The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032315	Bacillus subtilis strain MZK05 chromosome, complete genome	4145727	618132	626497	4145727		Synechococcus_phage(50.0%)	8	NA	NA
AYF10170.1|618132_619428_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.4	1.3e-18
AYF10171.1|619501_620227_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	7.0e-46
AYF10172.1|620219_620474_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AYF10173.1|620470_621154_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AYF10174.1|621137_623366_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	8.5e-159
AYF10175.1|623341_624772_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
AYF10176.1|624872_625913_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	3.7e-64
AYF10177.1|625909_626497_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.5	1.4e-28
>prophage 2
CP032315	Bacillus subtilis strain MZK05 chromosome, complete genome	4145727	1124258	1158166	4145727	tRNA,coat	Planktothrix_phage(20.0%)	37	NA	NA
AYF13590.1|1124258_1125251_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AYF10654.1|1125994_1127632_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYF10655.1|1127739_1128675_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AYF10656.1|1128678_1129596_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AYF10657.1|1129600_1130677_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	2.1e-17
AYF10658.1|1130678_1131596_+	oligopeptide transport ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
AYF10659.1|1131702_1132920_+	MFS transporter	NA	NA	NA	NA	NA
AYF10660.1|1133842_1134238_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AYF10661.1|1134283_1134940_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	38.0	1.1e-29
AYF10662.1|1135213_1135870_+	adaptor protein MecA	NA	NA	NA	NA	NA
AYF10663.1|1136030_1137182_+	competence protein CoiA	NA	NA	NA	NA	NA
AYF10664.1|1137228_1139241_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AYF10665.1|1139278_1139446_-	hypothetical protein	NA	NA	NA	NA	NA
AYF10666.1|1139760_1140660_-	DsbA family protein	NA	NA	NA	NA	NA
AYF10667.1|1140656_1141055_-	group 2 truncated hemoglobin YjbI	NA	NA	NA	NA	NA
AYF13591.1|1141309_1141855_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	61.0	4.8e-39
AYF10668.1|1142058_1142631_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AYF10669.1|1142755_1143124_+	hypothetical protein	NA	NA	NA	NA	NA
AYF10670.1|1143152_1143788_+	GTP pyrophosphokinase YjbM	NA	NA	NA	NA	NA
AYF10671.1|1143806_1144607_+	NAD(+) kinase	NA	NA	NA	NA	NA
AYF13592.1|1144669_1145521_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AYF10672.1|1145533_1146268_-	bis(5'-nucleosyl)-tetraphosphatase PrpE [asymmetrical]	NA	A8E2N0	Enterococcus_phage	24.8	7.2e-06
AYF10673.1|1146502_1148347_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AYF10674.1|1148595_1149306_+	thiaminase II	NA	NA	NA	NA	NA
AYF10675.1|1149280_1149898_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
AYF10676.1|1149881_1150991_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
AYF13593.1|1150990_1151191_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AYF10677.1|1151187_1151958_+	thiazole synthase	NA	NA	NA	NA	NA
AYF10678.1|1151954_1152965_+	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AYF10679.1|1152983_1153799_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AYF10680.1|1153934_1154711_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AYF10681.1|1154811_1155495_+|coat	spore coat protein	coat	NA	NA	NA	NA
AYF10682.1|1155587_1156037_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYF10683.1|1156164_1156653_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYF10684.1|1156804_1157323_-|coat	spore coat protein X	coat	NA	NA	NA	NA
AYF10685.1|1157421_1157739_-|coat	spore coat protein CotW	coat	NA	NA	NA	NA
AYF10686.1|1157779_1158166_-|coat	spore coat protein V	coat	NA	NA	NA	NA
>prophage 3
CP032315	Bacillus subtilis strain MZK05 chromosome, complete genome	4145727	1221593	1294040	4145727	tRNA,holin,terminase,portal,plate,protease	Bacillus_phage(23.81%)	85	NA	NA
AYF10747.1|1221593_1222865_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	A0A1V0SEI6	Indivirus	37.1	8.6e-15
AYF10748.1|1223009_1224146_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.4	4.9e-94
AYF10749.1|1224135_1224270_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
AYF10750.1|1224300_1224558_-	hypothetical protein	NA	NA	NA	NA	NA
AYF10751.1|1224678_1225632_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	73.8	1.6e-66
AYF10752.1|1225671_1226049_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	43.3	2.1e-17
AYF10753.1|1226153_1226756_+	hypothetical protein	NA	F8WQ53	Bacillus_phage	49.7	2.0e-46
AYF10754.1|1226832_1227669_+	manganese catalase family protein	NA	NA	NA	NA	NA
AYF10755.1|1227712_1228309_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
AYF10756.1|1228471_1228813_-	transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
AYF10757.1|1228991_1229171_+	hypothetical protein	NA	NA	NA	NA	NA
AYF10758.1|1229157_1229994_+	phage-like element PBSX protein XkdB	NA	S6BFM4	Thermus_phage	28.2	1.8e-24
AYF10759.1|1229893_1230694_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	1.1e-60
AYF10760.1|1230693_1230861_+	hypothetical protein	NA	NA	NA	NA	NA
AYF10761.1|1230945_1231296_+|portal	phage portal protein	portal	NA	NA	NA	NA
AYF10762.1|1231292_1231499_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	7.1e-12
AYF10763.1|1231614_1232124_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	38.6	1.9e-21
AYF10764.1|1232240_1233038_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	51.0	2.7e-59
AYF10765.1|1233034_1234336_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.5	6.3e-154
AYF10766.1|1234339_1235827_+	phage-like element PBSX protein XkdE	NA	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
AYF10767.1|1235846_1236674_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	58.7	2.1e-54
AYF10768.1|1236699_1237635_+	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
AYF10769.1|1237656_1238040_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	41.1	3.7e-14
AYF10770.1|1238036_1238393_+	phage-like element PBSX protein XkdH	NA	NA	NA	NA	NA
AYF10771.1|1238389_1238875_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.0	8.0e-38
AYF10772.1|1238887_1239328_+	phage-like element PBSX protein XkdJ	NA	NA	NA	NA	NA
AYF10773.1|1239331_1239550_+	hypothetical protein	NA	NA	NA	NA	NA
AYF10774.1|1239546_1240947_+	phage-like element PBSX protein XkdK	NA	A0A0A7S087	Clostridium_phage	39.3	2.3e-77
AYF10775.1|1240948_1241392_+	phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
AYF10776.1|1241484_1241931_+	phage-like element PBSX protein XkdN	NA	A0A249XXA9	Clostridium_phage	33.6	7.5e-14
AYF10777.1|1241960_1242110_+	hypothetical protein	NA	NA	NA	NA	NA
AYF10778.1|1242111_1245993_+	lytic transglycosylase	NA	A0A1L2JY60	Aeribacillus_phage	44.9	3.5e-43
AYF10779.1|1245985_1246645_+	phage-like element PBSX protein XkdP	NA	A0A090DBR9	Clostridium_phage	34.0	3.7e-25
AYF10780.1|1246660_1247638_+|portal	phage portal protein	portal	H7BV96	unidentified_phage	32.3	3.9e-39
AYF10781.1|1247637_1247904_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	34.1	8.4e-05
AYF10782.1|1247963_1248389_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	3.9e-12
AYF10783.1|1248381_1249428_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.0	3.7e-72
AYF10784.1|1249411_1249990_+	DUF2313 domain-containing protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.1	5.1e-15
AYF10785.1|1249986_1250259_+	hypothetical protein	NA	NA	NA	NA	NA
AYF10786.1|1250261_1252319_+|terminase	terminase	terminase	A0A2H4J4R1	uncultured_Caudovirales_phage	34.9	6.9e-30
AYF10787.1|1252332_1252662_+|portal	phage portal protein	portal	NA	NA	NA	NA
AYF10788.1|1252658_1252823_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	66.0	7.2e-15
AYF10789.1|1252866_1253706_+|portal	phage portal protein	portal	NA	NA	NA	NA
AYF10790.1|1253758_1254028_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	6.2e-24
AYF10791.1|1254040_1254304_+|holin	holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	4.7e-24
AYF10792.1|1254316_1255210_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	69.2	5.2e-83
AYF10793.1|1255469_1255640_-	type II toxin-antitoxin system SpoIISB family antitoxin	NA	NA	NA	NA	NA
AYF10794.1|1255639_1256386_-	type II toxin-antitoxin system SpoIISA family toxin	NA	NA	NA	NA	NA
AYF10795.1|1256495_1257497_-	low-affinity inorganic phosphate transporter	NA	NA	NA	NA	NA
AYF10796.1|1257509_1258127_-	DUF47 domain-containing protein	NA	NA	NA	NA	NA
AYF10797.1|1258402_1259719_-	amino acid permease	NA	NA	NA	NA	NA
AYF10798.1|1260106_1261057_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
AYF10799.1|1261311_1263480_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
AYF10800.1|1263491_1264463_+	glycosyltransferase	NA	A0A2H5BFL1	Salmonella_phage	41.0	1.9e-62
AYF10801.1|1264980_1266339_-|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	33.7	5.8e-25
AYF10802.1|1266507_1267326_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
AYF10803.1|1267454_1268279_+	aminopeptidase	NA	NA	NA	NA	NA
AYF10804.1|1268295_1269222_+	ABC transporter permease	NA	NA	NA	NA	NA
AYF10805.1|1269227_1270190_+	ABC transporter permease	NA	NA	NA	NA	NA
AYF10806.1|1270194_1271202_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	2.4e-15
AYF13599.1|1271204_1272854_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYF10807.1|1272941_1273901_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
AYF10808.1|1273897_1274998_+	dipeptide epimerase	NA	NA	NA	NA	NA
AYF10809.1|1274994_1275885_+	NlpC/P60 family protein	NA	A0A0A8WIF2	Clostridium_phage	41.9	2.0e-18
AYF10810.1|1275897_1276887_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	3.2e-17
AYF10811.1|1276930_1277980_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AYF10812.1|1278069_1278930_-	hypothetical protein	NA	NA	NA	NA	NA
AYF13600.1|1279089_1279608_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AYF10813.1|1279847_1281047_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AYF10814.1|1281123_1281348_-	hypothetical protein	NA	NA	NA	NA	NA
AYF10815.1|1281492_1282224_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AYF10816.1|1282315_1282843_+	DinB family protein	NA	NA	NA	NA	NA
AYF10817.1|1282832_1283351_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYF10818.1|1283572_1283911_+	multidrug efflux SMR transporter subunit YkkC	NA	NA	NA	NA	NA
AYF10819.1|1283910_1284228_+	multidrug efflux SMR transporter subunit YkkD	NA	NA	NA	NA	NA
AYF10820.1|1284298_1285201_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
AYF10821.1|1285551_1286649_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.8	1.1e-69
AYF10822.1|1286660_1287908_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.4	3.3e-99
AYF10823.1|1288033_1288459_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
AYF10824.1|1288490_1288934_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYF10825.1|1289076_1289487_+	organic hydroperoxide resistance protein OhrB	NA	NA	NA	NA	NA
AYF10826.1|1289513_1289684_+	hypothetical protein	NA	NA	NA	NA	NA
AYF10827.1|1289733_1290204_-|tRNA	tRNA-specific adenosine deaminase	tRNA	S4VYZ2	Pandoravirus	45.8	1.8e-26
AYF10828.1|1290376_1292665_-	5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase	NA	NA	NA	NA	NA
AYF10829.1|1293080_1294040_-|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	49.5	5.6e-75
>prophage 4
CP032315	Bacillus subtilis strain MZK05 chromosome, complete genome	4145727	1780496	1854024	4145727	bacteriocin,tail,integrase	Bacillus_phage(90.62%)	81	1808404:1808420	1836626:1836642
AYF11241.1|1780496_1780889_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
AYF11242.1|1780848_1782951_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
AYF11243.1|1782968_1783958_+	ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
AYF11244.1|1784007_1784628_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
AYF11245.1|1784691_1785459_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.0	7.0e-52
AYF11246.1|1786091_1786733_+	AAA family ATPase	NA	G3MAX6	Bacillus_virus	42.5	8.5e-27
AYF11247.1|1786756_1787050_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYF11248.1|1787512_1788046_+	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	99.4	5.1e-94
AYF11249.1|1788170_1789055_-	endonuclease	NA	A0A1P8CWK6	Bacillus_phage	94.9	1.4e-112
AYF11250.1|1789568_1790102_+	SMI1/KNR4 family protein	NA	A0A1P8CWM2	Bacillus_phage	96.3	2.8e-07
AYF11251.1|1790239_1792126_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	81.4	2.9e-160
AYF11252.1|1792138_1792597_+	SMI1/KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	84.9	1.2e-70
AYF11253.1|1792652_1793234_+	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	86.5	4.0e-92
AYF11254.1|1794084_1795197_+	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	48.9	3.4e-92
AYF11255.1|1795951_1796683_+	hypothetical protein	NA	NA	NA	NA	NA
AYF13620.1|1797235_1797529_+	YolD-like family protein	NA	O64030	Bacillus_phage	96.9	1.7e-46
AYF11256.1|1797521_1798772_+	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	96.9	4.5e-234
AYF11257.1|1798873_1799191_+	hypothetical protein	NA	NA	NA	NA	NA
AYF11258.1|1799486_1799657_+|bacteriocin	SPBc2 prophage-derived bacteriocin sublancin-168	bacteriocin	NA	NA	NA	NA
AYF11259.1|1799714_1801832_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	24.6	2.0e-24
AYF11260.1|1801828_1802242_+	thioredoxin	NA	NA	NA	NA	NA
AYF11261.1|1802241_1803510_+	SunS family peptide S-glycosyltransferase	NA	NA	NA	NA	NA
AYF11262.1|1803506_1803953_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
AYF11263.1|1804010_1804277_-	SPBc2 prophage-derived protein BhlB	NA	A0A2H4J6M0	uncultured_Caudovirales_phage	50.0	1.1e-15
AYF11264.1|1804287_1804500_-	SPBc2 prophage-derived protein BhlA	NA	A0A290GDY2	Caldibacillus_phage	59.7	4.2e-15
AYF11265.1|1804585_1805632_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1J0MS59	Bacillus_phage	52.3	1.6e-83
AYF11266.1|1805805_1807740_-	hypothetical protein	NA	A0A1P8CWN9	Bacillus_phage	99.7	0.0e+00
AYF13621.1|1807776_1808598_-	hypothetical protein	NA	A0A1P8CWP7	Bacillus_phage	99.3	3.5e-134
1808404:1808420	attL	ATCTTCAATTTCTCGCC	NA	NA	NA	NA
AYF11267.1|1808613_1811256_-	hypothetical protein	NA	A0A1P8CWQ0	Bacillus_phage	96.7	0.0e+00
AYF11268.1|1811268_1812030_-|tail	phage tail protein	tail	A0A1P8CWP8	Bacillus_phage	96.2	3.8e-127
AYF11269.1|1812073_1818952_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	74.6	0.0e+00
AYF11270.1|1819005_1819689_-	immunity protein	NA	Q37974	Bacillus_phage	93.4	3.2e-109
AYF11271.1|1820049_1820883_+	hypothetical protein	NA	NA	NA	NA	NA
AYF11272.1|1820902_1821097_+	hypothetical protein	NA	NA	NA	NA	NA
AYF11273.1|1821252_1821663_-	hypothetical protein	NA	NA	NA	NA	NA
AYF11274.1|1821794_1822796_-|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	98.2	8.4e-191
AYF13622.1|1822809_1823229_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	79.7	1.9e-56
AYF11275.1|1823228_1823717_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	73.1	2.7e-57
AYF11276.1|1823768_1823960_-	XkdX family protein	NA	A0A1P8CWR4	Bacillus_phage	96.8	2.3e-28
AYF11277.1|1823956_1824307_-	hypothetical protein	NA	O64053	Bacillus_phage	100.0	5.4e-60
AYF11278.1|1824317_1825535_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	97.5	8.5e-169
AYF11279.1|1825536_1825893_-	hypothetical protein	NA	O64055	Bacillus_phage	98.3	8.8e-58
AYF11280.1|1825956_1826184_-	hypothetical protein	NA	A0A1P8CWR2	Bacillus_phage	98.7	5.4e-37
AYF11281.1|1826183_1826795_-	hypothetical protein	NA	A0A1P8CWQ5	Bacillus_phage	99.5	7.5e-65
AYF11282.1|1826812_1827610_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	99.2	3.0e-90
AYF11283.1|1827652_1828363_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	100.0	1.8e-131
AYF11284.1|1828359_1828866_-	hypothetical protein	NA	O64060	Bacillus_phage	100.0	5.9e-92
AYF11285.1|1828862_1829513_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	100.0	3.2e-122
AYF11286.1|1829496_1829751_-	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	98.8	6.5e-39
AYF11287.1|1829747_1830143_-	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	100.0	2.5e-69
AYF11288.1|1830157_1830628_-	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	99.4	1.1e-81
AYF11289.1|1830663_1831680_-	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	99.7	2.9e-186
AYF11290.1|1831718_1832255_-	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	98.3	1.1e-93
AYF11291.1|1832279_1833716_-	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	98.3	3.5e-262
AYF11292.1|1833746_1835267_-	hypothetical protein	NA	O64068	Bacillus_phage	98.8	1.1e-279
AYF11293.1|1835284_1837054_-	hypothetical protein	NA	O64069	Bacillus_phage	99.7	0.0e+00
1836626:1836642	attR	ATCTTCAATTTCTCGCC	NA	NA	NA	NA
AYF11294.1|1837040_1837961_-	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	100.0	5.4e-176
AYF11295.1|1838063_1838588_-	hypothetical protein	NA	U5J9P3	Bacillus_phage	38.9	2.5e-21
AYF11296.1|1838620_1838950_-	hypothetical protein	NA	NA	NA	NA	NA
AYF11297.1|1838986_1839442_-	hypothetical protein	NA	NA	NA	NA	NA
AYF11298.1|1839455_1840655_-	hypothetical protein	NA	W5RV85	Staphylococcus_phage	40.8	3.5e-66
AYF13623.1|1840666_1840876_-	hypothetical protein	NA	NA	NA	NA	NA
AYF11299.1|1842385_1842661_-	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	94.5	2.7e-38
AYF11300.1|1842921_1845447_-	hypothetical protein	NA	O64076	Bacillus_phage	90.9	0.0e+00
AYF11301.1|1845486_1845681_-	hypothetical protein	NA	O64077	Bacillus_phage	95.3	1.1e-27
AYF11302.1|1846639_1846816_+	hypothetical protein	NA	O64080	Bacillus_phage	94.9	2.6e-10
AYF11303.1|1846834_1847086_+	hypothetical protein	NA	A0A1P8CWU4	Bacillus_phage	95.8	9.3e-30
AYF11304.1|1847130_1847319_+	hypothetical protein	NA	O64081	Bacillus_phage	96.8	9.7e-24
AYF11305.1|1847400_1848618_+	hypothetical protein	NA	A0A1P8CWT6	Bacillus_phage	82.9	4.2e-200
AYF11306.1|1848933_1849371_+	hypothetical protein	NA	NA	NA	NA	NA
AYF11307.1|1849419_1849599_+	hypothetical protein	NA	A0A1P8CWU9	Bacillus_phage	88.1	6.0e-23
AYF11308.1|1849617_1849809_+	hypothetical protein	NA	A0A1P8CWV3	Bacillus_phage	80.6	2.3e-20
AYF11309.1|1849895_1850192_+	hypothetical protein	NA	NA	NA	NA	NA
AYF11310.1|1850229_1850565_+	hypothetical protein	NA	NA	NA	NA	NA
AYF11311.1|1850572_1851031_+	hypothetical protein	NA	O64087	Bacillus_phage	31.0	2.4e-07
AYF13624.1|1851217_1851445_+	XRE family transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	88.9	2.2e-30
AYF11312.1|1851568_1853038_+	hypothetical protein	NA	NA	NA	NA	NA
AYF11313.1|1853160_1853340_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	96.6	3.6e-28
AYF11314.1|1853410_1853662_+	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	98.8	3.5e-37
AYF11315.1|1853665_1853881_+	hypothetical protein	NA	O64089	Bacillus_phage	93.0	7.9e-30
AYF11316.1|1853892_1854024_+	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	95.3	5.5e-18
>prophage 5
CP032315	Bacillus subtilis strain MZK05 chromosome, complete genome	4145727	1857617	1915469	4145727	integrase	Bacillus_phage(95.12%)	100	1857583:1857604	1877161:1877182
1857583:1857604	attL	AAAGATAAAAAATATGTATATA	NA	NA	NA	NA
AYF11321.1|1857617_1857818_+	hypothetical protein	NA	O64096	Bacillus_phage	98.5	2.0e-27
AYF11322.1|1857820_1858138_+	hypothetical protein	NA	NA	NA	NA	NA
AYF11323.1|1858186_1858399_+	XRE family transcriptional regulator	NA	O64098	Bacillus_phage	95.7	1.6e-27
AYF11324.1|1858388_1859465_+|integrase	site-specific integrase	integrase	O64099	Bacillus_phage	99.2	5.0e-197
AYF11325.1|1859571_1860954_+	hypothetical protein	NA	O64100	Bacillus_phage	100.0	1.3e-263
AYF11326.1|1860977_1861955_+	hypothetical protein	NA	O64101	Bacillus_phage	99.7	4.0e-177
AYF11327.1|1862143_1862368_-	XRE family transcriptional regulator	NA	O64102	Bacillus_phage	100.0	1.9e-34
AYF11328.1|1862550_1862769_+	hypothetical protein	NA	O64103	Bacillus_phage	100.0	6.6e-32
AYF11329.1|1862838_1863036_+	hypothetical protein	NA	O64104	Bacillus_phage	98.5	6.8e-28
AYF11330.1|1863147_1863342_+	hypothetical protein	NA	O64105	Bacillus_phage	100.0	1.9e-27
AYF13625.1|1863919_1864348_+	hypothetical protein	NA	M4ZRL6	Bacillus_phage	53.0	2.4e-30
AYF11331.1|1864498_1864696_+	hypothetical protein	NA	A0A1P8CWX9	Bacillus_phage	95.4	2.4e-25
AYF11332.1|1864714_1865065_+	hypothetical protein	NA	A0A1P8CWX8	Bacillus_phage	85.2	3.5e-51
AYF11333.1|1865061_1865244_+	hypothetical protein	NA	NA	NA	NA	NA
AYF11334.1|1865312_1866047_+	hypothetical protein	NA	A0A0A8WIT2	Clostridium_phage	58.8	9.6e-67
AYF11335.1|1866046_1866394_+	hypothetical protein	NA	NA	NA	NA	NA
AYF11336.1|1866460_1866907_+	hypothetical protein	NA	NA	NA	NA	NA
AYF11337.1|1866937_1867159_+	hypothetical protein	NA	NA	NA	NA	NA
AYF11338.1|1867271_1867529_+	hypothetical protein	NA	A0A1P8CWY1	Bacillus_phage	96.5	1.5e-43
AYF11339.1|1867561_1867954_+	hypothetical protein	NA	A0A0A8WEI8	Clostridium_phage	46.6	1.1e-24
AYF11340.1|1867946_1868165_+	hypothetical protein	NA	NA	NA	NA	NA
AYF11341.1|1868142_1868358_+	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	97.2	6.5e-32
AYF11342.1|1868374_1868749_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	99.2	3.7e-59
AYF11343.1|1868862_1869153_+	hypothetical protein	NA	A0A1P8CWY9	Bacillus_phage	95.8	1.5e-47
AYF11344.1|1869184_1869394_+	hypothetical protein	NA	NA	NA	NA	NA
AYF11345.1|1869467_1869620_-	hypothetical protein	NA	O64128	Bacillus_phage	84.0	1.3e-15
AYF11346.1|1869859_1870672_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	94.4	4.2e-148
AYF11347.1|1870741_1871416_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	95.8	6.1e-76
AYF11348.1|1871483_1871705_+	hypothetical protein	NA	A0A1P8CWZ6	Bacillus_phage	93.2	7.9e-33
AYF11349.1|1871754_1872957_+	hypothetical protein	NA	A0A2C9CZ84	Yersinia_phage	37.1	1.1e-40
AYF11350.1|1872993_1873389_+	hypothetical protein	NA	O64133	Bacillus_phage	92.4	2.8e-65
AYF11351.1|1873486_1874311_+	hypothetical protein	NA	O64134	Bacillus_phage	96.4	2.2e-144
AYF11352.1|1874307_1876068_+	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	96.6	0.0e+00
AYF11353.1|1876153_1876450_+	hypothetical protein	NA	O64136	Bacillus_phage	84.0	7.1e-37
AYF11354.1|1876515_1876905_+	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	97.6	4.3e-66
AYF11355.1|1877216_1877588_+	hypothetical protein	NA	O64139	Bacillus_phage	95.1	3.6e-62
1877161:1877182	attR	AAAGATAAAAAATATGTATATA	NA	NA	NA	NA
AYF11356.1|1877609_1878524_+	hypothetical protein	NA	O64140	Bacillus_phage	89.5	3.6e-156
AYF11357.1|1878607_1879579_+	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	100.0	1.7e-180
AYF11358.1|1879621_1880092_+	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	98.1	3.5e-86
AYF11359.1|1880106_1881621_+	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	99.4	5.2e-285
AYF11360.1|1881636_1882773_+	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	98.1	8.0e-222
AYF11361.1|1882772_1884503_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	99.7	0.0e+00
AYF11362.1|1884515_1888433_+	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	98.5	0.0e+00
AYF13626.1|1888461_1889178_+	hypothetical protein	NA	O64147	Bacillus_phage	81.1	1.2e-101
AYF11363.1|1889286_1889445_+	hypothetical protein	NA	A0A1P8CX11	Bacillus_phage	88.5	2.1e-19
AYF11364.1|1889481_1889679_+	hypothetical protein	NA	O64149	Bacillus_phage	96.9	2.1e-29
AYF13627.1|1889711_1889927_+	hypothetical protein	NA	O64150	Bacillus_phage	98.6	3.0e-37
AYF11365.1|1889919_1890075_+	hypothetical protein	NA	A0A1P8CX36	Bacillus_phage	94.1	5.7e-22
AYF11366.1|1890074_1890572_+	hypothetical protein	NA	A0A1P8CX28	Bacillus_phage	90.9	1.3e-80
AYF11367.1|1890611_1890959_-	hypothetical protein	NA	NA	NA	NA	NA
AYF11368.1|1891083_1891350_+	hypothetical protein	NA	NA	NA	NA	NA
AYF11369.1|1891398_1892718_+	DNA cytosine methyltransferase	NA	Q02778	Bacillus_phage	63.1	4.6e-168
AYF11370.1|1892761_1892980_+	hypothetical protein	NA	A0A1P8CX26	Bacillus_phage	98.6	1.2e-30
AYF11371.1|1892982_1893348_+	hypothetical protein	NA	O64156	Bacillus_phage	96.7	1.7e-61
AYF11372.1|1893387_1893615_+	hypothetical protein	NA	A0A1P8CX31	Bacillus_phage	93.3	4.7e-33
AYF13628.1|1893628_1893811_+	hypothetical protein	NA	O64158	Bacillus_phage	100.0	1.5e-26
AYF11373.1|1893877_1894090_+	hypothetical protein	NA	O64159	Bacillus_phage	95.7	2.6e-33
AYF11374.1|1894182_1894332_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
AYF11375.1|1894464_1895013_+	metallophosphoesterase	NA	A0A223LD99	Bacillus_phage	59.4	9.7e-56
AYF11376.1|1895077_1895281_+	hypothetical protein	NA	A0A1P8CX41	Bacillus_phage	47.2	2.9e-05
AYF11377.1|1895264_1895450_+	hypothetical protein	NA	NA	NA	NA	NA
AYF11378.1|1895492_1895888_+	hypothetical protein	NA	O64163	Bacillus_phage	94.7	2.5e-69
AYF11379.1|1895902_1896250_+	hypothetical protein	NA	O64164	Bacillus_phage	95.7	5.7e-54
AYF11380.1|1896347_1896626_+	hypothetical protein	NA	NA	NA	NA	NA
AYF11381.1|1896661_1896937_+	hypothetical protein	NA	A0A222Z5X2	Bacillus_phage	66.7	1.5e-28
AYF11382.1|1896974_1897166_+	hypothetical protein	NA	S6BUY9	Bacillus_phage	48.4	1.4e-09
AYF13629.1|1897180_1897396_+	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	64.8	6.1e-22
AYF11383.1|1897409_1897544_+	hypothetical protein	NA	O64168	Bacillus_phage	93.2	8.1e-17
AYF11384.1|1897563_1897758_+	hypothetical protein	NA	O64169	Bacillus_phage	98.4	1.7e-31
AYF13630.1|1897806_1898007_+	hypothetical protein	NA	O64170	Bacillus_phage	97.0	1.0e-31
AYF11385.1|1898098_1898446_+	hypothetical protein	NA	A0A1P8CX44	Bacillus_phage	55.0	3.3e-25
AYF13631.1|1898451_1898841_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	91.5	1.3e-59
AYF13632.1|1898848_1899526_+	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	88.0	7.4e-106
AYF11386.1|1901421_1901700_+	hypothetical protein	NA	A0A1P8CX32	Bacillus_phage	94.2	9.9e-33
AYF11387.1|1902240_1902762_+	HNH endonuclease	NA	A0A1P8CX39	Bacillus_phage	91.3	7.7e-87
AYF11388.1|1903342_1903585_+	thiol reductase thioredoxin	NA	A0A1P8CX24	Bacillus_phage	92.5	3.7e-36
AYF11389.1|1903627_1903990_+	hypothetical protein	NA	A0A172JI43	Bacillus_phage	40.5	3.5e-14
AYF11390.1|1904061_1904490_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A0A1P8CX51	Bacillus_phage	93.7	4.0e-73
AYF11391.1|1904577_1904760_+	hypothetical protein	NA	NA	NA	NA	NA
AYF11392.1|1905084_1905378_+	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	95.7	2.5e-42
AYF11393.1|1905374_1905590_+	hypothetical protein	NA	A0A1P8CX47	Bacillus_phage	100.0	3.7e-35
AYF11394.1|1905704_1906049_+	hypothetical protein	NA	A0A1P8CX52	Bacillus_phage	81.6	2.2e-45
AYF11395.1|1906105_1906945_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	96.4	3.4e-161
AYF11396.1|1906944_1907466_+	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	44.1	5.2e-35
AYF11397.1|1907590_1907953_+	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	66.7	2.4e-34
AYF11398.1|1907956_1908253_+	hypothetical protein	NA	R4JEY6	Bacillus_phage	79.4	1.0e-35
AYF11399.1|1908253_1908475_+	hypothetical protein	NA	NA	NA	NA	NA
AYF11400.1|1908633_1908834_+	hypothetical protein	NA	A0A1P8CX75	Bacillus_phage	57.9	2.1e-08
AYF11401.1|1908867_1909086_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	94.4	3.1e-29
AYF11402.1|1909203_1910031_+	metallophosphoesterase	NA	O64184	Bacillus_phage	93.5	2.2e-160
AYF11403.1|1910077_1910383_+	hypothetical protein	NA	NA	NA	NA	NA
AYF11404.1|1910594_1911011_+	hypothetical protein	NA	NA	NA	NA	NA
AYF13633.1|1911090_1911423_+	hypothetical protein	NA	A0A1P8CX53	Bacillus_phage	60.4	5.2e-28
AYF11405.1|1911403_1911952_+	hypothetical protein	NA	NA	NA	NA	NA
AYF11406.1|1911952_1912126_+	hypothetical protein	NA	O64190	Bacillus_phage	86.0	3.5e-20
AYF11407.1|1912122_1912374_+	hypothetical protein	NA	NA	NA	NA	NA
AYF11408.1|1912435_1912621_+	hypothetical protein	NA	O64193	Bacillus_phage	94.8	7.3e-24
AYF11409.1|1912622_1912865_-	XRE family transcriptional regulator	NA	A0A1P8CX60	Bacillus_phage	91.2	1.4e-35
AYF11410.1|1912937_1913537_+	hypothetical protein	NA	O64195	Bacillus_phage	91.4	1.2e-94
AYF11411.1|1913768_1915469_+	recombinase family protein	NA	B8R885	Bacillus_phage	24.3	4.7e-16
>prophage 6
CP032315	Bacillus subtilis strain MZK05 chromosome, complete genome	4145727	2308770	2314867	4145727		Staphylococcus_phage(66.67%)	8	NA	NA
AYF11794.1|2308770_2309364_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.0e-14
AYF13652.1|2309353_2310109_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	5.5e-09
AYF11795.1|2310390_2310915_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
AYF11796.1|2310928_2311303_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYF11797.1|2311415_2311880_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
AYF11798.1|2311912_2313109_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.4	2.2e-113
AYF11799.1|2313123_2313771_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	8.5e-43
AYF11800.1|2313781_2314867_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	6.6e-56
>prophage 7
CP032315	Bacillus subtilis strain MZK05 chromosome, complete genome	4145727	2542258	2580080	4145727	holin,terminase,capsid,portal,tail,plate	uncultured_Caudovirales_phage(30.3%)	53	NA	NA
AYF12044.1|2542258_2543854_+	ribonuclease YqcG	NA	A0A1P8CWI7	Bacillus_phage	61.3	6.9e-78
AYF12045.1|2543868_2544447_+	suppressor of fused domain protein	NA	NA	NA	NA	NA
AYF12046.1|2544707_2545070_-	hypothetical protein	NA	NA	NA	NA	NA
AYF12047.1|2545085_2545565_-	hypothetical protein	NA	NA	NA	NA	NA
AYF12048.1|2545729_2546548_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	73.8	3.8e-64
AYF12049.1|2546592_2547015_-|holin	holin family protein	holin	D6R405	Bacillus_phage	72.9	1.7e-47
AYF12050.1|2547060_2547954_-|portal	phage portal protein	portal	NA	NA	NA	NA
AYF12051.1|2548041_2548206_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	2.7e-14
AYF12052.1|2548202_2548538_-|portal	phage portal protein	portal	NA	NA	NA	NA
AYF12053.1|2548547_2549648_-	hypothetical protein	NA	M4ZRP1	Bacillus_phage	56.1	1.7e-19
AYF12054.1|2549651_2549924_-	hypothetical protein	NA	NA	NA	NA	NA
AYF12055.1|2549920_2550499_-	DUF2313 domain-containing protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.8	1.9e-14
AYF12056.1|2550482_2551529_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.0	4.8e-72
AYF12057.1|2551521_2551947_-	DUF2634 domain-containing protein	NA	A0A0A8WJV8	Clostridium_phage	33.3	5.6e-11
AYF12058.1|2551959_2552223_-	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
AYF12059.1|2552219_2553200_-|portal	phage portal protein	portal	H7BV96	unidentified_phage	32.0	2.1e-40
AYF12060.1|2553212_2553872_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.7	4.8e-25
AYF12061.1|2553864_2558622_-	hypothetical protein	NA	A0A1L2JY60	Aeribacillus_phage	47.2	1.3e-44
AYF12062.1|2558624_2558762_-	hypothetical protein	NA	NA	NA	NA	NA
AYF12063.1|2558803_2559253_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	41.1	2.7e-11
AYF12064.1|2559398_2559578_+	type I toxin-antitoxin system toxin TxpA	NA	NA	NA	NA	NA
AYF12065.1|2559957_2560047_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AYF12066.1|2560300_2560744_-|portal	phage portal protein	portal	A0A0K2CNG3	Brevibacillus_phage	45.4	3.2e-25
AYF12067.1|2560746_2562147_-|tail	phage tail sheath protein	tail	S5MNC1	Brevibacillus_phage	39.1	4.1e-74
AYF12068.1|2562147_2562339_-	hypothetical protein	NA	NA	NA	NA	NA
AYF12069.1|2562335_2562773_-|portal	phage portal protein	portal	NA	NA	NA	NA
AYF12070.1|2562785_2563289_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.9	8.3e-38
AYF12071.1|2563285_2563648_-	DUF3599 family protein	NA	A0A249XXE9	Clostridium_phage	39.3	6.9e-10
AYF12072.1|2563644_2564040_-	DUF3199 family protein	NA	NA	NA	NA	NA
AYF12073.1|2564043_2564355_-	hypothetical protein	NA	NA	NA	NA	NA
AYF12074.1|2564365_2565301_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	65.0	8.6e-105
AYF12075.1|2565319_2566291_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	70.3	2.0e-59
AYF12076.1|2566296_2566863_-	hypothetical protein	NA	NA	NA	NA	NA
AYF12077.1|2566905_2567823_-	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	39.1	2.2e-52
AYF12078.1|2567819_2569352_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	51.5	1.4e-147
AYF12079.1|2569355_2570651_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	63.2	8.7e-156
AYF12080.1|2570643_2571363_-	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	60.9	7.0e-62
AYF12081.1|2571886_2572075_-	hypothetical protein	NA	NA	NA	NA	NA
AYF12082.1|2572219_2572675_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	73.5	3.5e-59
AYF12083.1|2572765_2573419_-	hypothetical protein	NA	NA	NA	NA	NA
AYF12084.1|2573485_2573692_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	71.2	1.6e-19
AYF12085.1|2573773_2574202_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	64.2	4.8e-42
AYF12086.1|2574297_2574447_-	hypothetical protein	NA	NA	NA	NA	NA
AYF12087.1|2574437_2575379_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	52.2	2.1e-58
AYF13665.1|2575260_2575938_-	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	32.2	1.5e-05
AYF12088.1|2576014_2576869_-	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	77.6	5.6e-119
AYF13666.1|2576871_2577843_-	hypothetical protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	70.4	8.9e-129
AYF12089.1|2577931_2578126_-	hypothetical protein	NA	NA	NA	NA	NA
AYF12090.1|2578255_2578513_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	42.2	6.4e-10
AYF12091.1|2578509_2579079_-	XRE family transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	61.0	1.5e-64
AYF12092.1|2579152_2579293_-	hypothetical protein	NA	NA	NA	NA	NA
AYF12093.1|2579322_2579553_-	XRE family transcriptional regulator	NA	A8ATK0	Listeria_phage	53.4	1.1e-08
AYF12094.1|2579729_2580080_+	helix-turn-helix domain-containing protein	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	30.6	2.0e-06
>prophage 8
CP032315	Bacillus subtilis strain MZK05 chromosome, complete genome	4145727	3741007	3750353	4145727	bacteriocin,tRNA	Staphylococcus_phage(100.0%)	11	NA	NA
AYF13182.1|3741007_3742678_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
AYF13183.1|3742674_3743103_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
AYF13184.1|3743415_3743547_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
AYF13185.1|3743503_3743656_+|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
AYF13186.1|3743680_3745027_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
AYF13187.1|3745039_3745201_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
AYF13188.1|3745197_3745917_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	7.3e-19
AYF13189.1|3745909_3747220_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
AYF13720.1|3747209_3748370_+|bacteriocin	bacteriocin biosynthesis zinc-dependent peptidase AlbE	bacteriocin	NA	NA	NA	NA
AYF13190.1|3748374_3749655_+	insulinase family protein	NA	NA	NA	NA	NA
AYF13191.1|3749651_3750353_+|bacteriocin	bacteriocin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
>prophage 9
CP032315	Bacillus subtilis strain MZK05 chromosome, complete genome	4145727	3763860	3805129	4145727	tRNA,protease,coat	Enterobacteria_phage(20.0%)	41	NA	NA
AYF13207.1|3763860_3764520_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AYF13208.1|3764628_3764817_+	2-hydroxymuconate tautomerase	NA	NA	NA	NA	NA
AYF13209.1|3764859_3765279_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYF13210.1|3765398_3767315_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	43.4	2.5e-143
AYF13211.1|3768159_3769560_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
AYF13212.1|3769559_3770030_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AYF13213.1|3770141_3770642_-	YwgA family protein	NA	NA	NA	NA	NA
AYF13214.1|3770677_3771979_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	9.4e-25
AYF13215.1|3772140_3772365_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
AYF13216.1|3772580_3773357_+	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
AYF13217.1|3773500_3774391_-	DMT family transporter	NA	NA	NA	NA	NA
AYF13218.1|3774558_3775404_-	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
AYF13219.1|3775452_3776352_-	transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
AYF13220.1|3776497_3777469_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
AYF13721.1|3777753_3778503_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
AYF13221.1|3778635_3779415_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYF13222.1|3779429_3780629_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AYF13223.1|3780629_3781814_-	MFS transporter	NA	NA	NA	NA	NA
AYF13224.1|3781810_3783229_-	alanine-anticapsin ligase BacD	NA	NA	NA	NA	NA
AYF13225.1|3783247_3784015_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	6.4e-21
AYF13226.1|3784011_3784719_-	bacilysin biosynthesis protein BacB	NA	NA	NA	NA	NA
AYF13227.1|3784708_3785323_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
AYF13228.1|3785474_3786713_-	MFS transporter	NA	NA	NA	NA	NA
AYF13229.1|3786921_3788334_-	amino acid permease	NA	NA	NA	NA	NA
AYF13230.1|3788333_3790034_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
AYF13231.1|3790107_3791655_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYF13232.1|3791881_3793156_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
AYF13233.1|3793333_3793798_-	hypothetical protein	NA	NA	NA	NA	NA
AYF13234.1|3794121_3794577_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYF13235.1|3794569_3795421_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.9	3.7e-38
AYF13236.1|3795434_3796382_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
AYF13237.1|3796381_3797122_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	41.9	3.4e-48
AYF13238.1|3797146_3798166_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYF13239.1|3798168_3798891_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYF13240.1|3798883_3800005_-|coat	spore coat biosynthesis protein SpsE	coat	NA	NA	NA	NA
AYF13241.1|3800004_3800874_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYF13242.1|3800874_3802044_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	26.6	1.2e-15
AYF13243.1|3802064_3803489_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
AYF13244.1|3803493_3804264_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	28.6	5.8e-06
AYF13245.1|3804229_3804436_-	hypothetical protein	NA	NA	NA	NA	NA
AYF13246.1|3804583_3805129_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
