235.1|2788405_2788996_+	hypothetical protein	NA	NA	NA	NA	NA
AYG24236.1|2789036_2791619_+	ATP-dependent endonuclease	NA	U5J9B0	Bacillus_phage	25.4	1.2e-50
AYG24237.1|2791964_2792711_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
AYG24238.1|2792982_2793726_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
AYG24239.1|2793788_2796011_-	alpha-galactosidase	NA	NA	NA	NA	NA
AYG24240.1|2796300_2796564_-	hypothetical protein	NA	NA	NA	NA	NA
AYG24241.1|2796813_2798238_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AYG24242.1|2798234_2798441_+	hypothetical protein	NA	NA	NA	NA	NA
AYG24243.1|2798412_2798823_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
AYG24244.1|2798932_2800033_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
AYG24245.1|2800089_2800425_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AYG24246.1|2800677_2801244_-	hypothetical protein	NA	NA	NA	NA	NA
AYG24247.1|2801382_2801490_+	hypothetical protein	NA	NA	NA	NA	NA
AYG24248.1|2801714_2802497_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
AYG24249.1|2802493_2803978_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
AYG24250.1|2803970_2804678_+	lactate utilization protein C	NA	NA	NA	NA	NA
AYG24536.1|2805155_2805347_+	hypothetical protein	NA	NA	NA	NA	NA
AYG24251.1|2805897_2806461_+	elongation factor P	NA	NA	NA	NA	NA
AYG24537.1|2806694_2808119_+	MFS transporter	NA	NA	NA	NA	NA
AYG24252.1|2808550_2810173_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYG24253.1|2810347_2811271_+	ABC transporter permease	NA	NA	NA	NA	NA
AYG24254.1|2811270_2812269_+	ABC transporter permease	NA	NA	NA	NA	NA
AYG24255.1|2812280_2813333_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	4.3e-20
AYG24256.1|2813334_2814312_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	34.1	5.8e-11
AYG24257.1|2814530_2814728_+	hypothetical protein	NA	NA	NA	NA	NA
AYG24258.1|2814702_2815056_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AYG24259.1|2815156_2816659_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
AYG24260.1|2816930_2817569_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AYG24261.1|2817827_2818139_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYG24262.1|2818233_2818425_-	hypothetical protein	NA	NA	NA	NA	NA
AYG24263.1|2818423_2818648_+	DUF2829 domain-containing protein	NA	A8AT88	Listeria_phage	33.3	3.1e-08
AYG24264.1|2818644_2819358_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AYG24265.1|2819469_2819970_+	QueT transporter family protein	NA	NA	NA	NA	NA
AYG24266.1|2820252_2820972_-	acyltransferase	NA	NA	NA	NA	NA
AYG24267.1|2821331_2822261_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
AYG24268.1|2822275_2823034_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
AYG24269.1|2823171_2824353_+	DUF1972 domain-containing protein	NA	NA	NA	NA	NA
AYG24270.1|2824339_2825497_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AYG24271.1|2825620_2826595_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AYG24272.1|2826632_2827892_+	hypothetical protein	NA	NA	NA	NA	NA
AYG24273.1|2828671_2828923_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
AYG24274.1|2828976_2829819_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.9	8.8e-157
AYG24275.1|2830419_2831193_+	mannosyltransferase	NA	NA	NA	NA	NA
AYG24276.1|2831960_2833397_+	flippase	NA	NA	NA	NA	NA
AYG24277.1|2833423_2834290_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AYG24278.1|2834435_2835104_+	sugar transferase	NA	NA	NA	NA	NA
AYG24279.1|2835301_2836174_+	glucose-1-phosphate thymidylyltransferase	NA	K7QKA7	Escherichia_phage	58.9	1.5e-98
AYG24280.1|2836185_2836758_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	43.0	3.2e-33
AYG24281.1|2836760_2837786_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.4	1.5e-70
AYG24282.1|2837860_2838703_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.1	4.7e-33
AYG24283.1|2838872_2839070_+	hypothetical protein	NA	NA	NA	NA	NA
AYG24284.1|2839044_2839308_+|transposase	transposase	transposase	NA	NA	NA	NA
AYG24285.1|2839268_2839397_+	hypothetical protein	NA	NA	NA	NA	NA
AYG24286.1|2839497_2841000_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
