The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032618	Pseudomonas fluorescens strain PF08 chromosome, complete genome	6030573	965834	975346	6030573		Pseudomonas_phage(75.0%)	11	NA	NA
AYG10741.1|965834_966248_-	hypothetical protein	NA	K7PLY8	Enterobacterial_phage	33.3	9.6e-08
AYG06323.1|967131_967446_-	hypothetical protein	NA	A0A1B0VML7	Pseudomonas_phage	82.7	7.0e-43
AYG06324.1|967801_969595_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	91.8	0.0e+00
AYG06325.1|969581_970463_-	toprim domain-containing protein	NA	A0A1B0VML8	Pseudomonas_phage	92.2	3.0e-147
AYG06326.1|970459_970687_-	hypothetical protein	NA	A0A1B0VRK9	Pseudomonas_phage	88.0	1.7e-30
AYG06327.1|970679_970967_-	hypothetical protein	NA	A0A1B0VMJ4	Pseudomonas_phage	80.6	2.2e-35
AYG06328.1|971847_972321_-	hypothetical protein	NA	A0A1B0VMK9	Pseudomonas_phage	80.1	2.9e-64
AYG06329.1|972317_972617_-	hypothetical protein	NA	NA	NA	NA	NA
AYG06330.1|972616_972877_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AYG06331.1|973038_974016_-	hypothetical protein	NA	NA	NA	NA	NA
AYG06332.1|974107_975346_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	40.6	5.7e-80
>prophage 2
CP032618	Pseudomonas fluorescens strain PF08 chromosome, complete genome	6030573	1281111	1380232	6030573	tRNA,terminase,integrase,protease,tail,coat,head	Pseudomonas_phage(40.32%)	113	1272247:1272272	1362618:1362643
1272247:1272272	attL	CCAATGTGGGAGCGGGCTTGCCCGCG	NA	NA	NA	NA
AYG06614.1|1281111_1282215_-|integrase	integrase	integrase	A0A0U4JIT5	Pseudomonas_phage	67.8	1.5e-143
AYG06615.1|1282195_1282438_-	excisionase	NA	NA	NA	NA	NA
AYG06616.1|1282756_1283524_+	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	27.9	3.0e-18
AYG06617.1|1283550_1284474_-	DNA cytosine methyltransferase	NA	A0A142KB20	Gordonia_phage	34.1	3.8e-20
AYG06618.1|1284546_1284780_+	hypothetical protein	NA	A0A1B0VP27	Pseudomonas_phage	94.4	7.0e-32
AYG06619.1|1284852_1285707_+	hypothetical protein	NA	NA	NA	NA	NA
AYG06620.1|1285670_1286534_-	hypothetical protein	NA	A0A2H4J418	uncultured_Caudovirales_phage	55.5	4.4e-87
AYG06621.1|1286631_1286862_+	hypothetical protein	NA	NA	NA	NA	NA
AYG06622.1|1286858_1287881_-	nucleoid-associated protein YejK	NA	L7TI92	Pseudomonas_virus	63.9	5.0e-122
AYG06623.1|1288196_1288682_-	hypothetical protein	NA	A0A1B0VMB5	Pseudomonas_phage	86.2	3.2e-71
AYG06624.1|1288766_1289429_-	exonuclease	NA	A0A0U2BXF3	Paracoccus_phage	38.3	5.8e-31
AYG06625.1|1289428_1290418_-	hypothetical protein	NA	A0A193GYL3	Enterobacter_phage	57.7	4.9e-66
AYG10750.1|1290471_1291575_-	hypothetical protein	NA	NA	NA	NA	NA
AYG06626.1|1291686_1291914_-	hypothetical protein	NA	NA	NA	NA	NA
AYG06627.1|1291910_1292141_-	hypothetical protein	NA	NA	NA	NA	NA
AYG06628.1|1292118_1292385_-	hypothetical protein	NA	A0A2H4J404	uncultured_Caudovirales_phage	50.6	6.4e-13
AYG06629.1|1292929_1293130_-	hypothetical protein	NA	NA	NA	NA	NA
AYG06630.1|1293618_1293930_+	DUF1654 domain-containing protein	NA	A0A2D1GND3	Pseudomonas_phage	93.2	3.6e-31
AYG06631.1|1294315_1295188_-	hypothetical protein	NA	NA	NA	NA	NA
AYG06632.1|1295197_1295437_-	hypothetical protein	NA	NA	NA	NA	NA
AYG06633.1|1295441_1296302_-	S24 family peptidase	NA	A0A2D1GNH0	Pseudomonas_phage	89.9	9.9e-148
AYG06634.1|1296397_1296652_+	transcriptional regulator	NA	A0A2D1GND2	Pseudomonas_phage	88.1	2.8e-34
AYG06635.1|1296702_1297320_+	hypothetical protein	NA	NA	NA	NA	NA
AYG06636.1|1297465_1298320_+	Rha family transcriptional regulator	NA	A0A2H4J111	uncultured_Caudovirales_phage	70.7	2.6e-55
AYG06637.1|1298319_1299270_+	hypothetical protein	NA	A0A125RNK1	Pseudomonas_phage	59.3	6.7e-28
AYG06638.1|1299250_1300033_+	AAA family ATPase	NA	A0A059VK34	Pseudomonas_phage	43.8	5.6e-57
AYG06639.1|1300032_1300362_+	hypothetical protein	NA	NA	NA	NA	NA
AYG06640.1|1300354_1300942_+	DUF1367 family protein	NA	Q9MC49	Pseudomonas_phage	82.1	5.3e-92
AYG06641.1|1300938_1301613_+	hypothetical protein	NA	A0A1B0VME4	Pseudomonas_phage	74.7	8.8e-83
AYG06642.1|1301609_1302287_+	hypothetical protein	NA	NA	NA	NA	NA
AYG06643.1|1302658_1302859_-	hypothetical protein	NA	NA	NA	NA	NA
AYG06644.1|1302891_1303527_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A2H4JFV9	uncultured_Caudovirales_phage	40.6	8.1e-22
AYG06645.1|1303578_1303758_-	type II toxin-antitoxin system HicA family toxin	NA	A0A2H4JDU5	uncultured_Caudovirales_phage	50.0	9.3e-08
AYG06646.1|1303845_1304217_+	chemotaxis protein	NA	A0A059VK40	Pseudomonas_phage	67.8	2.8e-38
AYG06647.1|1304216_1304534_+	hypothetical protein	NA	A0A059VJW1	Pseudomonas_phage	53.5	2.8e-15
AYG06648.1|1304587_1304803_+	hypothetical protein	NA	NA	NA	NA	NA
AYG06649.1|1304799_1304991_+	hypothetical protein	NA	NA	NA	NA	NA
AYG06650.1|1304987_1305242_+	hypothetical protein	NA	NA	NA	NA	NA
AYG06651.1|1305273_1305483_-	hypothetical protein	NA	NA	NA	NA	NA
AYG06652.1|1305572_1306172_+	hypothetical protein	NA	A0A2H4J2I6	uncultured_Caudovirales_phage	40.5	1.1e-23
AYG06653.1|1306173_1307664_+|terminase	terminase	terminase	A0A2H4J2I1	uncultured_Caudovirales_phage	89.9	1.3e-272
AYG06654.1|1307663_1309124_+	DUF4055 domain-containing protein	NA	A0A2H4J0H4	uncultured_Caudovirales_phage	80.8	6.7e-229
AYG06655.1|1309107_1310154_+|head	phage head morphogenesis protein	head	A0A2H4J3G9	uncultured_Caudovirales_phage	70.1	2.4e-132
AYG06656.1|1310162_1310645_+	hypothetical protein	NA	A0A1B0VND3	Pseudomonas_phage	34.5	2.2e-19
AYG06657.1|1310712_1311351_+	hypothetical protein	NA	NA	NA	NA	NA
AYG10751.1|1311459_1312197_+	hypothetical protein	NA	A0A2H4J0I7	uncultured_Caudovirales_phage	65.8	5.8e-80
AYG06658.1|1312200_1313178_+|coat	phage coat protein	coat	A0A2H4JIE6	uncultured_Caudovirales_phage	82.5	4.7e-154
AYG06659.1|1313234_1313540_+	hypothetical protein	NA	A0A2H4J0G3	uncultured_Caudovirales_phage	45.5	2.3e-22
AYG06660.1|1313550_1313928_+	hypothetical protein	NA	A0A2H4J0N2	uncultured_Caudovirales_phage	76.0	8.4e-43
AYG06661.1|1313930_1314323_+	hypothetical protein	NA	A0A2H4IZB5	uncultured_Caudovirales_phage	68.5	3.0e-43
AYG06662.1|1314324_1314909_+	hypothetical protein	NA	A0A1B0VMI1	Pseudomonas_phage	54.5	1.1e-52
AYG06663.1|1314905_1315322_+	hypothetical protein	NA	A0A1B0VMI0	Pseudomonas_phage	91.3	5.1e-65
AYG06664.1|1315394_1316051_+|tail	phage tail protein	tail	A0A1S5R1H0	Pseudomonas_phage	48.4	1.2e-49
AYG06665.1|1316054_1316435_+	hypothetical protein	NA	A0A2H4IYQ5	uncultured_Caudovirales_phage	49.6	1.9e-26
AYG06666.1|1316452_1316755_+	hypothetical protein	NA	A0A1B0VMG9	Pseudomonas_phage	56.2	3.5e-23
AYG06667.1|1316782_1319827_+|tail	phage tail tape measure protein	tail	A0A1B0VMG8	Pseudomonas_phage	40.4	1.0e-175
AYG06668.1|1319830_1320169_+|tail	phage tail protein	tail	A0A1B0VMG7	Pseudomonas_phage	81.2	1.2e-51
AYG06669.1|1320180_1320933_+|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	92.4	3.3e-139
AYG06670.1|1320935_1321700_+|tail	phage tail protein	tail	A0A1B0VP68	Pseudomonas_phage	87.6	4.8e-138
AYG06671.1|1321843_1322107_-	hypothetical protein	NA	NA	NA	NA	NA
AYG06672.1|1322187_1322448_-	protein L	NA	NA	NA	NA	NA
AYG06673.1|1322710_1323388_+	hypothetical protein	NA	NA	NA	NA	NA
AYG06674.1|1323485_1323836_+	hypothetical protein	NA	NA	NA	NA	NA
AYG06675.1|1323899_1324511_+|tail	tail assembly protein	tail	A0A1B0VMI5	Pseudomonas_phage	77.8	5.7e-81
AYG10752.1|1327612_1329640_+	DUF1983 domain-containing protein	NA	A0A1B0VMH5	Pseudomonas_phage	82.0	9.4e-56
AYG06676.1|1329730_1330126_+	hypothetical protein	NA	NA	NA	NA	NA
AYG06677.1|1330127_1330853_+	hypothetical protein	NA	NA	NA	NA	NA
AYG06678.1|1331652_1332201_+|tail	phage tail protein	tail	A0A2H4J9Z7	uncultured_Caudovirales_phage	61.2	2.2e-15
AYG06679.1|1332272_1332485_+	hypothetical protein	NA	NA	NA	NA	NA
AYG06680.1|1332966_1333488_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AYG06681.1|1334352_1335045_-	DUF159 family protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	88.4	8.3e-121
AYG06682.1|1335067_1335415_-	hypothetical protein	NA	A0A2H4IZV2	uncultured_Caudovirales_phage	42.2	1.2e-11
AYG06683.1|1335512_1335719_-	hypothetical protein	NA	A0A2D1GNR5	Pseudomonas_phage	56.7	1.0e-10
AYG06684.1|1336213_1337857_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
AYG06685.1|1337937_1339137_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
AYG06686.1|1339283_1341986_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
AYG06687.1|1342053_1342836_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
AYG06688.1|1343222_1343963_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
AYG06689.1|1344156_1345020_+	elongation factor Ts	NA	NA	NA	NA	NA
AYG06690.1|1345231_1345975_+	UMP kinase	NA	NA	NA	NA	NA
AYG06691.1|1345971_1346529_+	ribosome recycling factor	NA	NA	NA	NA	NA
AYG06692.1|1346546_1347302_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	37.3	1.4e-17
AYG06693.1|1347301_1348108_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AYG06694.1|1348104_1349295_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AYG06695.1|1349330_1350683_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
AYG06696.1|1350757_1353145_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AYG06697.1|1353190_1353694_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
AYG06698.1|1353697_1354753_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AYG06699.1|1354863_1355304_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AYG06700.1|1355300_1356077_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AYG06701.1|1356079_1357219_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AYG06702.1|1357215_1357848_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.9	4.4e-28
AYG06703.1|1357925_1361447_+	DNA polymerase III subunit alpha	NA	A0A1C9LWZ5	Streptomyces_phage	36.5	5.1e-198
AYG06704.1|1361586_1362534_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
AYG06705.1|1362690_1364010_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1J0F9X6	Only_Syngen_Nebraska_virus	24.5	1.7e-05
1362618:1362643	attR	CGCGGGCAAGCCCGCTCCCACATTGG	NA	NA	NA	NA
AYG06706.1|1364283_1365915_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.1	1.2e-157
AYG06707.1|1365920_1366766_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.8	9.4e-50
AYG06708.1|1366922_1368212_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.7	7.4e-139
AYG06709.1|1368383_1368662_+	cell division protein FtsB	NA	NA	NA	NA	NA
AYG06710.1|1368658_1369366_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYG06711.1|1369493_1370390_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYG06712.1|1370499_1371612_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.1	5.6e-34
AYG06713.1|1371620_1372466_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AYG06714.1|1372520_1372994_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
AYG06715.1|1372990_1374049_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
AYG06716.1|1374036_1374786_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.4	9.1e-65
AYG06717.1|1374785_1375463_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	53.1	3.1e-43
AYG06718.1|1375674_1376508_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	33.3	8.2e-06
AYG06719.1|1376613_1377618_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	36.2	1.3e-34
AYG06720.1|1377807_1378017_-	cold-shock protein CapB	NA	Q9AZD3	Lactococcus_phage	66.7	2.2e-16
AYG06721.1|1378409_1378976_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	74.2	3.3e-75
AYG06722.1|1379083_1379281_+	hypothetical protein	NA	NA	NA	NA	NA
AYG06723.1|1379467_1380232_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.0	1.6e-16
>prophage 3
CP032618	Pseudomonas fluorescens strain PF08 chromosome, complete genome	6030573	1503761	1580093	6030573	terminase,capsid,lysis,protease	Pseudomonas_phage(33.33%)	81	NA	NA
AYG06832.1|1503761_1504262_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.0	2.0e-23
AYG06833.1|1504358_1504769_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	52.3	3.0e-33
AYG06834.1|1504791_1504974_-	addiction module toxin, HicA family	NA	A0A0D4DC32	Acinetobacter_phage	73.7	4.7e-15
AYG06835.1|1505354_1505585_-	hypothetical protein	NA	A0A2H4J5U9	uncultured_Caudovirales_phage	81.6	5.7e-26
AYG06836.1|1506041_1506296_-	hypothetical protein	NA	NA	NA	NA	NA
AYG06837.1|1506292_1506940_-	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	44.8	4.4e-39
AYG06838.1|1506939_1507245_-	hypothetical protein	NA	A0A2H4J405	uncultured_Caudovirales_phage	83.5	2.7e-31
AYG06839.1|1507818_1508430_-	3'-5' exonuclease	NA	A0A2H4J7C9	uncultured_Caudovirales_phage	92.1	5.5e-108
AYG06840.1|1508906_1509086_+	hypothetical protein	NA	NA	NA	NA	NA
AYG06841.1|1509320_1510388_-	DNA translocase FtsK	NA	A0A2H4J7E6	uncultured_Caudovirales_phage	53.8	9.6e-92
AYG06842.1|1510397_1510598_-	hypothetical protein	NA	A0A2H4J6K7	uncultured_Caudovirales_phage	83.3	1.3e-23
AYG06843.1|1510600_1512244_-	Heme peroxidase	NA	A0A2H4J6P1	uncultured_Caudovirales_phage	66.2	6.1e-154
AYG06844.1|1512230_1512992_-	hypothetical protein	NA	A0A2H4J6I3	uncultured_Caudovirales_phage	67.9	2.2e-90
AYG10754.1|1513045_1513231_-	hypothetical protein	NA	NA	NA	NA	NA
AYG06845.1|1513625_1513919_-	hypothetical protein	NA	NA	NA	NA	NA
AYG06846.1|1514046_1514277_-	hypothetical protein	NA	NA	NA	NA	NA
AYG06847.1|1514273_1514546_-	hypothetical protein	NA	A0A2H4J6R2	uncultured_Caudovirales_phage	51.5	1.4e-15
AYG06848.1|1514535_1514946_-	hypothetical protein	NA	NA	NA	NA	NA
AYG06849.1|1515206_1515560_-	hypothetical protein	NA	NA	NA	NA	NA
AYG06850.1|1515600_1516317_-	helix-turn-helix transcriptional regulator	NA	A0A0S2SYF7	Pseudomonas_phage	45.6	5.5e-59
AYG06851.1|1516406_1516595_+	Cro/Cl family transcriptional regulator	NA	A0A0S2SYB8	Pseudomonas_phage	50.9	1.8e-09
AYG06852.1|1516597_1516912_+	transcriptional regulator	NA	NA	NA	NA	NA
AYG06853.1|1516914_1517850_+	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	75.1	1.4e-78
AYG06854.1|1518488_1518824_+	hypothetical protein	NA	A0A0U4B0K0	Pseudomonas_phage	54.8	3.9e-07
AYG06855.1|1518820_1519255_+	RusA family crossover junction endodeoxyribonuclease	NA	H2BD71	Pseudomonas_phage	60.6	1.3e-42
AYG06856.1|1519295_1519925_+	hypothetical protein	NA	A0A0S2SYA9	Pseudomonas_phage	36.4	1.8e-34
AYG06857.1|1519996_1520935_+	hypothetical protein	NA	Q5QF73	Pseudomonas_virus	56.2	1.6e-18
AYG06858.1|1521193_1521478_+	Holin	NA	A0A0U1UNM6	Pseudomonas_phage	51.8	2.8e-14
AYG06859.1|1521474_1521993_+	lysozyme	NA	I6X6V3	Burkholderia_virus	64.3	2.6e-58
AYG06860.1|1521989_1522457_+|lysis	lysis protein	lysis	A0A0H5AUG6	Pseudomonas_phage	31.1	1.3e-05
AYG06861.1|1522461_1522998_+|terminase	terminase small subunit	terminase	A0A1W6JNT5	Morganella_phage	57.5	9.5e-48
AYG06862.1|1522975_1524487_+|terminase	terminase	terminase	K4NWT7	Pseudomonas_phage	67.5	2.7e-196
AYG06863.1|1524488_1524839_+	hypothetical protein	NA	NA	NA	NA	NA
AYG06864.1|1524801_1526535_+	hypothetical protein	NA	K4NWH1	Pseudomonas_phage	45.8	1.3e-141
AYG06865.1|1526534_1526837_+	hypothetical protein	NA	Q858H0	Salmonella_phage	38.0	1.7e-06
AYG06866.1|1526833_1527559_+	hypothetical protein	NA	T1SAP9	Salmonella_phage	39.3	6.0e-21
AYG06867.1|1527588_1528584_+|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	63.7	2.3e-124
AYG06868.1|1528621_1529014_+	hypothetical protein	NA	T1SA71	Salmonella_phage	72.3	3.6e-44
AYG06869.1|1529006_1529378_+	hypothetical protein	NA	NA	NA	NA	NA
AYG06870.1|1529437_1530037_+	hypothetical protein	NA	G9L6C9	Escherichia_phage	41.5	2.2e-37
AYG06871.1|1530033_1532376_+	hypothetical protein	NA	K4NWU8	Pseudomonas_phage	47.9	4.2e-209
AYG06872.1|1532362_1532830_+	hypothetical protein	NA	A0A2R2ZGD5	Ralstonia_phage	38.9	3.9e-21
AYG06873.1|1532832_1533384_+	hypothetical protein	NA	K4NYZ0	Pseudomonas_phage	54.8	7.0e-22
AYG06874.1|1533394_1535497_+	hypothetical protein	NA	K4NWI2	Pseudomonas_phage	34.2	4.4e-88
AYG06875.1|1535493_1541613_+	hypothetical protein	NA	K4NZ44	Pseudomonas_phage	36.0	7.9e-207
AYG06876.1|1541685_1543473_+	hypothetical protein	NA	A0A0F6TJC8	Escherichia_coli_O157_typing_phage	37.9	3.3e-28
AYG06877.1|1543494_1545465_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	38.6	2.1e-60
AYG06878.1|1546910_1548170_-	DUF4102 domain-containing protein	NA	A0A2H4JAT5	uncultured_Caudovirales_phage	93.5	1.5e-229
AYG06879.1|1548566_1549451_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYG06880.1|1549746_1550439_-	pseudouridine synthase	NA	NA	NA	NA	NA
AYG06881.1|1550438_1550651_-	helicase	NA	NA	NA	NA	NA
AYG06882.1|1550868_1551228_+	hypothetical protein	NA	NA	NA	NA	NA
AYG06883.1|1551373_1551802_+	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
AYG06884.1|1551824_1552937_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
AYG06885.1|1553071_1553764_+	uracil-DNA glycosylase	NA	S4VYQ4	Pandoravirus	46.1	3.6e-55
AYG06886.1|1553862_1554900_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AYG06887.1|1554892_1556407_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
AYG06888.1|1556408_1556867_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
AYG06889.1|1556927_1557911_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
AYG06890.1|1557955_1559248_-	OprD family porin	NA	NA	NA	NA	NA
AYG06891.1|1559495_1560167_+	response regulator	NA	NA	NA	NA	NA
AYG06892.1|1560159_1561545_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.7	4.8e-19
AYG06893.1|1561569_1562391_-	HDOD domain-containing protein	NA	A0A1C3NFB0	Phage_NCTB	32.4	4.4e-28
AYG06894.1|1562427_1563369_-	folate-binding protein	NA	NA	NA	NA	NA
AYG06895.1|1563506_1563761_+	succinate dehydrogenase assembly factor 2 family protein	NA	NA	NA	NA	NA
AYG06896.1|1563744_1564197_+	hypothetical protein	NA	NA	NA	NA	NA
AYG06897.1|1564165_1565782_-	L-aspartate oxidase	NA	NA	NA	NA	NA
AYG06898.1|1566250_1566832_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	23.5	6.3e-05
AYG06899.1|1566864_1567452_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AYG06900.1|1567468_1568425_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AYG06901.1|1568665_1570102_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.6	6.5e-27
AYG06902.1|1570175_1571609_-	M48 family peptidase	NA	NA	NA	NA	NA
AYG06903.1|1571704_1571944_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
AYG06904.1|1572061_1572535_-	peroxiredoxin	NA	NA	NA	NA	NA
AYG06905.1|1572546_1573107_-	glycine cleavage system protein R	NA	NA	NA	NA	NA
AYG06906.1|1573367_1574246_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AYG06907.1|1574263_1575379_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
AYG06908.1|1575383_1576142_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYG06909.1|1576170_1576884_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	37.6	3.9e-41
AYG06910.1|1577299_1579063_+	hypothetical protein	NA	NA	NA	NA	NA
AYG06911.1|1579538_1580093_+|lysis	lysis protein	lysis	B5TK84	Pseudomonas_phage	53.4	2.9e-39
>prophage 4
CP032618	Pseudomonas fluorescens strain PF08 chromosome, complete genome	6030573	2571216	2617873	6030573	plate,terminase,integrase,holin,tail,head	uncultured_Caudovirales_phage(25.53%)	68	2571153:2571171	2617366:2617384
2571153:2571171	attL	TGGGACAATCCTGGGACAC	NA	NA	NA	NA
AYG10784.1|2571216_2572194_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	64.3	5.8e-112
AYG10785.1|2572190_2572436_-	hypothetical protein	NA	W6MVE5	Pseudomonas_phage	64.2	9.7e-24
AYG07711.1|2572438_2572744_-	hypothetical protein	NA	NA	NA	NA	NA
AYG07712.1|2572743_2573055_-	hypothetical protein	NA	NA	NA	NA	NA
AYG07713.1|2573197_2573677_-	hypothetical protein	NA	NA	NA	NA	NA
AYG07714.1|2573673_2573853_-	hypothetical protein	NA	NA	NA	NA	NA
AYG07715.1|2573839_2574034_-	hypothetical protein	NA	NA	NA	NA	NA
AYG07716.1|2574071_2574452_-	hypothetical protein	NA	NA	NA	NA	NA
AYG07717.1|2574899_2575190_-	hypothetical protein	NA	A0A0S2SY28	Pseudomonas_phage	62.1	2.5e-26
AYG07718.1|2575236_2575581_-	hypothetical protein	NA	A0A1B0VN82	Pseudomonas_phage	36.4	3.1e-12
AYG07719.1|2576147_2576528_-	hypothetical protein	NA	A0A1B0VMC7	Pseudomonas_phage	59.0	1.3e-19
AYG07720.1|2576700_2577453_-	DNA cytosine methyltransferase	NA	W0LM09	Edwardsiella_phage	62.1	2.9e-66
AYG07721.1|2577511_2577835_-	hypothetical protein	NA	A0A2H4JAQ1	uncultured_Caudovirales_phage	55.9	1.5e-19
AYG07722.1|2577904_2578498_-	hypothetical protein	NA	A0A1B0VMB1	Pseudomonas_phage	67.0	5.5e-65
AYG07723.1|2578494_2580123_-	Heme peroxidase	NA	A0A2H4J6P1	uncultured_Caudovirales_phage	70.5	3.0e-201
AYG10786.1|2580119_2580926_-	phage recombination protein Bet	NA	U6C6J0	Ralstonia_phage	53.8	4.9e-72
AYG07724.1|2581099_2581456_-	hypothetical protein	NA	H2BD40	Pseudomonas_phage	61.6	1.6e-35
AYG07725.1|2581586_2581820_-	hypothetical protein	NA	NA	NA	NA	NA
AYG07726.1|2581816_2582092_-	hypothetical protein	NA	A0A2H4J6R2	uncultured_Caudovirales_phage	49.5	3.9e-13
AYG07727.1|2582113_2582374_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
AYG07728.1|2582395_2582635_-	hypothetical protein	NA	NA	NA	NA	NA
AYG07729.1|2583337_2583796_-	hypothetical protein	NA	A0A1B0VRI5	Pseudomonas_phage	75.0	6.2e-64
AYG07730.1|2584021_2584309_-	hypothetical protein	NA	NA	NA	NA	NA
AYG07731.1|2584775_2585435_-	LexA family transcriptional regulator	NA	H2BDH4	Pseudomonas_virus	58.6	4.7e-73
AYG07732.1|2585534_2585738_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYG07733.1|2585769_2585958_+	hypothetical protein	NA	B5WZX7	Pseudomonas_phage	43.5	1.1e-06
AYG07734.1|2585976_2586165_+	hypothetical protein	NA	NA	NA	NA	NA
AYG07735.1|2586292_2587096_+	KilA-N domain-containing protein	NA	I6R9D7	Salmonella_phage	49.6	3.8e-24
AYG07736.1|2587098_2587407_+	hypothetical protein	NA	A0A2H4J5Q4	uncultured_Caudovirales_phage	38.3	1.9e-08
AYG07737.1|2587403_2588108_+	helix-turn-helix domain-containing protein	NA	A0A0P0ZC04	Stx2-converting_phage	66.4	1.5e-37
AYG07738.1|2588104_2588845_+	Replication protein P	NA	A0A2H4J1T4	uncultured_Caudovirales_phage	70.9	7.4e-83
AYG07739.1|2588841_2589024_+	hypothetical protein	NA	NA	NA	NA	NA
AYG07740.1|2589020_2589806_+	hypothetical protein	NA	A0A2H4J7V6	uncultured_Caudovirales_phage	51.9	5.2e-10
AYG07741.1|2589802_2590045_+	hypothetical protein	NA	NA	NA	NA	NA
AYG07742.1|2590041_2590458_+	NinB family protein	NA	A0A2H4J1T9	uncultured_Caudovirales_phage	94.2	3.3e-72
AYG07743.1|2590852_2591128_+	hypothetical protein	NA	H2BDI5	Pseudomonas_virus	45.6	9.3e-07
AYG07744.1|2591243_2591870_+	ninG protein	NA	A0A2H4JGI2	uncultured_Caudovirales_phage	82.1	4.5e-81
AYG07745.1|2591866_2592532_+	hypothetical protein	NA	A0A2H4J9G7	uncultured_Caudovirales_phage	60.2	2.1e-65
AYG07746.1|2593127_2593460_+|holin	phage holin, lambda family	holin	A0A2H4J1U5	uncultured_Caudovirales_phage	100.0	5.3e-57
AYG07747.1|2593512_2594925_+	DUF1073 domain-containing protein	NA	A0A1I9SES0	Klebsiella_phage	47.8	2.1e-110
AYG10787.1|2594992_2595781_+|head	phage head morphogenesis protein	head	A0A2I7QN95	Vibrio_phage	46.3	3.9e-58
AYG07748.1|2595785_2596889_+	DUF2213 domain-containing protein	NA	H9C0E3	Vibrio_phage	40.6	3.3e-55
AYG07749.1|2596888_2597398_+	hypothetical protein	NA	NA	NA	NA	NA
AYG07750.1|2597410_2598388_+	DUF2184 domain-containing protein	NA	A0A2I7QN78	Vibrio_phage	32.2	1.2e-32
AYG07751.1|2598397_2598742_+	hypothetical protein	NA	NA	NA	NA	NA
AYG07752.1|2598802_2599240_+	DUF4054 domain-containing protein	NA	A0A2I7QKJ9	Vibrio_phage	37.2	4.3e-14
AYG07753.1|2599236_2599734_+	hypothetical protein	NA	A0A2I7QQZ3	Vibrio_phage	45.3	1.5e-31
AYG07754.1|2599733_2600153_+	hypothetical protein	NA	A0A2I7RFU7	Vibrio_phage	33.1	1.5e-11
AYG07755.1|2600145_2600703_+	hypothetical protein	NA	NA	NA	NA	NA
AYG07756.1|2600686_2601817_+	DUF3383 family protein	NA	N0DP63	Edwardsiella_phage	45.1	4.7e-81
AYG07757.1|2601830_2602235_+	hypothetical protein	NA	A0A2H4N7E0	Pectobacterium_phage	41.9	4.8e-20
AYG07758.1|2602231_2602678_+	hypothetical protein	NA	NA	NA	NA	NA
AYG07759.1|2602904_2604446_+	hypothetical protein	NA	A0A089X2P4	Vibrio_phage	26.2	6.6e-25
AYG07760.1|2604442_2605063_+	hypothetical protein	NA	N0DQQ6	Edwardsiella_phage	37.1	5.3e-26
AYG07761.1|2605059_2605362_+	hypothetical protein	NA	NA	NA	NA	NA
AYG07762.1|2605354_2606305_+	hypothetical protein	NA	NA	NA	NA	NA
AYG07763.1|2606301_2606958_+	hypothetical protein	NA	B5AX78	Iodobacteriophage	37.9	4.0e-32
AYG07764.1|2606954_2607320_+	hypothetical protein	NA	A0A0P0IVU6	Acinetobacter_phage	45.5	2.3e-13
AYG07765.1|2607319_2608579_+|plate	phage baseplate protein	plate	H9C1B3	Pectobacterium_phage	39.4	7.1e-70
AYG07766.1|2608575_2609235_+	DUF2612 domain-containing protein	NA	B5AX81	Iodobacteriophage	35.6	1.3e-22
AYG07767.1|2609234_2610017_+|tail	tail fiber protein	tail	A0A1W6JT73	Escherichia_phage	42.1	1.6e-19
AYG07768.1|2610233_2610677_+|terminase	terminase small subunit	terminase	E5AGA2	Erwinia_phage	50.0	4.0e-28
AYG07769.1|2610673_2612284_+|terminase	terminase	terminase	H9C191	Pectobacterium_phage	47.2	1.4e-147
AYG07770.1|2612359_2614768_+	hypothetical protein	NA	A0A2H4J9C6	uncultured_Caudovirales_phage	33.4	6.7e-85
AYG07771.1|2615142_2616162_-	hypothetical protein	NA	NA	NA	NA	NA
AYG07772.1|2616269_2616821_+	glycoside hydrolase family 19 protein	NA	B5TK83	Pseudomonas_phage	69.2	1.6e-66
AYG07773.1|2616817_2617330_+	DUF2514 domain-containing protein	NA	A0A221SAM5	Ralstonia_phage	55.7	5.0e-06
AYG10788.1|2617636_2617873_-	hypothetical protein	NA	A0A2H4JDJ8	uncultured_Caudovirales_phage	53.8	1.0e-14
2617366:2617384	attR	TGGGACAATCCTGGGACAC	NA	NA	NA	NA
>prophage 5
CP032618	Pseudomonas fluorescens strain PF08 chromosome, complete genome	6030573	3529531	3536484	6030573	tRNA	uncultured_Caudovirales_phage(85.71%)	9	NA	NA
AYG08526.1|3529531_3530203_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	95.5	4.9e-110
AYG08527.1|3530290_3530683_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	86.2	3.3e-58
AYG08528.1|3530684_3531035_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	66.7	1.2e-38
AYG08529.1|3531034_3531328_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	63.6	2.4e-29
AYG08530.1|3531324_3531660_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	78.4	1.4e-44
AYG08531.1|3531656_3532658_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	86.9	1.9e-166
AYG08532.1|3532746_3533742_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AYG08533.1|3533808_3535203_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
AYG08534.1|3535203_3536484_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.3	1.8e-97
>prophage 6
CP032618	Pseudomonas fluorescens strain PF08 chromosome, complete genome	6030573	4068773	4169566	6030573	plate,capsid,tRNA,terminase,integrase,portal,holin,lysis,protease,tail,head	uncultured_Caudovirales_phage(50.0%)	92	4124787:4124806	4168622:4168641
AYG08963.1|4068773_4069484_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
AYG08964.1|4069734_4070229_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
AYG08965.1|4070487_4070715_-	hypothetical protein	NA	NA	NA	NA	NA
AYG08966.1|4071344_4072643_+	MFS transporter	NA	NA	NA	NA	NA
AYG08967.1|4072717_4073611_+	effector protein	NA	NA	NA	NA	NA
AYG08968.1|4073723_4075583_+	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
AYG08969.1|4075592_4076699_-	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
AYG08970.1|4076719_4077805_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
AYG08971.1|4077806_4078715_-	N-carbamoylputrescine amidase	NA	M1H510	Paramecium_bursaria_Chlorella_virus	47.7	1.4e-75
AYG08972.1|4078719_4079772_-	agmatine deiminase family protein	NA	M1H3B1	Paramecium_bursaria_Chlorella_virus	34.9	2.4e-55
AYG08973.1|4079907_4080780_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYG08974.1|4080772_4081345_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
AYG08975.1|4082051_4082606_+	ParA family protein	NA	NA	NA	NA	NA
AYG08976.1|4082818_4083445_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYG08977.1|4084683_4085217_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYG08978.1|4085229_4086231_-	adhesin	NA	NA	NA	NA	NA
AYG08979.1|4086230_4088861_-	outer membrane usher protein FimD	NA	NA	NA	NA	NA
AYG10856.1|4088984_4089692_-	fimbrial chaperone protein FimC	NA	NA	NA	NA	NA
AYG08980.1|4090184_4090745_-	type-1 fimbrial protein subunit A	NA	NA	NA	NA	NA
AYG08981.1|4092274_4092781_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AYG08982.1|4092786_4093722_+	FecR family protein	NA	NA	NA	NA	NA
AYG08983.1|4093798_4096204_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AYG08984.1|4096413_4097037_+	hypothetical protein	NA	NA	NA	NA	NA
AYG08985.1|4097178_4097931_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AYG08986.1|4098065_4099577_-	purine permease	NA	NA	NA	NA	NA
AYG08987.1|4099749_4100700_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYG08988.1|4100843_4101677_+	nucleoside-binding protein	NA	NA	NA	NA	NA
AYG08989.1|4101678_4102863_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	26.1	2.0e-18
AYG08990.1|4102985_4103903_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYG10857.1|4103894_4105061_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AYG08991.1|4105159_4106065_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYG08992.1|4106061_4106685_-	HAD family phosphatase	NA	NA	NA	NA	NA
AYG08993.1|4106871_4108065_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
AYG08994.1|4108393_4109767_+	LOG family protein	NA	NA	NA	NA	NA
AYG08995.1|4109943_4110201_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AYG08996.1|4110197_4110593_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AYG08997.1|4110664_4111039_+	hypothetical protein	NA	NA	NA	NA	NA
AYG08998.1|4111979_4112969_-	hypothetical protein	NA	NA	NA	NA	NA
AYG08999.1|4112981_4113449_-	hypothetical protein	NA	NA	NA	NA	NA
AYG09000.1|4113507_4113975_-	hypothetical protein	NA	NA	NA	NA	NA
AYG09001.1|4122004_4122790_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
AYG10858.1|4122795_4123497_-	transcriptional regulator	NA	NA	NA	NA	NA
AYG09002.1|4123872_4124604_+	hypothetical protein	NA	NA	NA	NA	NA
4124787:4124806	attL	GCCCCGATGATGGATTGGAC	NA	NA	NA	NA
AYG09003.1|4125875_4126979_+	CBS domain-containing protein	NA	NA	NA	NA	NA
AYG09004.1|4127066_4128344_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	50.6	3.2e-110
AYG09005.1|4128336_4128762_-	peptidase S24	NA	A0A1W6JNS2	Morganella_phage	38.7	1.1e-14
AYG09006.1|4130330_4131125_-	DNA adenine methylase	NA	C7BGE1	Burkholderia_phage	66.8	7.1e-100
AYG09007.1|4131274_4131817_-|lysis	lysis protein	lysis	B5TK84	Pseudomonas_phage	57.0	7.1e-43
AYG09008.1|4131798_4132362_-	glycoside hydrolase family 19 protein	NA	B5TK83	Pseudomonas_phage	80.7	5.1e-84
AYG09009.1|4132425_4133469_-	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	77.6	6.0e-147
AYG09010.1|4133485_4133692_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	3.9e-18
AYG09011.1|4133666_4134512_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	67.1	6.4e-107
AYG09012.1|4134521_4137152_-|tail	tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	69.0	4.0e-200
AYG09013.1|4137292_4137895_-|tail	phage tail assembly protein	tail	A0A2H4J873	uncultured_Caudovirales_phage	49.0	7.4e-17
AYG10859.1|4137907_4138411_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	66.7	3.5e-60
AYG09014.1|4138429_4139593_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	82.8	3.7e-182
AYG09015.1|4139695_4140157_-	hypothetical protein	NA	NA	NA	NA	NA
AYG09016.1|4140164_4140899_-	hypothetical protein	NA	NA	NA	NA	NA
AYG09017.1|4140905_4141592_-|tail	phage tail protein	tail	A2I2X8	Vibrio_virus	37.7	2.9e-17
AYG09018.1|4141588_4142308_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	32.4	7.8e-13
AYG09019.1|4142304_4143285_-|tail	phage tail protein	tail	Q37840	Escherichia_phage	40.7	2.8e-53
AYG09020.1|4143281_4143608_-|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	69.4	2.3e-36
AYG09021.1|4143612_4143840_-	hypothetical protein	NA	NA	NA	NA	NA
AYG09022.1|4143898_4144456_-|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	60.1	1.1e-54
AYG09023.1|4144452_4144989_-	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	62.4	1.2e-58
AYG09024.1|4144981_4145638_-	hypothetical protein	NA	A0A2H4JBV1	uncultured_Caudovirales_phage	66.1	1.1e-77
AYG09025.1|4145634_4145955_-	hypothetical protein	NA	A0A2H4J879	uncultured_Caudovirales_phage	74.3	2.5e-40
AYG09026.1|4145957_4146953_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	89.4	3.7e-170
AYG09027.1|4147016_4147361_-|head	head decoration protein	head	A0A2H4JF15	uncultured_Caudovirales_phage	84.2	1.1e-46
AYG09028.1|4147357_4148500_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	69.0	3.8e-139
AYG09029.1|4148496_4149978_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	85.8	6.1e-246
AYG09030.1|4149977_4150184_-	hypothetical protein	NA	A0A2H4JA19	uncultured_Caudovirales_phage	73.5	2.0e-22
AYG09031.1|4150185_4152210_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4J898	uncultured_Caudovirales_phage	84.3	0.0e+00
AYG09032.1|4152214_4152772_-|terminase	terminase small subunit	terminase	A0A2H4JG15	uncultured_Caudovirales_phage	67.9	5.6e-59
AYG09033.1|4152975_4153320_-|holin	pyocin R2, holin	holin	A0A2H4J893	uncultured_Caudovirales_phage	80.6	1.7e-45
AYG09034.1|4153839_4154205_-	hypothetical protein	NA	NA	NA	NA	NA
AYG09035.1|4154197_4156420_-	toprim domain-containing protein	NA	A0A2D1GN57	Marinobacter_phage	47.0	1.9e-190
AYG09036.1|4156409_4156637_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
AYG09037.1|4156629_4157196_-	hypothetical protein	NA	NA	NA	NA	NA
AYG09038.1|4157479_4157704_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYG09039.1|4157806_4158556_+	XRE family transcriptional regulator	NA	G9L676	Escherichia_phage	51.8	7.3e-30
AYG09040.1|4158806_4159397_+	hypothetical protein	NA	NA	NA	NA	NA
AYG09041.1|4159406_4159691_+	DNA-binding protein	NA	NA	NA	NA	NA
AYG09042.1|4159846_4160173_+	transcriptional regulator	NA	NA	NA	NA	NA
AYG09043.1|4160800_4161022_+	hypothetical protein	NA	NA	NA	NA	NA
AYG09044.1|4161018_4161561_+	phosphohydrolase	NA	U5P0T3	Shigella_phage	45.2	1.2e-29
AYG09045.1|4162582_4163338_+	DNA cytosine methyltransferase	NA	A0A2I7QZY6	Vibrio_phage	52.4	7.3e-62
AYG09046.1|4163350_4163620_+	Pyocin activator protein PrtN	NA	A0A2K8HN48	Pseudomonas_phage	61.1	9.0e-23
AYG09047.1|4163772_4164891_+	DNA cytosine methyltransferase	NA	A0A2H4PAK4	Aphanizomenon_phage	38.7	6.0e-28
AYG09048.1|4165869_4167255_-	ATP-binding protein	NA	NA	NA	NA	NA
AYG09049.1|4167334_4168444_-|integrase	site-specific integrase	integrase	L7TP61	Pseudomonas_virus	71.2	5.0e-152
AYG09050.1|4168546_4169566_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
4168622:4168641	attR	GCCCCGATGATGGATTGGAC	NA	NA	NA	NA
>prophage 7
CP032618	Pseudomonas fluorescens strain PF08 chromosome, complete genome	6030573	4698372	4739337	6030573	plate,tRNA,holin,lysis,tail	uncultured_Caudovirales_phage(30.0%)	41	NA	NA
AYG09516.1|4698372_4700088_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AYG09517.1|4700108_4701062_+	hypothetical protein	NA	NA	NA	NA	NA
AYG09518.1|4701183_4702242_-	DNA polymerase IV	NA	NA	NA	NA	NA
AYG09519.1|4703160_4705803_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
AYG09520.1|4705802_4707083_+	virulence factor family protein	NA	NA	NA	NA	NA
AYG09521.1|4707176_4708451_-	hypothetical protein	NA	NA	NA	NA	NA
AYG09522.1|4708620_4710522_-	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	33.9	2.4e-77
AYG09523.1|4710830_4712171_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AYG09524.1|4712274_4712745_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYG09525.1|4712873_4713584_+	RNA-binding protein	NA	NA	NA	NA	NA
AYG09526.1|4713650_4714112_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	50.7	1.0e-37
AYG09527.1|4714115_4714811_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AYG09528.1|4714959_4715739_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
AYG09529.1|4715805_4716792_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYG09530.1|4716788_4717151_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AYG09531.1|4717229_4717877_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYG09532.1|4718039_4718750_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AYG09533.1|4718942_4719377_+	hypothetical protein	NA	NA	NA	NA	NA
AYG09534.1|4719732_4720845_+	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
AYG09535.1|4720952_4721420_-	recombination regulator RecX	NA	NA	NA	NA	NA
AYG09536.1|4721428_4722487_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	62.4	1.4e-111
AYG09537.1|4722570_4723071_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	84.9	3.0e-72
AYG09538.1|4723152_4723656_-|lysis	lysis protein	lysis	B5TK84	Pseudomonas_phage	58.7	2.0e-39
AYG09539.1|4723646_4724198_-	glycoside hydrolase family 19 protein	NA	B5TK83	Pseudomonas_phage	78.0	9.0e-78
AYG09540.1|4724215_4725226_-	phage late control D family protein	NA	B0ZSH3	Halomonas_phage	54.8	1.3e-101
AYG09541.1|4725235_4725448_-|tail	phage tail protein	tail	A0A2H4JGD9	uncultured_Caudovirales_phage	62.9	4.0e-18
AYG09542.1|4725440_4725824_-|tail	phage tail protein	tail	A0A2H4JAC8	uncultured_Caudovirales_phage	55.1	1.9e-34
AYG09543.1|4727316_4727883_-|tail	phage tail assembly protein	tail	B0ZSH0	Halomonas_phage	37.1	5.7e-27
AYG09544.1|4728052_4728559_-|tail	phage tail protein	tail	Q6R4W3	Vibrio_virus	33.9	3.8e-22
AYG09545.1|4728558_4729725_-|tail	phage tail protein	tail	B0ZSG8	Halomonas_phage	57.2	4.2e-125
AYG09546.1|4729727_4729931_-	hypothetical protein	NA	NA	NA	NA	NA
AYG09547.1|4730298_4731159_-	hypothetical protein	NA	NA	NA	NA	NA
AYG09548.1|4731229_4731760_-	hypothetical protein	NA	B0ZSG1	Halomonas_phage	58.7	1.7e-49
AYG09549.1|4731756_4732395_-|tail	phage tail protein I	tail	A0A2H4JDK0	uncultured_Caudovirales_phage	52.6	6.2e-38
AYG09550.1|4732391_4733387_-|plate	baseplate J protein	plate	A0A2H4JC04	uncultured_Caudovirales_phage	63.5	2.3e-111
AYG09551.1|4733383_4733716_-|plate	phage baseplate protein	plate	A0A2H4JI46	uncultured_Caudovirales_phage	68.2	1.8e-36
AYG09552.1|4733725_4734337_-|plate	phage baseplate assembly protein V	plate	A0A2H4JBW8	uncultured_Caudovirales_phage	54.2	1.2e-46
AYG09553.1|4734341_4734854_-	hypothetical protein	NA	NA	NA	NA	NA
AYG09554.1|4734875_4735220_-|holin	pyocin R2, holin	holin	B5TK61	Pseudomonas_phage	82.8	6.7e-47
AYG09555.1|4735819_4736548_-	XRE family transcriptional regulator	NA	B5TK58	Pseudomonas_phage	87.7	3.7e-119
AYG09556.1|4736745_4739337_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.8	2.5e-29
>prophage 8
CP032618	Pseudomonas fluorescens strain PF08 chromosome, complete genome	6030573	5496786	5537046	6030573	transposase,holin,protease	Tupanvirus(33.33%)	40	NA	NA
AYG10224.1|5496786_5497287_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
AYG10225.1|5497463_5498342_+	acyltransferase	NA	NA	NA	NA	NA
AYG10226.1|5498383_5498629_-	hypothetical protein	NA	NA	NA	NA	NA
AYG10227.1|5498770_5499340_-	DUF2780 domain-containing protein	NA	NA	NA	NA	NA
AYG10228.1|5499522_5499981_+	hypothetical protein	NA	NA	NA	NA	NA
AYG10229.1|5500053_5501253_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	30.7	2.9e-12
AYG10230.1|5501435_5502293_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
AYG10231.1|5502311_5502518_+	hypothetical protein	NA	NA	NA	NA	NA
AYG10232.1|5502457_5503090_-	sarcosine oxidase subunit gamma family protein	NA	NA	NA	NA	NA
AYG10233.1|5503215_5506233_-	sarcosine oxidase subunit alpha	NA	NA	NA	NA	NA
AYG10234.1|5506229_5506532_-	sarcosine oxidase subunit delta family protein	NA	NA	NA	NA	NA
AYG10235.1|5506547_5507798_-	sarcosine oxidase subunit beta	NA	NA	NA	NA	NA
AYG10236.1|5507820_5509074_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.5	8.6e-100
AYG10237.1|5509310_5510039_-	conjugal transfer protein TraX	NA	NA	NA	NA	NA
AYG10238.1|5510129_5511170_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
AYG10893.1|5511371_5511572_+	hypothetical protein	NA	NA	NA	NA	NA
AYG10239.1|5511651_5512185_+|transposase	transposase	transposase	NA	NA	NA	NA
AYG10240.1|5512310_5513411_-	glycine-betaine demethylase subunit GbcB	NA	NA	NA	NA	NA
AYG10241.1|5513692_5514988_+	glycine-betaine demethylase subunit GbcA	NA	NA	NA	NA	NA
AYG10242.1|5515679_5516246_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYG10243.1|5516344_5517115_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AYG10244.1|5517130_5518351_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
AYG10245.1|5518350_5520288_-	dimethylglycine demethylation protein DgcB	NA	NA	NA	NA	NA
AYG10246.1|5520443_5522504_-	dimethylglycine demethylation protein DgcA	NA	NA	NA	NA	NA
AYG10247.1|5522519_5523050_-	hydrocarbon binding protein	NA	NA	NA	NA	NA
AYG10248.1|5523119_5524097_-	membrane dipeptidase	NA	NA	NA	NA	NA
AYG10249.1|5524121_5524373_+	hypothetical protein	NA	NA	NA	NA	NA
AYG10250.1|5524317_5524719_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AYG10251.1|5524761_5525169_+	DUF3010 family protein	NA	NA	NA	NA	NA
AYG10252.1|5525301_5526246_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
AYG10253.1|5526438_5527377_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
AYG10254.1|5527455_5528343_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
AYG10255.1|5528400_5529366_+	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
AYG10256.1|5529439_5529913_+	thioesterase	NA	NA	NA	NA	NA
AYG10257.1|5530151_5530415_+	hypothetical protein	NA	NA	NA	NA	NA
AYG10258.1|5530510_5531614_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
AYG10259.1|5532207_5533584_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AYG10260.1|5534011_5534959_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
AYG10261.1|5535025_5535871_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
AYG10262.1|5535867_5537046_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	37.6	3.5e-26
