The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP022214	Burkholderia thailandensis strain FDAARGOS_241 chromosome 1, complete sequence	3862564	378937	389819	3862564	protease	Agrobacterium_phage(16.67%)	10	NA	NA
AWY57392.1|378937_381238_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	5.1e-167
AWY57393.1|381234_381549_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A218MMY6	uncultured_virus	44.6	2.6e-13
AWY57394.1|382079_382283_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
AWY57395.1|382394_383990_-	copper oxidase	NA	NA	NA	NA	NA
AWY57396.1|384002_384179_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AWY57397.1|384151_385411_-	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	63.0	6.8e-12
AWY57398.1|385675_386254_+	pseudouridine synthase	NA	NA	NA	NA	NA
AWY57399.1|386514_386730_+	hypothetical protein	NA	NA	NA	NA	NA
AWY57400.1|386925_387441_+	hypothetical protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	1.5e-13
AWY57401.1|387704_389819_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.8	1.2e-56
>prophage 2
CP022214	Burkholderia thailandensis strain FDAARGOS_241 chromosome 1, complete sequence	3862564	521258	550779	3862564	transposase,integrase	Burkholderia_virus(30.0%)	26	517563:517581	552760:552778
517563:517581	attL	ATTCTCGACTGGATGCTCG	NA	NA	NA	NA
AWY57511.1|521258_522617_+|integrase	integrase	integrase	NA	NA	NA	NA
AWY57512.1|522824_523217_+	hypothetical protein	NA	NA	NA	NA	NA
AWY57513.1|523213_524080_+	hypothetical protein	NA	NA	NA	NA	NA
AWY57514.1|524266_524806_+	hypothetical protein	NA	A4JX23	Burkholderia_virus	60.1	1.3e-49
AWY57515.1|524802_525537_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	79.5	6.3e-111
AWY57516.1|525564_526647_+	hypothetical protein	NA	Q8W6S0	Burkholderia_virus	76.3	1.4e-159
AWY60222.1|526813_527272_-	transcriptional regulator	NA	NA	NA	NA	NA
AWY57517.1|528595_529276_+	hypothetical protein	NA	NA	NA	NA	NA
AWY57518.1|529311_529692_+	hypothetical protein	NA	NA	NA	NA	NA
AWY57519.1|529987_530812_-	hypothetical protein	NA	NA	NA	NA	NA
AWY57520.1|530951_531275_-	hypothetical protein	NA	NA	NA	NA	NA
AWY60223.1|531332_532964_-	hypothetical protein	NA	NA	NA	NA	NA
AWY57521.1|533600_534155_+	hypothetical protein	NA	NA	NA	NA	NA
AWY57522.1|534264_535338_-|integrase	integrase	integrase	A0A2D1GMX8	Marinobacter_phage	23.2	2.5e-07
AWY57523.1|535843_536365_+	hypothetical protein	NA	NA	NA	NA	NA
AWY57524.1|536392_539428_+	hypothetical protein	NA	NA	NA	NA	NA
AWY57525.1|539566_540130_+	hypothetical protein	NA	NA	NA	NA	NA
AWY57526.1|540179_540587_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	38.2	3.1e-14
AWY57527.1|540583_540931_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	72.0	2.1e-40
AWY57528.1|540960_542532_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.8	6.7e-150
AWY60224.1|544047_544299_-	hypothetical protein	NA	NA	NA	NA	NA
AWY57529.1|544513_545002_-	hypothetical protein	NA	A0A0N9SGM1	Paenibacillus_phage	39.5	3.3e-23
AWY57530.1|545095_545797_-	restriction endonuclease	NA	NA	NA	NA	NA
AWY57531.1|545793_547017_-	DNA (cytosine-5-)-methyltransferase	NA	A7XXH6	Thermus_virus	28.6	1.2e-26
AWY57532.1|547003_547435_-	very short patch repair endonuclease	NA	I6NSG0	Burkholderia_phage	51.6	3.9e-36
AWY57533.1|548715_550779_+|integrase	integrase	integrase	NA	NA	NA	NA
552760:552778	attR	ATTCTCGACTGGATGCTCG	NA	NA	NA	NA
>prophage 3
CP022214	Burkholderia thailandensis strain FDAARGOS_241 chromosome 1, complete sequence	3862564	1314094	1321131	3862564	integrase	Pseudomonas_phage(33.33%)	8	1315266:1315316	1325322:1325372
AWY58154.1|1314094_1315123_-|integrase	integrase	integrase	W6MYA3	Pseudomonas_phage	41.3	1.2e-46
1315266:1315316	attL	TTGGCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAGGGCAG	NA	NA	NA	NA
AWY58155.1|1315458_1315764_-	hypothetical protein	NA	NA	NA	NA	NA
AWY60292.1|1315963_1316281_-	transcriptional regulator	NA	A0A088CD40	Shigella_phage	59.2	2.1e-15
AWY58156.1|1316288_1316648_-	hypothetical protein	NA	A0A088CBP5	Shigella_phage	51.9	1.1e-18
AWY58157.1|1316662_1317517_-|integrase	integrase	integrase	Q9T1P3	Pseudomonas_phage	46.2	8.3e-62
AWY58158.1|1317597_1318374_-	hypothetical protein	NA	A0A1W5LU59	Ralstonia_phage	40.9	4.3e-33
AWY58159.1|1318840_1320229_-	type II secretory pathway protein	NA	NA	NA	NA	NA
AWY58160.1|1320225_1321131_-	hypothetical protein	NA	Q6UAZ2	Ralstonia_phage	36.1	4.9e-28
1325322:1325372	attR	TTGGCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAGGGCAG	NA	NA	NA	NA
>prophage 4
CP022214	Burkholderia thailandensis strain FDAARGOS_241 chromosome 1, complete sequence	3862564	1393401	1456028	3862564	transposase,integrase,holin	Bacillus_thuringiensis_phage(11.11%)	59	1443690:1443705	1456041:1456056
AWY58219.1|1393401_1394664_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWY58220.1|1394945_1395554_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
AWY58221.1|1395704_1396595_+	ATPase	NA	NA	NA	NA	NA
AWY58222.1|1396720_1397542_+	hydrolase	NA	NA	NA	NA	NA
AWY58223.1|1397721_1398426_-	aquaporin	NA	NA	NA	NA	NA
AWY58224.1|1398731_1399028_+	H-NS histone	NA	NA	NA	NA	NA
AWY58225.1|1399130_1400195_-	glycosyl transferase	NA	NA	NA	NA	NA
AWY58226.1|1400263_1400437_+	hypothetical protein	NA	NA	NA	NA	NA
AWY58227.1|1400717_1401110_+	flagellar transcriptional activator FlhD	NA	NA	NA	NA	NA
AWY58228.1|1401203_1401755_+	transcriptional activator FlhC	NA	NA	NA	NA	NA
AWY58229.1|1401751_1401838_+	transcriptional regulator	NA	NA	NA	NA	NA
AWY58230.1|1401956_1402817_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
AWY58231.1|1402833_1403868_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
AWY58232.1|1403898_1404279_+	response regulator	NA	NA	NA	NA	NA
AWY58233.1|1404310_1406542_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
AWY58234.1|1406572_1407100_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
AWY58235.1|1409125_1410073_+	chemotaxis protein CheR	NA	NA	NA	NA	NA
AWY58236.1|1410069_1410774_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
AWY58237.1|1410770_1411874_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
AWY58238.1|1411959_1412355_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	2.7e-07
AWY58239.1|1412356_1413085_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
AWY58240.1|1413255_1413789_+	hypothetical protein	NA	NA	NA	NA	NA
AWY58241.1|1413811_1415125_+	hypothetical protein	NA	NA	NA	NA	NA
AWY58242.1|1415304_1415805_+	VOC family protein	NA	NA	NA	NA	NA
AWY58243.1|1415905_1417372_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AWY58244.1|1417740_1418958_+	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
AWY58245.1|1418954_1421057_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AWY58246.1|1421053_1422787_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
AWY58247.1|1422779_1423592_+	flagellar biosynthesis protein FlhG	NA	NA	NA	NA	NA
AWY58248.1|1423616_1424348_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
AWY58249.1|1424700_1426122_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	29.9	9.9e-44
AWY58250.1|1426284_1426638_+|holin	phage holin family protein	holin	NA	NA	NA	NA
AWY58251.1|1426655_1427486_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
AWY58252.1|1427567_1428788_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	98.5	6.2e-236
AWY58253.1|1428974_1430465_-	6-aminohexanoate hydrolase	NA	NA	NA	NA	NA
AWY58254.1|1430553_1431246_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
AWY58255.1|1433098_1434241_+	branched chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWY58256.1|1434399_1435518_-	MFS transporter	NA	NA	NA	NA	NA
AWY58257.1|1435907_1436597_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AWY58258.1|1436670_1436919_-	hypothetical protein	NA	NA	NA	NA	NA
AWY60297.1|1436981_1437275_+	H-NS histone	NA	NA	NA	NA	NA
AWY60298.1|1437514_1438705_+	cation transporter	NA	NA	NA	NA	NA
AWY60299.1|1438869_1439328_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AWY58259.1|1439418_1440075_-	exonuclease	NA	A0A2L0UZL4	Agrobacterium_phage	37.1	1.5e-31
AWY58260.1|1440071_1440716_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AWY58261.1|1440729_1440891_-	hypothetical protein	NA	NA	NA	NA	NA
AWY58262.1|1441316_1441952_+	septal ring lytic transglycosylase RlpA family lipoprotein	NA	F5B3X9	Synechococcus_phage	65.5	1.9e-23
AWY58263.1|1442046_1442934_-	rRNA (cytidine-2'-O-)-methyltransferase	NA	NA	NA	NA	NA
AWY58264.1|1442932_1443415_+	YraN family protein	NA	NA	NA	NA	NA
AWY58265.1|1443537_1444116_+	phosphoheptose isomerase	NA	NA	NA	NA	NA
1443690:1443705	attL	CCCGTCGGCCGCCGCG	NA	NA	NA	NA
AWY58266.1|1444134_1444935_+	BON domain-containing protein	NA	NA	NA	NA	NA
AWY60300.1|1444961_1445294_+	cytochrome C	NA	NA	NA	NA	NA
AWY58267.1|1445550_1446642_+|integrase	integrase	integrase	W6MYA3	Pseudomonas_phage	40.5	6.2e-54
AWY58268.1|1446783_1447431_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWY58269.1|1447427_1448636_+	DNA-binding protein	NA	B6SBZ6	Clostridium_virus	27.9	3.3e-32
AWY58270.1|1449936_1450254_+	hypothetical protein	NA	NA	NA	NA	NA
AWY58271.1|1450253_1450823_+	hypothetical protein	NA	NA	NA	NA	NA
AWY58272.1|1452668_1453937_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.7	9.8e-43
AWY58273.1|1454456_1456028_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.8	6.7e-150
1456041:1456056	attR	CGCGGCGGCCGACGGG	NA	NA	NA	NA
>prophage 5
CP022214	Burkholderia thailandensis strain FDAARGOS_241 chromosome 1, complete sequence	3862564	1943880	1953111	3862564		Hokovirus(16.67%)	7	NA	NA
AWY58683.1|1943880_1945833_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.5	1.2e-148
AWY58684.1|1946096_1947227_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.0	1.8e-24
AWY58685.1|1947258_1949268_+	chloride transporter	NA	S4VT78	Pandoravirus	35.2	1.7e-52
AWY58686.1|1949443_1950259_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	32.9	3.3e-36
AWY60350.1|1950323_1951007_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	3.3e-05
AWY58687.1|1951003_1951531_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AWY58688.1|1951566_1953111_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	3.3e-24
>prophage 6
CP022214	Burkholderia thailandensis strain FDAARGOS_241 chromosome 1, complete sequence	3862564	2334180	2342828	3862564		Bacillus_phage(16.67%)	8	NA	NA
AWY58997.1|2334180_2335581_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.7	1.1e-79
AWY60376.1|2335612_2336536_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.9	1.3e-15
AWY58998.1|2336593_2337586_+	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
AWY58999.1|2337657_2337975_+	competence protein ComE	NA	NA	NA	NA	NA
AWY60377.1|2338309_2339212_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	39.9	4.3e-53
AWY59000.1|2339306_2340599_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
AWY59001.1|2340726_2341650_+	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	36.2	3.2e-43
AWY60378.1|2341985_2342828_-	lysophospholipase	NA	A7K906	Acanthocystis_turfacea_chlorella_virus	24.6	3.8e-11
>prophage 7
CP022214	Burkholderia thailandensis strain FDAARGOS_241 chromosome 1, complete sequence	3862564	2612430	2707420	3862564	terminase,plate,tRNA,protease,head,capsid,tail,portal	uncultured_Caudovirales_phage(24.44%)	104	NA	NA
AWY59219.1|2612430_2613957_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.2	7.3e-85
AWY59220.1|2615361_2617056_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A0K2FM92	Brevibacillus_phage	27.5	1.4e-28
AWY60408.1|2617071_2618157_-	regulator	NA	NA	NA	NA	NA
AWY59221.1|2618510_2619764_+	lipoprotein-releasing system transmembrane subunit LolC	NA	NA	NA	NA	NA
AWY59222.1|2619783_2620506_+	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.2	3.1e-33
AWY59223.1|2620510_2621299_+	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
AWY59224.1|2623925_2624753_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWY60409.1|2624796_2624910_+	CTP synthetase	NA	NA	NA	NA	NA
AWY59225.1|2624994_2626656_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.0	1.4e-150
AWY59226.1|2626652_2627507_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.0e-48
AWY59227.1|2627611_2628895_+	enolase	NA	W6LP63	Streptococcus_phage	62.1	9.3e-150
AWY59228.1|2628986_2629418_+	cell division protein FtsB	NA	NA	NA	NA	NA
AWY59229.1|2629579_2629924_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59230.1|2630012_2630963_-	redox-regulated molecular chaperone Hsp33	NA	NA	NA	NA	NA
AWY59231.1|2631001_2631526_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AWY59232.1|2631671_2632523_+	hypothetical protein	NA	NA	NA	NA	NA
AWY59233.1|2632797_2633700_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWY59234.1|2633901_2634741_+	phosphatase	NA	NA	NA	NA	NA
AWY59235.1|2634804_2635434_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AWY59236.1|2635532_2636198_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AWY59237.1|2636206_2637409_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AWY59238.1|2637405_2638023_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWY59239.1|2638067_2638970_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AWY60410.1|2639080_2640223_+	hypothetical protein	NA	NA	NA	NA	NA
AWY59240.1|2640229_2641006_+	MBL fold metallo-hydrolase	NA	U5PVD0	Bacillus_phage	26.6	1.9e-09
AWY59241.1|2641186_2641441_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59242.1|2641346_2641616_-	hypothetical protein	NA	NA	NA	NA	NA
AWY60412.1|2641672_2642836_-	cupin	NA	NA	NA	NA	NA
AWY59243.1|2642928_2643474_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AWY59244.1|2643453_2644752_-	hypothetical protein	NA	NA	NA	NA	NA
AWY60411.1|2644738_2647408_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	24.0	2.2e-28
AWY59245.1|2647579_2648881_+	alpha/beta hydrolase	NA	C7BGE7	Burkholderia_phage	58.7	2.6e-147
AWY60413.1|2648831_2649074_-	hypothetical protein	NA	C7BGF0	Burkholderia_phage	59.2	9.3e-19
AWY60414.1|2649082_2649556_-	hypothetical protein	NA	B5TA88	Burkholderia_phage	71.4	2.3e-05
AWY59246.1|2649564_2649894_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59247.1|2650007_2651324_-	pyridoxal phosphate biosynthetic protein PdxJ	NA	NA	NA	NA	NA
AWY59248.1|2651323_2651773_-	ACP synthase	NA	NA	NA	NA	NA
AWY59249.1|2651769_2652375_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59250.1|2652371_2652707_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59251.1|2653081_2653570_-	hypothetical protein	NA	NA	NA	NA	NA
AWY60415.1|2653523_2654024_-	transcriptional regulator	NA	NA	NA	NA	NA
AWY59252.1|2654140_2654350_+	hypothetical protein	NA	NA	NA	NA	NA
AWY59253.1|2654436_2654967_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.8	4.4e-29
AWY60416.1|2654980_2655313_+	hypothetical protein	NA	NA	NA	NA	NA
AWY59254.1|2655914_2656478_+	hypothetical protein	NA	NA	NA	NA	NA
AWY59255.1|2656541_2656721_+	hypothetical protein	NA	NA	NA	NA	NA
AWY59256.1|2656851_2657322_+	hypothetical protein	NA	NA	NA	NA	NA
AWY59257.1|2657443_2659936_+	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.8	3.6e-97
AWY59258.1|2660153_2660741_+	hypothetical protein	NA	NA	NA	NA	NA
AWY59259.1|2661121_2661970_+	DUF4747 domain-containing protein	NA	NA	NA	NA	NA
AWY60417.1|2662165_2662570_+	hypothetical protein	NA	NA	NA	NA	NA
AWY59260.1|2662721_2663291_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWY59261.1|2663253_2665239_+|terminase	terminase	terminase	A0A2D1GMT1	Marinobacter_phage	53.4	2.7e-180
AWY59262.1|2665249_2665456_+	hypothetical protein	NA	NA	NA	NA	NA
AWY59263.1|2665452_2666946_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.2	7.5e-135
AWY59264.1|2666942_2668037_+	peptidase S14	NA	A0A2H4JDI2	uncultured_Caudovirales_phage	36.2	2.3e-48
AWY59265.1|2668063_2668408_+|head	head decoration protein	head	A0A2H4JF15	uncultured_Caudovirales_phage	49.5	3.0e-15
AWY59266.1|2668442_2669468_+|capsid	minor capsid protein E	capsid	A0A2H4J890	uncultured_Caudovirales_phage	59.1	1.7e-109
AWY59267.1|2669471_2669762_+	hypothetical protein	NA	NA	NA	NA	NA
AWY59268.1|2669763_2670294_+|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	28.0	9.2e-11
AWY59269.1|2670283_2670817_+	hypothetical protein	NA	Q9JML9	Wolbachia_phage	39.5	6.2e-23
AWY59270.1|2670819_2671500_+|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	34.4	1.2e-18
AWY59271.1|2671564_2671771_+	hypothetical protein	NA	NA	NA	NA	NA
AWY59272.1|2671767_2672112_+|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	50.9	1.4e-23
AWY59273.1|2672108_2673002_+|plate	baseplate J protein	plate	A0A1J0I2M3	Salmonella_phage	40.1	8.4e-49
AWY59274.1|2672994_2673570_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	43.2	6.0e-32
AWY59275.1|2673557_2675021_+	hypothetical protein	NA	A4JWL8	Burkholderia_virus	78.0	8.0e-214
AWY59276.1|2675036_2675489_+|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	76.8	7.0e-44
AWY59277.1|2675554_2676724_+|tail	phage tail protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	73.2	3.7e-161
AWY59278.1|2676734_2677238_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	50.0	1.2e-41
AWY59279.1|2677307_2677610_+|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	37.2	1.5e-05
AWY59280.1|2677697_2680109_+|tail	phage tail protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	35.5	1.2e-62
AWY59281.1|2680117_2680999_+	oxidoreductase	NA	A0A2H4J875	uncultured_Caudovirales_phage	37.4	3.9e-30
AWY60418.1|2680973_2681180_+|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	61.2	4.0e-15
AWY59282.1|2681189_2682242_+	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	44.8	7.0e-79
AWY59283.1|2682317_2682512_+	hypothetical protein	NA	NA	NA	NA	NA
AWY59284.1|2682504_2683047_+	glycosyl hydrolase	NA	A4JX20	Burkholderia_virus	90.6	9.8e-85
AWY59285.1|2683046_2683592_+	lysozyme	NA	Q8W6S5	Burkholderia_virus	95.0	1.0e-81
AWY59286.1|2683735_2684524_+	restriction endonuclease subunit M	NA	Q8W6S4	Burkholderia_virus	96.9	1.8e-151
AWY59287.1|2684564_2685275_-	LysR family transcriptional regulator	NA	A4PE26	Ralstonia_virus	41.5	1.4e-38
AWY59288.1|2685286_2685802_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59289.1|2685773_2686247_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59290.1|2686239_2686746_-	hypothetical protein	NA	A4PE24	Ralstonia_virus	39.4	1.5e-18
AWY59291.1|2686742_2687168_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	46.0	2.4e-14
AWY59292.1|2687229_2687511_-	hypothetical protein	NA	NA	NA	NA	NA
AWY60419.1|2687510_2687975_-	hypothetical protein	NA	C7BGE3	Burkholderia_phage	60.4	9.7e-49
AWY59293.1|2688056_2688626_+	DUF159 family protein	NA	A4JX27	Burkholderia_virus	82.3	2.0e-88
AWY59294.1|2689746_2690208_+	DNA-binding protein	NA	K4ICM4	Acidithiobacillus_phage	62.1	8.4e-45
AWY59295.1|2691971_2693111_+	RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AWY59296.1|2693107_2693941_+	hypothetical protein	NA	NA	NA	NA	NA
AWY59297.1|2694140_2694356_-	DNA mismatch repair protein	NA	NA	NA	NA	NA
AWY59298.1|2695564_2695837_+	hypothetical protein	NA	NA	NA	NA	NA
AWY59299.1|2696101_2696905_-	inositol monophosphatase	NA	NA	NA	NA	NA
AWY59300.1|2697207_2698128_+	RNA methyltransferase	NA	NA	NA	NA	NA
AWY59301.1|2698329_2699112_+	serine acetyltransferase	NA	NA	NA	NA	NA
AWY59302.1|2699203_2699425_+	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
AWY59303.1|2699454_2700255_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AWY59304.1|2700278_2700770_-	peptidyl-prolyl cis-trans isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	29.8	8.2e-06
AWY59305.1|2700850_2701426_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	40.0	2.4e-12
AWY59306.1|2701481_2702147_-	hypothetical protein	NA	NA	NA	NA	NA
AWY60420.1|2702434_2703832_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.8	2.4e-42
AWY59307.1|2703879_2704818_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
AWY59308.1|2704920_2705892_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AWY59309.1|2705935_2707420_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	NA	NA	NA	NA
>prophage 8
CP022214	Burkholderia thailandensis strain FDAARGOS_241 chromosome 1, complete sequence	3862564	3586231	3652935	3862564	transposase	Stx2-converting_phage(54.55%)	50	NA	NA
AWY59957.1|3586231_3587803_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.4	3.7e-148
AWY59958.1|3587832_3588180_-|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	72.0	2.1e-40
AWY59959.1|3588176_3588584_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	38.2	3.1e-14
AWY60506.1|3588841_3589288_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
AWY59960.1|3589553_3589829_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59961.1|3589760_3589997_+	hypothetical protein	NA	NA	NA	NA	NA
AWY60507.1|3590783_3591476_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59962.1|3591941_3592199_-	hypothetical protein	NA	NA	NA	NA	NA
AWY60508.1|3592418_3592712_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59963.1|3592726_3592915_+	hypothetical protein	NA	NA	NA	NA	NA
AWY59964.1|3593148_3596172_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AWY59965.1|3596174_3597191_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59966.1|3600034_3600340_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59967.1|3600357_3600690_-	paar motif family protein	NA	NA	NA	NA	NA
AWY60509.1|3600823_3601036_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59968.1|3601172_3601664_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59969.1|3601641_3604977_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AWY59970.1|3605085_3607488_-	type VI secretion system protein	NA	NA	NA	NA	NA
AWY59971.1|3607484_3608084_-	hypothetical protein	NA	NA	NA	NA	NA
AWY60510.1|3608080_3608638_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59972.1|3608765_3611174_-	type VI secretion system protein	NA	NA	NA	NA	NA
AWY59973.1|3611170_3611770_-	hypothetical protein	NA	NA	NA	NA	NA
AWY60511.1|3611766_3612324_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59974.1|3612460_3613294_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59975.1|3613296_3616095_-	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.1	1.5e-27
AWY59976.1|3616620_3616887_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
AWY59977.1|3616910_3618338_+	hypothetical protein	NA	NA	NA	NA	NA
AWY59978.1|3618366_3620217_-	type VI secretion system ImpG/VasA family protein	NA	NA	NA	NA	NA
AWY59979.1|3621709_3621928_+	hypothetical protein	NA	NA	NA	NA	NA
AWY59980.1|3622688_3624167_+	poly(3-hydroxybutyrate) depolymerase	NA	NA	NA	NA	NA
AWY59981.1|3624470_3624806_-	DNA-binding protein	NA	NA	NA	NA	NA
AWY59982.1|3625122_3626409_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	71.8	2.3e-172
AWY59983.1|3626541_3627447_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	75.1	1.7e-129
AWY59984.1|3628507_3629899_+	preprotein translocase	NA	NA	NA	NA	NA
AWY59985.1|3630522_3632580_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59986.1|3632582_3633023_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59987.1|3633019_3633298_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59988.1|3634174_3634597_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59989.1|3635098_3635689_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59990.1|3635843_3637580_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
AWY59991.1|3637604_3637829_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59992.1|3637857_3638667_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59993.1|3638676_3648096_-	cell surface protein	NA	A0A0R6PJK4	Moraxella_phage	30.9	4.4e-31
AWY59994.1|3648498_3648843_-	hypothetical protein	NA	NA	NA	NA	NA
AWY59995.1|3649023_3649251_+	hypothetical protein	NA	NA	NA	NA	NA
AWY59996.1|3649350_3650319_+	hypothetical protein	NA	A0A0H4INH5	Stenotrophomonas_phage	42.3	6.3e-58
AWY59997.1|3650315_3650516_+	hypothetical protein	NA	NA	NA	NA	NA
AWY59998.1|3650582_3652154_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.8	6.7e-150
AWY59999.1|3652183_3652531_-|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	72.0	2.1e-40
AWY60000.1|3652527_3652935_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	38.2	3.1e-14
>prophage 9
CP022214	Burkholderia thailandensis strain FDAARGOS_241 chromosome 1, complete sequence	3862564	3666401	3720789	3862564	transposase,terminase,holin,integrase,head,capsid,tail,portal	Burkholderia_virus(93.85%)	70	3666156:3666206	3720919:3720969
3666156:3666206	attL	CTGATTTGGGATCAGAGGGTCGTAGGTTCGAATCCTATCGCTCCGACCACT	NA	NA	NA	NA
AWY60512.1|3666401_3667073_-	DUF159 family protein	NA	Q8W6R8	Burkholderia_virus	99.6	1.2e-135
AWY60013.1|3667158_3667800_+	hypothetical protein	NA	Q8W6R9	Burkholderia_virus	100.0	1.2e-118
AWY60014.1|3667932_3669024_-	hypothetical protein	NA	Q8W6S0	Burkholderia_virus	100.0	1.5e-212
AWY60015.1|3669051_3669786_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	100.0	3.6e-138
AWY60016.1|3669782_3670343_-	PAAR domain-containing protein	NA	Q8W6S2	Burkholderia_virus	100.0	7.5e-104
AWY60017.1|3670524_3671259_-	hypothetical protein	NA	Q8W6S3	Burkholderia_virus	100.0	1.6e-130
AWY60018.1|3671511_3672300_-	restriction endonuclease subunit M	NA	Q8W6S4	Burkholderia_virus	99.6	1.5e-155
AWY60019.1|3672443_3672989_-	lysozyme	NA	Q8W6S5	Burkholderia_virus	91.7	2.4e-78
AWY60020.1|3672988_3673480_-	glycosyl hydrolase	NA	Q6JIK8	Burkholderia_virus	100.0	7.8e-89
AWY60021.1|3673472_3673685_-|holin	holin	holin	Q8W6S7	Burkholderia_virus	100.0	6.6e-29
AWY60022.1|3673727_3674462_-	hypothetical protein	NA	Q8W6S8	Burkholderia_virus	100.0	1.2e-146
AWY60513.1|3674461_3674728_-	hypothetical protein	NA	Q8W6S9	Burkholderia_virus	100.0	2.5e-49
AWY60023.1|3674772_3678078_-	host specificity protein	NA	Q8W6T0	Burkholderia_virus	100.0	0.0e+00
AWY60024.1|3678074_3678659_-|tail	tail assembly protein	tail	Q8W6T1	Burkholderia_virus	99.0	6.2e-101
AWY60025.1|3678655_3679408_-	hydrolase Nlp/P60	NA	Q8W6T2	Burkholderia_virus	100.0	6.0e-149
AWY60026.1|3679457_3680141_-|tail	phage minor tail protein L	tail	Q8W6T3	Burkholderia_virus	100.0	8.5e-134
AWY60027.1|3680137_3681526_-	hypothetical protein	NA	Q8W6T4	Burkholderia_virus	99.8	7.9e-272
AWY60514.1|3681534_3681873_-|tail	phage tail protein	tail	Q8W6T5	Burkholderia_virus	100.0	8.0e-61
AWY60028.1|3681872_3685934_-|tail	phage tail tape measure protein	tail	Q8W6T6	Burkholderia_virus	98.6	0.0e+00
AWY60029.1|3685947_3686232_-|tail	phage tail protein	tail	Q8W6T7	Burkholderia_virus	100.0	2.6e-44
AWY60030.1|3686231_3686696_-|tail	phage tail protein	tail	Q6JIM0	Burkholderia_virus	96.1	4.3e-81
AWY60031.1|3686723_3687182_-|tail	phage tail protein	tail	Q8W6T9	Burkholderia_virus	100.0	2.2e-77
AWY60032.1|3687243_3687591_-	hypothetical protein	NA	Q6JIM2	Burkholderia_virus	100.0	4.5e-59
AWY60033.1|3687587_3688010_-	hypothetical protein	NA	A4JX05	Burkholderia_virus	98.6	5.0e-68
AWY60034.1|3688002_3688329_-|head,tail	head-tail adaptor protein	head,tail	Q8W6U2	Burkholderia_virus	100.0	1.2e-56
AWY60035.1|3688328_3688895_-	hypothetical protein	NA	Q8W6U3	Burkholderia_virus	99.5	5.4e-102
AWY60036.1|3688901_3689087_-	hypothetical protein	NA	Q8W6U4	Burkholderia_virus	93.4	2.1e-23
AWY60037.1|3689146_3690454_-|capsid	phage major capsid protein	capsid	Q8W6U5	Burkholderia_virus	99.3	1.1e-227
AWY60038.1|3690556_3691525_-|capsid	capsid protein	capsid	A4JX00	Burkholderia_virus	95.3	8.0e-162
AWY60039.1|3691521_3692781_-|portal	phage portal protein	portal	Q8W6U7	Burkholderia_virus	99.8	4.7e-239
AWY60040.1|3692785_3692971_-	hypothetical protein	NA	Q8W6U8	Burkholderia_virus	93.4	3.2e-19
AWY60041.1|3692967_3694680_-|terminase	terminase	terminase	Q8W6U9	Burkholderia_virus	100.0	0.0e+00
AWY60042.1|3694689_3695175_-|terminase	terminase	terminase	Q8W6V0	Burkholderia_virus	100.0	1.0e-88
AWY60043.1|3695322_3695679_-	HNH endonuclease	NA	Q8W6N0	Burkholderia_virus	92.4	5.5e-60
AWY60044.1|3695739_3695997_+	addiction module toxin RelE	NA	Q8W6N1	Burkholderia_virus	100.0	2.4e-41
AWY60045.1|3695993_3696380_+	transcriptional regulator	NA	Q8W6N2	Burkholderia_virus	99.2	1.4e-64
AWY60046.1|3697249_3697513_+	hypothetical protein	NA	NA	NA	NA	NA
AWY60047.1|3697733_3699614_+	ATP-dependent endonuclease	NA	E5E3R2	Burkholderia_phage	76.8	3.8e-269
AWY60048.1|3699616_3700819_+	hypothetical protein	NA	NA	NA	NA	NA
AWY60049.1|3700887_3701178_+	hypothetical protein	NA	NA	NA	NA	NA
AWY60050.1|3701476_3702233_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AWY60051.1|3702246_3702915_-	hypothetical protein	NA	Q8W6N4	Burkholderia_virus	95.7	6.6e-107
AWY60052.1|3702923_3703184_-	hypothetical protein	NA	Q8W6N5	Burkholderia_virus	100.0	4.7e-45
AWY60053.1|3703159_3703492_-	hypothetical protein	NA	Q8W6N6	Burkholderia_virus	100.0	1.8e-60
AWY60054.1|3703494_3703935_-	hypothetical protein	NA	Q6JIF7	Burkholderia_virus	72.5	9.5e-54
AWY60055.1|3703931_3704288_-	hypothetical protein	NA	Q8W6N8	Burkholderia_virus	100.0	2.1e-59
AWY60056.1|3704284_3704836_-	hypothetical protein	NA	A4JX56	Burkholderia_virus	94.5	4.9e-92
AWY60057.1|3704832_3705825_-	helix-turn-helix domain-containing protein	NA	Q6JIG0	Burkholderia_virus	99.7	9.0e-177
AWY60058.1|3705978_3706239_-	helix-turn-helix domain-containing protein	NA	Q6JIG2	Burkholderia_virus	69.8	8.4e-26
AWY60059.1|3706235_3707057_-	hypothetical protein	NA	Q8W6P2	Burkholderia_virus	97.8	1.1e-143
AWY60060.1|3707091_3707898_-	hypothetical protein	NA	H2BDG1	Pseudomonas_virus	61.5	2.2e-32
AWY60061.1|3707912_3708353_-	hypothetical protein	NA	Q6JIG6	Burkholderia_virus	87.7	2.0e-67
AWY60062.1|3708567_3708786_+	hypothetical protein	NA	Q6JIG7	Burkholderia_virus	80.6	8.6e-24
AWY60063.1|3708782_3709115_-	hypothetical protein	NA	Q6JIG8	Burkholderia_virus	90.9	6.7e-52
AWY60064.1|3709794_3710097_-	hypothetical protein	NA	Q3HQY6	Burkholderia_phage	73.0	6.3e-33
AWY60515.1|3710736_3711126_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	39.8	1.8e-16
AWY60065.1|3711159_3711360_-	hypothetical protein	NA	NA	NA	NA	NA
AWY60066.1|3712629_3712905_+	hypothetical protein	NA	Q8W6Q1	Burkholderia_virus	93.4	6.8e-42
AWY60067.1|3712915_3713047_+	hypothetical protein	NA	Q8W6Q2	Burkholderia_virus	72.5	2.0e-07
AWY60068.1|3713497_3713647_+	hypothetical protein	NA	Q8W6Q6	Burkholderia_virus	89.8	4.1e-17
AWY60069.1|3713643_3714456_+|transposase	transposase	transposase	Q8W6Q7	Burkholderia_virus	94.4	2.7e-139
AWY60070.1|3714717_3715425_+	hypothetical protein	NA	Q8W6Q8	Burkholderia_virus	99.1	2.9e-121
AWY60071.1|3715438_3716110_+	hypothetical protein	NA	Q8W6Q9	Burkholderia_virus	100.0	1.4e-125
AWY60516.1|3716112_3716508_+	hypothetical protein	NA	Q8W6R0	Burkholderia_virus	99.2	8.5e-70
AWY60072.1|3716507_3716786_+	hypothetical protein	NA	Q6JII7	Burkholderia_virus	85.9	3.5e-38
AWY60517.1|3716989_3717853_+	hypothetical protein	NA	Q8W6R3	Burkholderia_virus	99.7	4.9e-155
AWY60073.1|3717849_3718842_+	phage Gp37/Gp68 family protein	NA	Q8W6R4	Burkholderia_virus	100.0	5.4e-206
AWY60074.1|3718838_3719339_+	hypothetical protein	NA	Q8W6R5	Burkholderia_virus	100.0	1.9e-90
AWY60075.1|3719464_3719689_+	hypothetical protein	NA	Q8W6R6	Burkholderia_virus	100.0	1.0e-35
AWY60076.1|3719688_3720789_+|integrase	integrase	integrase	Q8W6R7	Burkholderia_virus	100.0	1.9e-215
3720919:3720969	attR	CTGATTTGGGATCAGAGGGTCGTAGGTTCGAATCCTATCGCTCCGACCACT	NA	NA	NA	NA
>prophage 1
CP022215	Burkholderia thailandensis strain FDAARGOS_241 chromosome 2, complete sequence	2821560	634650	640716	2821560	integrase	Burkholderia_virus(28.57%)	9	629510:629525	649871:649886
629510:629525	attL	ATTCGGACGAGGCGGA	NA	NA	NA	NA
AWY60938.1|634650_635223_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	65.9	1.7e-55
AWY60939.1|635841_636339_+	hypothetical protein	NA	NA	NA	NA	NA
AWY60940.1|636579_636858_+	hypothetical protein	NA	NA	NA	NA	NA
AWY62592.1|636767_637184_-	HicB family protein	NA	A0A0A8JBA5	Ralstonia_phage	58.9	1.2e-26
AWY60941.1|637227_637407_-	addiction module toxin, HicA family	NA	A0A0D4DC32	Acinetobacter_phage	74.6	1.2e-18
AWY60942.1|637686_638214_+	hypothetical protein	NA	A4JWV5	Burkholderia_virus	66.1	6.2e-60
AWY60943.1|638210_638945_+	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	50.9	3.0e-52
AWY60944.1|638954_640070_+	hypothetical protein	NA	E5E3X7	Burkholderia_phage	80.4	8.6e-176
AWY62593.1|640140_640716_-	resolvase	NA	A0A219Y9V9	Aeromonas_phage	39.0	2.3e-23
649871:649886	attR	ATTCGGACGAGGCGGA	NA	NA	NA	NA
