The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032310	Bacillus subtilis strain WB800N chromosome, complete genome	4214174	1211203	1245108	4214174	coat,tRNA	Planktothrix_phage(20.0%)	39	NA	NA
AYE66724.1|1211203_1212196_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AYE63745.1|1212939_1214577_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYE63746.1|1214684_1215620_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AYE63747.1|1215623_1216541_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AYE63748.1|1216545_1217622_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	2.1e-17
AYE63749.1|1217623_1218541_+	oligopeptide transport ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.2e-05
AYE63750.1|1218647_1219865_+	MFS transporter	NA	NA	NA	NA	NA
AYE63751.1|1220028_1220607_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYE63752.1|1220787_1221183_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AYE63753.1|1221225_1221882_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	38.0	1.1e-29
AYE63754.1|1222158_1222815_+	adaptor protein MecA	NA	NA	NA	NA	NA
AYE63755.1|1222975_1224127_+	competence protein CoiA	NA	NA	NA	NA	NA
AYE63756.1|1224173_1226186_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AYE63757.1|1226223_1226391_-	hypothetical protein	NA	NA	NA	NA	NA
AYE63758.1|1226486_1226690_-	hypothetical protein	NA	NA	NA	NA	NA
AYE63759.1|1226704_1227604_-	DsbA family protein	NA	NA	NA	NA	NA
AYE63760.1|1227600_1227999_-	group 2 truncated hemoglobin YjbI	NA	NA	NA	NA	NA
AYE66725.1|1228253_1228799_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	60.4	4.8e-39
AYE63761.1|1229002_1229575_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AYE63762.1|1229699_1230068_+	hypothetical protein	NA	NA	NA	NA	NA
AYE63763.1|1230096_1230732_+	GTP pyrophosphokinase YjbM	NA	NA	NA	NA	NA
AYE63764.1|1230750_1231551_+	NAD(+) kinase	NA	NA	NA	NA	NA
AYE66726.1|1231613_1232465_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AYE63765.1|1232477_1233212_-	bis(5'-nucleosyl)-tetraphosphatase PrpE [asymmetrical]	NA	M4Q4T6	Vibrio_phage	25.0	3.2e-06
AYE63766.1|1233446_1235291_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AYE63767.1|1235539_1236250_+	thiaminase II	NA	NA	NA	NA	NA
AYE63768.1|1236224_1236842_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
AYE63769.1|1236825_1237935_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
AYE66727.1|1237934_1238135_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AYE63770.1|1238131_1238902_+	thiazole synthase	NA	NA	NA	NA	NA
AYE63771.1|1238898_1239909_+	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AYE63772.1|1239927_1240743_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AYE63773.1|1240878_1241655_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AYE63774.1|1241755_1242439_+|coat	spore coat protein O	coat	NA	NA	NA	NA
AYE63775.1|1242532_1242979_-|coat	spore coat protein Z	coat	NA	NA	NA	NA
AYE63776.1|1243106_1243595_-|coat	spore coat protein Y	coat	NA	NA	NA	NA
AYE63777.1|1243746_1244265_-|coat	spore coat protein X	coat	NA	NA	NA	NA
AYE63778.1|1244363_1244681_-|coat	spore coat protein CotW	coat	NA	NA	NA	NA
AYE63779.1|1244721_1245108_-|coat	spore coat protein V	coat	NA	NA	NA	NA
>prophage 2
CP032310	Bacillus subtilis strain WB800N chromosome, complete genome	4214174	1307544	1341277	4214174	holin,plate,terminase	Bacillus_phage(27.27%)	46	NA	NA
AYE63844.1|1307544_1308816_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	A0A1V0SEI6	Indivirus	37.1	8.6e-15
AYE63845.1|1308960_1310097_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.4	8.3e-94
AYE63846.1|1310086_1310221_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
AYE63847.1|1310251_1310509_-	hypothetical protein	NA	NA	NA	NA	NA
AYE63848.1|1310629_1311583_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	74.1	7.3e-67
AYE63849.1|1311622_1312000_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	6.1e-17
AYE63850.1|1312105_1312708_+	hypothetical protein	NA	F8WQ53	Bacillus_phage	49.2	3.8e-45
AYE63851.1|1312784_1313621_+	manganese catalase family protein	NA	NA	NA	NA	NA
AYE63852.1|1313664_1314261_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
AYE63853.1|1314423_1314765_-	transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
AYE63854.1|1314942_1315122_+	hypothetical protein	NA	NA	NA	NA	NA
AYE63855.1|1315108_1315945_+	phage-like element PBSX protein XkdB	NA	S6BFM4	Thermus_phage	28.2	1.8e-24
AYE63856.1|1315844_1316645_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	5.0e-61
AYE63857.1|1316644_1316812_+	hypothetical protein	NA	NA	NA	NA	NA
AYE63858.1|1316896_1317247_+	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
AYE63859.1|1317250_1317445_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AYE63860.1|1317565_1318075_+	positive control factor	NA	A0A1L2JY33	Aeribacillus_phage	38.6	1.9e-21
AYE63861.1|1318190_1318988_+|terminase	PBSX phage terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	50.2	8.0e-59
AYE63862.1|1318984_1320286_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.2	2.4e-153
AYE63863.1|1320289_1321777_+	phage-like element PBSX protein XkdE	NA	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
AYE63864.1|1321796_1322624_+	phage-like element PBSX protein XkdF	NA	A0A1B1P7E4	Bacillus_phage	58.7	2.1e-54
AYE63865.1|1322649_1323585_+	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
AYE63866.1|1323606_1323990_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.2	1.9e-13
AYE63867.1|1323986_1324343_+	phage-like element PBSX protein XkdH	NA	NA	NA	NA	NA
AYE63868.1|1324339_1324825_+	phage-like element PBSX protein XkdI	NA	A0A249XXA4	Clostridium_phage	47.0	2.1e-38
AYE63869.1|1324837_1325278_+	phage-like element PBSX protein XkdJ	NA	NA	NA	NA	NA
AYE63870.1|1325281_1325500_+	hypothetical protein	NA	NA	NA	NA	NA
AYE63871.1|1325496_1326897_+	phage-like element PBSX protein XkdK	NA	A0A0A7S087	Clostridium_phage	39.3	2.3e-77
AYE63872.1|1326898_1327342_+	phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
AYE63873.1|1327433_1327880_+	phage-like element PBSX protein XkdN	NA	A0A249XXA9	Clostridium_phage	33.6	7.5e-14
AYE63874.1|1327909_1328059_+	hypothetical protein	NA	NA	NA	NA	NA
AYE63875.1|1328060_1332059_+	phage-like element PBSX protein XkdO	NA	A0A1L2JY60	Aeribacillus_phage	44.9	2.1e-43
AYE63876.1|1332051_1332711_+	phage-like element PBSX protein XkdP	NA	A0A090DBR9	Clostridium_phage	34.0	3.7e-25
AYE63877.1|1332726_1333704_+	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
AYE63878.1|1333703_1333970_+	phage-like element PBSX protein XkdR	NA	S6C459	Thermus_phage	36.4	1.7e-05
AYE63879.1|1334026_1334452_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	7.8e-13
AYE63880.1|1334444_1335491_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	4.4e-73
AYE63881.1|1335474_1336053_+	phage-like element PBSX protein XkdU	NA	A0A2H4J717	uncultured_Caudovirales_phage	34.2	3.0e-15
AYE63882.1|1336049_1336322_+	hypothetical protein	NA	NA	NA	NA	NA
AYE63883.1|1336324_1338388_+	phage-like element PBSX protein XkdV	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	37.4	4.8e-31
AYE63884.1|1338399_1338729_+	phage-like element PBSX protein XkdW	NA	A0A2H4JCI0	uncultured_Caudovirales_phage	41.3	1.7e-15
AYE63885.1|1338725_1338890_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	66.0	3.2e-15
AYE63886.1|1338933_1339773_+	phage-like element PBSX protein XepA	NA	NA	NA	NA	NA
AYE63887.1|1339825_1340095_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	6.2e-24
AYE63888.1|1340107_1340371_+|holin	holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	4.7e-24
AYE63889.1|1340383_1341277_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	69.7	1.8e-83
>prophage 3
CP032310	Bacillus subtilis strain WB800N chromosome, complete genome	4214174	1868252	1874807	4214174		Bacillus_phage(50.0%)	7	NA	NA
AYE64332.1|1868252_1868645_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
AYE64333.1|1868604_1870707_+	ribonucleotide-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	87.0	0.0e+00
AYE64334.1|1870724_1871714_+	ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
AYE64335.1|1871763_1872384_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
AYE64336.1|1872447_1873215_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.5	9.1e-52
AYE64337.1|1873462_1873687_-	hypothetical protein	NA	NA	NA	NA	NA
AYE64338.1|1873838_1874807_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
>prophage 4
CP032310	Bacillus subtilis strain WB800N chromosome, complete genome	4214174	2059322	2065009	4214174	holin	Bacillus_phage(100.0%)	9	NA	NA
AYE64488.1|2059322_2059496_-	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	82.5	5.6e-18
AYE64489.1|2059640_2059865_+	hypothetical protein	NA	A0A1P8CWZ1	Bacillus_phage	82.0	8.9e-16
AYE64490.1|2059868_2060324_-	hypothetical protein	NA	NA	NA	NA	NA
AYE64491.1|2060448_2060709_+	hypothetical protein	NA	NA	NA	NA	NA
AYE64492.1|2061462_2061627_+|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	92.6	3.9e-21
AYE64493.1|2061781_2062897_+	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	49.2	1.5e-95
AYE64494.1|2062893_2063016_+	phosphatase RapK inhibitor	NA	NA	NA	NA	NA
AYE64495.1|2064171_2064465_-	YolD-like family protein	NA	O64030	Bacillus_phage	86.6	7.5e-39
AYE64496.1|2064673_2065009_+	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	86.5	7.2e-46
>prophage 5
CP032310	Bacillus subtilis strain WB800N chromosome, complete genome	4214174	2151257	2286682	4214174	bacteriocin,tail,integrase	Bacillus_phage(97.79%)	194	2202648:2202670	2221918:2221940
AYE64587.1|2151257_2151683_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1V0SAI8	Catovirus	36.8	4.9e-15
AYE64588.1|2151717_2151894_-	hypothetical protein	NA	O64196	Bacillus_phage	100.0	5.3e-24
AYE64589.1|2151896_2152484_-	hypothetical protein	NA	O64195	Bacillus_phage	100.0	3.6e-109
AYE66762.1|2152558_2152801_+	XRE family transcriptional regulator	NA	O64194	Bacillus_phage	100.0	8.6e-41
AYE64590.1|2152802_2152988_-	hypothetical protein	NA	O64193	Bacillus_phage	100.0	2.1e-26
AYE64591.1|2153071_2153284_-	hypothetical protein	NA	O64192	Bacillus_phage	100.0	5.2e-34
AYE64592.1|2153349_2153712_-	hypothetical protein	NA	A0A1P8CX73	Bacillus_phage	100.0	1.1e-63
AYE66763.1|2153708_2153882_-	hypothetical protein	NA	O64190	Bacillus_phage	100.0	3.4e-23
AYE64593.1|2153897_2154215_-	hypothetical protein	NA	A0A1P8CX53	Bacillus_phage	100.0	2.1e-55
AYE66764.1|2154227_2154305_-	hypothetical protein	NA	A0A1P8CX55	Bacillus_phage	100.0	7.4e-07
AYE64594.1|2154336_2154483_-	hypothetical protein	NA	A0A1P8CX49	Bacillus_phage	100.0	1.0e-17
AYE64595.1|2154518_2154650_-	rubrerythrin family protein	NA	A0A1P8CX61	Bacillus_phage	100.0	2.6e-20
AYE64596.1|2154689_2154881_-	hypothetical protein	NA	A0A1P8CX54	Bacillus_phage	100.0	1.0e-33
AYE66765.1|2154924_2155752_-	hypothetical protein	NA	O64184	Bacillus_phage	100.0	4.4e-169
AYE64597.1|2155870_2156089_+	small, acid-soluble spore protein C	NA	Q77YX0	Bacillus_phage	100.0	5.6e-31
AYE64598.1|2156388_2156742_-	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	64.1	3.9e-34
AYE64599.1|2156972_2157314_-	hypothetical protein	NA	O64181	Bacillus_phage	100.0	5.1e-55
AYE64600.1|2157460_2157751_-	hypothetical protein	NA	O64180	Bacillus_phage	100.0	4.3e-47
AYE64601.1|2157751_2157919_-	hypothetical protein	NA	A0A1P8CX64	Bacillus_phage	88.9	1.8e-21
AYE64602.1|2158070_2158316_+	hypothetical protein	NA	A0A1P8CX50	Bacillus_phage	100.0	1.6e-31
AYE64603.1|2158355_2158805_-	SPBc2 prophage-derived transcriptional regulator YosT	NA	A0A1P8CX48	Bacillus_phage	100.0	2.0e-83
AYE64604.1|2158899_2159328_-	SPBc2 prophage-derived deoxyuridine 5'-triphosphate nucleotidohydrolase YosS	NA	A0A1P8CX51	Bacillus_phage	100.0	5.4e-78
AYE64605.1|2159373_2159616_-	thioredoxin	NA	A0A1P8CX24	Bacillus_phage	100.0	1.4e-38
AYE64606.1|2160196_2160718_-	HNH endonuclease	NA	A0A1P8CX39	Bacillus_phage	100.0	7.4e-98
AYE66766.1|2161739_2164277_-	hypothetical protein	NA	A0A1P8CX40	Bacillus_phage	99.1	0.0e+00
AYE66768.1|2164523_2165201_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	88.4	2.3e-107
AYE66767.1|2165208_2165598_-	SPBc2 prophage-derived protein NrdI	NA	A0A1P8CX56	Bacillus_phage	94.6	8.9e-64
AYE64607.1|2165603_2165957_-	hypothetical protein	NA	O64171	Bacillus_phage	100.0	1.1e-60
AYE64608.1|2166044_2166245_-	hypothetical protein	NA	O64170	Bacillus_phage	100.0	2.1e-32
AYE64609.1|2166289_2166484_-	hypothetical protein	NA	O64169	Bacillus_phage	100.0	7.6e-32
AYE64610.1|2166504_2166639_-	hypothetical protein	NA	O64168	Bacillus_phage	100.0	2.5e-18
AYE64611.1|2166670_2167141_-	hypothetical protein	NA	O64167	Bacillus_phage	100.0	1.4e-82
AYE64612.1|2167201_2167564_-	hypothetical protein	NA	O64166	Bacillus_phage	100.0	8.6e-61
AYE64613.1|2167606_2167732_-	hypothetical protein	NA	O64165	Bacillus_phage	100.0	3.5e-14
AYE64614.1|2167745_2168093_-	hypothetical protein	NA	O64164	Bacillus_phage	100.0	1.2e-56
AYE64615.1|2168107_2168503_-	hypothetical protein	NA	O64163	Bacillus_phage	100.0	4.1e-72
AYE64616.1|2168541_2169084_-	hypothetical protein	NA	O64162	Bacillus_phage	100.0	1.4e-99
AYE64617.1|2169128_2169308_-	hypothetical protein	NA	O64161	Bacillus_phage	100.0	6.8e-27
AYE64618.1|2169438_2169558_+	YhzE/YjcZ family sporulation protein YosA	NA	NA	NA	NA	NA
AYE64619.1|2169661_2169874_-	hypothetical protein	NA	O64159	Bacillus_phage	100.0	1.2e-35
AYE64620.1|2169940_2170123_-	hypothetical protein	NA	O64158	Bacillus_phage	100.0	1.5e-26
AYE64621.1|2170135_2170363_-	hypothetical protein	NA	O64157	Bacillus_phage	100.0	9.2e-37
AYE64622.1|2170402_2170768_-	hypothetical protein	NA	O64156	Bacillus_phage	100.0	4.9e-64
AYE64623.1|2170770_2170989_-	hypothetical protein	NA	O64155	Bacillus_phage	100.0	4.3e-31
AYE64624.1|2171032_2172364_-	DNA cytosine methyltransferase	NA	Q77YW9	Bacillus_phage	100.0	1.5e-256
AYE64625.1|2172412_2172532_-	hypothetical protein	NA	O64154	Bacillus_phage	100.0	1.7e-13
AYE64626.1|2172563_2173082_-	5'-3'-deoxyribonucleotidase	NA	A0A1P8CX15	Bacillus_phage	100.0	2.2e-97
AYE64627.1|2173090_2173588_-	hypothetical protein	NA	A0A1P8CX28	Bacillus_phage	100.0	1.0e-88
AYE64628.1|2173587_2173743_-	hypothetical protein	NA	A0A1P8CX36	Bacillus_phage	100.0	2.0e-22
AYE66769.1|2173735_2173951_-	hypothetical protein	NA	O64150	Bacillus_phage	100.0	7.9e-38
AYE64629.1|2173983_2174181_-	hypothetical protein	NA	O64149	Bacillus_phage	100.0	1.9e-30
AYE64630.1|2174216_2174366_-	hypothetical protein	NA	O64148	Bacillus_phage	100.0	7.9e-21
AYE64631.1|2174481_2175198_-	hypothetical protein	NA	O64147	Bacillus_phage	100.0	2.1e-127
AYE64632.1|2175225_2179143_-	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	96.9	0.0e+00
AYE64633.1|2179155_2180886_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	98.3	0.0e+00
AYE64634.1|2180885_2182022_-	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	100.0	1.2e-225
AYE64635.1|2182037_2183552_-	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	100.0	3.6e-286
AYE64636.1|2183566_2184037_-	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	100.0	1.4e-87
AYE64637.1|2184079_2185051_-	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	100.0	1.7e-180
AYE64638.1|2185133_2186048_-	hypothetical protein	NA	O64140	Bacillus_phage	100.0	3.0e-171
AYE64639.1|2186069_2186441_-	hypothetical protein	NA	O64139	Bacillus_phage	100.0	2.6e-65
AYE64640.1|2186614_2186929_-	SPBc2 prophage-derived stress response protein SCP1	NA	NA	NA	NA	NA
AYE64641.1|2187005_2187386_-	hypothetical protein	NA	O64137	Bacillus_phage	100.0	3.8e-67
AYE64642.1|2187448_2187745_-	hypothetical protein	NA	O64136	Bacillus_phage	100.0	8.1e-49
AYE64643.1|2187833_2189594_-	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	100.0	0.0e+00
AYE64644.1|2189590_2190415_-	hypothetical protein	NA	O64134	Bacillus_phage	100.0	7.8e-150
AYE64645.1|2190513_2190909_-	hypothetical protein	NA	O64133	Bacillus_phage	100.0	7.7e-71
AYE64646.1|2190963_2191185_-	hypothetical protein	NA	O64132	Bacillus_phage	100.0	5.8e-36
AYE64647.1|2191255_2191930_+	DUF159 family protein	NA	A0A1P8CX02	Bacillus_phage	98.6	5.9e-79
AYE64648.1|2191999_2192812_+	SPBc2 prophage-derived DNA ligase-like protein LigB	NA	O64130	Bacillus_phage	100.0	2.5e-156
AYE64649.1|2192877_2193291_-	hypothetical protein	NA	O64129	Bacillus_phage	100.0	1.8e-78
AYE64650.1|2193456_2193606_+	hypothetical protein	NA	O64128	Bacillus_phage	100.0	2.7e-21
AYE64651.1|2193682_2194030_-	hypothetical protein	NA	O64127	Bacillus_phage	100.0	1.1e-60
AYE64652.1|2194031_2194388_-	hypothetical protein	NA	O64126	Bacillus_phage	100.0	1.6e-51
AYE64653.1|2194347_2194689_-	hypothetical protein	NA	O64125	Bacillus_phage	100.0	8.1e-61
AYE64654.1|2194802_2195177_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	100.0	3.4e-60
AYE64655.1|2195193_2195412_-	hypothetical protein	NA	O64123	Bacillus_phage	100.0	2.7e-33
AYE64656.1|2195615_2195894_+	hypothetical protein	NA	O64122	Bacillus_phage	100.0	2.3e-45
AYE64657.1|2196017_2196710_-	HNH endonuclease	NA	O64121	Bacillus_phage	100.0	7.2e-133
AYE64658.1|2196749_2196953_-	hypothetical protein	NA	O64120	Bacillus_phage	100.0	8.5e-34
AYE64659.1|2196972_2197599_-	DUF1273 domain-containing protein	NA	A0A1P8CWY2	Bacillus_phage	89.8	5.6e-108
AYE64660.1|2197698_2197893_-	hypothetical protein	NA	O64118	Bacillus_phage	100.0	3.2e-30
AYE64661.1|2197941_2198394_-	hypothetical protein	NA	O64117	Bacillus_phage	100.0	6.7e-79
AYE64662.1|2198476_2198734_-	hypothetical protein	NA	O64116	Bacillus_phage	100.0	3.0e-44
AYE64663.1|2198778_2198982_-	hypothetical protein	NA	O64115	Bacillus_phage	100.0	1.3e-34
AYE64664.1|2198990_2199155_-	hypothetical protein	NA	O64114	Bacillus_phage	100.0	1.7e-24
AYE64665.1|2199208_2199964_-	SPBc2 prophage-derived antirepressor protein YoqD	NA	A0A1P8CWY0	Bacillus_phage	100.0	1.1e-137
AYE64666.1|2200004_2200412_-	hypothetical protein	NA	A0A1P8CWY3	Bacillus_phage	100.0	2.6e-74
AYE64667.1|2200418_2200757_-	hypothetical protein	NA	O64111	Bacillus_phage	100.0	8.9e-52
AYE64668.1|2200753_2201104_-	hypothetical protein	NA	A0A1P8CWX8	Bacillus_phage	100.0	8.3e-61
AYE64669.1|2201116_2201320_-	hypothetical protein	NA	A0A1P8CWX9	Bacillus_phage	100.0	5.7e-30
AYE64670.1|2201333_2201612_-	hypothetical protein	NA	A0A1P8CWX5	Bacillus_phage	100.0	9.2e-47
AYE64671.1|2201608_2202013_-	hypothetical protein	NA	A0A1P8CWX0	Bacillus_phage	100.0	2.9e-73
AYE64672.1|2202009_2202345_-	hypothetical protein	NA	A0A1P8CWX6	Bacillus_phage	100.0	3.2e-46
AYE64673.1|2202433_2202628_-	hypothetical protein	NA	O64105	Bacillus_phage	100.0	1.9e-27
2202648:2202670	attL	TATATACATATTATTTGTATTTG	NA	NA	NA	NA
AYE64674.1|2202739_2202937_-	hypothetical protein	NA	O64104	Bacillus_phage	100.0	3.6e-29
AYE64675.1|2203006_2203225_-	hypothetical protein	NA	O64103	Bacillus_phage	100.0	6.6e-32
AYE64676.1|2203407_2203632_+	XRE family transcriptional regulator	NA	O64102	Bacillus_phage	100.0	1.9e-34
AYE64677.1|2203820_2204798_-	hypothetical protein	NA	O64101	Bacillus_phage	99.7	4.0e-177
AYE64678.1|2204821_2206204_-	hypothetical protein	NA	O64100	Bacillus_phage	100.0	1.3e-263
AYE64679.1|2206310_2207387_-|integrase	SPBc2 prophage-derived probable integrase/recombinase YopP	integrase	O64099	Bacillus_phage	100.0	1.5e-198
AYE64680.1|2207376_2207589_-	transcriptional regulator	NA	O64098	Bacillus_phage	100.0	8.6e-29
AYE64681.1|2207636_2207954_-	hypothetical protein	NA	NA	NA	NA	NA
AYE64682.1|2207956_2208157_-	hypothetical protein	NA	O64096	Bacillus_phage	100.0	9.0e-28
AYE64683.1|2208483_2208609_-	hypothetical protein	NA	NA	NA	NA	NA
AYE64684.1|2208622_2209783_-	hypothetical protein	NA	NA	NA	NA	NA
AYE64685.1|2209959_2210376_-	hypothetical protein	NA	O64093	Bacillus_phage	100.0	1.2e-71
AYE64686.1|2210377_2210911_-	hypothetical protein	NA	O64092	Bacillus_phage	100.0	9.3e-88
AYE64687.1|2210937_2211474_-	hypothetical protein	NA	O64091	Bacillus_phage	100.0	2.2e-97
AYE64688.1|2211512_2211644_-	hypothetical protein	NA	O64090	Bacillus_phage	100.0	1.7e-19
AYE64689.1|2211654_2211870_-	hypothetical protein	NA	O64089	Bacillus_phage	100.0	5.0e-32
AYE64690.1|2211873_2212125_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	100.0	1.6e-37
AYE64691.1|2212195_2212375_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	96.6	3.6e-28
AYE64692.1|2212476_2212707_+	hypothetical protein	NA	NA	NA	NA	NA
AYE64693.1|2212711_2213107_-	UPF0715 family protein	NA	O64087	Bacillus_phage	100.0	1.0e-62
AYE64694.1|2213164_2214493_-	hypothetical protein	NA	O64086	Bacillus_phage	100.0	8.7e-260
AYE64695.1|2214600_2214828_-	XRE family transcriptional regulator	NA	O64085	Bacillus_phage	100.0	1.0e-35
AYE64696.1|2215088_2216405_-	hypothetical protein	NA	O64084	Bacillus_phage	100.0	1.1e-257
AYE64697.1|2216761_2217268_-	hypothetical protein	NA	O64083	Bacillus_phage	100.0	4.9e-70
AYE64698.1|2217595_2218828_-	hypothetical protein	NA	O64082	Bacillus_phage	100.0	1.7e-238
AYE64699.1|2218909_2219098_-	hypothetical protein	NA	O64081	Bacillus_phage	100.0	1.5e-24
AYE64700.1|2219142_2219394_-	hypothetical protein	NA	A0A1P8CWU4	Bacillus_phage	94.4	1.6e-29
AYE64701.1|2219412_2219589_-	hypothetical protein	NA	O64080	Bacillus_phage	100.0	6.7e-11
AYE64702.1|2219963_2220575_-	lipoprotein	NA	O64079	Bacillus_phage	100.0	5.0e-85
AYE64703.1|2220689_2221016_-	XRE family transcriptional regulator	NA	O64078	Bacillus_phage	100.0	9.8e-56
AYE64704.1|2221968_2222163_+	hypothetical protein	NA	O64077	Bacillus_phage	100.0	2.7e-29
2221918:2221940	attR	CAAATACAAATAATATGTATATA	NA	NA	NA	NA
AYE64705.1|2222202_2224722_+	hypothetical protein	NA	O64076	Bacillus_phage	100.0	0.0e+00
AYE64706.1|2224965_2225244_+	SPBc2 prophage-derived DNA-binding protein HU 2	NA	A0A1P8CWT5	Bacillus_phage	76.9	1.2e-30
AYE64707.1|2226925_2227117_+	hypothetical protein	NA	O64074	Bacillus_phage	100.0	1.5e-27
AYE64708.1|2227133_2228351_+	hypothetical protein	NA	O64073	Bacillus_phage	99.8	1.3e-230
AYE64709.1|2228384_2228795_-	hypothetical protein	NA	A0A1P8CWT0	Bacillus_phage	100.0	8.8e-70
AYE64710.1|2229013_2229514_+	hypothetical protein	NA	A0A1P8CWS3	Bacillus_phage	100.0	3.6e-89
AYE64711.1|2229616_2230537_+	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	100.0	5.4e-176
AYE64712.1|2230523_2232293_+	hypothetical protein	NA	O64069	Bacillus_phage	100.0	0.0e+00
AYE64713.1|2232310_2233831_+	hypothetical protein	NA	O64068	Bacillus_phage	100.0	1.4e-282
AYE64714.1|2233861_2235298_+	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	100.0	2.7e-267
AYE64715.1|2235322_2235859_+	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	100.0	3.6e-95
AYE64716.1|2235897_2236914_+	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	100.0	1.3e-186
AYE64717.1|2236949_2237420_+	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	100.0	6.7e-82
AYE64718.1|2237434_2237830_+	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	100.0	2.5e-69
AYE64719.1|2237826_2238081_+	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	100.0	2.2e-39
AYE64720.1|2238064_2238715_+	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	100.0	3.2e-122
AYE64721.1|2238711_2239218_+	hypothetical protein	NA	O64060	Bacillus_phage	100.0	5.9e-92
AYE64722.1|2239214_2239925_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	100.0	1.8e-131
AYE64723.1|2239967_2240765_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	100.0	2.1e-91
AYE64724.1|2240782_2241394_+	hypothetical protein	NA	A0A1P8CWQ5	Bacillus_phage	100.0	3.3e-65
AYE64725.1|2241393_2241621_+	hypothetical protein	NA	A0A1P8CWR2	Bacillus_phage	100.0	6.4e-38
AYE64726.1|2241684_2242041_+	hypothetical protein	NA	O64055	Bacillus_phage	100.0	1.4e-58
AYE64727.1|2242042_2243260_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	100.0	2.5e-173
AYE64728.1|2243270_2243621_+	hypothetical protein	NA	O64053	Bacillus_phage	100.0	5.4e-60
AYE64729.1|2243617_2243809_+	XkdX family protein	NA	A0A1P8CWR4	Bacillus_phage	100.0	3.5e-29
AYE64730.1|2243858_2244359_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	100.0	5.7e-87
AYE64731.1|2244342_2244762_+	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	100.0	4.8e-71
AYE64732.1|2244775_2245777_+	SPBc2 prophage-derived recombinase-like protein YomM	NA	A0A1P8CWP6	Bacillus_phage	100.0	4.8e-194
AYE64733.1|2245779_2246109_-	hypothetical protein	NA	A0A1P8CWQ2	Bacillus_phage	99.1	1.2e-61
AYE64734.1|2246284_2246971_-	hypothetical protein	NA	O64048	Bacillus_phage	100.0	2.2e-126
AYE64735.1|2246995_2247172_-	hypothetical protein	NA	NA	NA	NA	NA
AYE64736.1|2247517_2247964_+	hypothetical protein	NA	O64047	Bacillus_phage	100.0	8.1e-77
AYE64737.1|2248045_2248729_+	immunity protein	NA	Q37974	Bacillus_phage	100.0	2.1e-116
AYE64738.1|2248782_2255640_+|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	67.7	0.0e+00
AYE64739.1|2255690_2256449_+|tail	phage tail protein	tail	O64045	Bacillus_phage	100.0	1.4e-145
AYE64740.1|2256460_2259088_+	hypothetical protein	NA	O64044	Bacillus_phage	100.0	0.0e+00
AYE64741.1|2259103_2259925_+	hypothetical protein	NA	O64043	Bacillus_phage	100.0	1.2e-134
AYE64742.1|2259961_2261896_+	hypothetical protein	NA	O64042	Bacillus_phage	100.0	0.0e+00
AYE64743.1|2262065_2262890_+	hypothetical protein	NA	A0A1P8CWP0	Bacillus_phage	100.0	1.5e-164
AYE64744.1|2262879_2263098_+	hypothetical protein	NA	A0A1P8CWN7	Bacillus_phage	100.0	1.7e-35
AYE64745.1|2263117_2264221_+	N-acetylmuramoyl-L-alanine amidase	NA	O64040	Bacillus_phage	100.0	2.8e-187
AYE64746.1|2264308_2264521_+	SPBc2 prophage-derived protein BhlA	NA	A0A290GDY2	Caldibacillus_phage	59.7	4.2e-15
AYE64747.1|2264531_2264798_+	SPBc2 prophage-derived protein BhlB	NA	A0A2H4J6M0	uncultured_Caudovirales_phage	50.0	1.1e-15
AYE64748.1|2264853_2265300_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
AYE64749.1|2265296_2266565_-	SunS family peptide S-glycosyltransferase	NA	NA	NA	NA	NA
AYE64750.1|2266564_2266978_-	thioredoxin	NA	NA	NA	NA	NA
AYE64751.1|2266974_2269092_-	SPBc2 prophage-derived sublancin-168-processing and transport ATP-binding protein SunT	NA	W8CYL7	Bacillus_phage	26.1	6.9e-25
AYE64752.1|2269149_2269320_-|bacteriocin	SPBc2 prophage-derived bacteriocin sublancin-168	bacteriocin	NA	NA	NA	NA
AYE64753.1|2269616_2269934_-	hypothetical protein	NA	NA	NA	NA	NA
AYE64754.1|2270035_2271286_-	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	100.0	4.2e-240
AYE64755.1|2271278_2271611_-	YolD-like family protein	NA	O64030	Bacillus_phage	100.0	1.3e-55
AYE64756.1|2271784_2272120_+	hypothetical protein	NA	O64029	Bacillus_phage	100.0	2.1e-53
AYE64757.1|2272162_2272519_-	hypothetical protein	NA	O64028	Bacillus_phage	100.0	5.0e-61
AYE64758.1|2272524_2272992_-	DUF4879 domain-containing protein	NA	O64027	Bacillus_phage	100.0	5.1e-82
AYE64759.1|2273617_2274151_-	N-acetyltransferase	NA	O64026	Bacillus_phage	100.0	6.2e-100
AYE64760.1|2274186_2274765_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	100.0	9.4e-110
AYE64761.1|2274828_2275326_-	SMI1/KNR4 family protein	NA	O64024	Bacillus_phage	100.0	1.9e-95
AYE64762.1|2275334_2277050_-	ribonuclease	NA	O64023	Bacillus_phage	99.8	1.4e-302
AYE64763.1|2277149_2277707_-	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	100.0	3.6e-106
AYE64764.1|2277736_2277976_+	hypothetical protein	NA	NA	NA	NA	NA
AYE64765.1|2278230_2279304_-	SPBc2 prophage-derived pesticidal crystal protein-like YokG	NA	O64021	Bacillus_phage	100.0	9.3e-204
AYE64766.1|2279605_2280496_+	SPBc2 prophage-derived endonuclease YokF	NA	O64020	Bacillus_phage	100.0	3.3e-114
AYE64767.1|2280509_2280992_+	hypothetical protein	NA	O64019	Bacillus_phage	100.0	2.5e-84
AYE64768.1|2281295_2282114_+	AAC(3) family N-acetyltransferase	NA	O64018	Bacillus_phage	100.0	1.9e-156
AYE64769.1|2282764_2283280_-	hypothetical protein	NA	O64017	Bacillus_phage	100.0	2.0e-95
AYE64770.1|2283486_2284197_-	lipoprotein	NA	O64016	Bacillus_phage	100.0	3.7e-108
AYE64771.1|2284399_2286037_+	resolvase YokA	NA	O64015	Bacillus_phage	100.0	2.8e-308
AYE66770.1|2286091_2286682_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	28.6	4.9e-13
>prophage 6
CP032310	Bacillus subtilis strain WB800N chromosome, complete genome	4214174	2424876	2430972	4214174		Staphylococcus_phage(66.67%)	8	NA	NA
AYE64920.1|2424876_2425470_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.0e-14
AYE66780.1|2425459_2426215_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	5.5e-09
AYE64921.1|2426495_2427020_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
AYE64922.1|2427033_2427408_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYE64923.1|2427520_2427985_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
AYE64924.1|2428017_2429214_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	6.9e-115
AYE64925.1|2429228_2429876_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	5.0e-43
AYE64926.1|2429886_2430972_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	5.1e-56
>prophage 7
CP032310	Bacillus subtilis strain WB800N chromosome, complete genome	4214174	2660728	2698870	4214174	capsid,portal,plate,holin,terminase,tail	uncultured_Caudovirales_phage(30.3%)	53	NA	NA
AYE65178.1|2660728_2662324_+	ribonuclease YqcG	NA	A0A1P8CWI7	Bacillus_phage	61.3	6.9e-78
AYE65179.1|2662338_2662917_+	suppressor of fused domain protein	NA	NA	NA	NA	NA
AYE65180.1|2663177_2663540_-	hypothetical protein	NA	NA	NA	NA	NA
AYE65181.1|2663555_2664035_-	hypothetical protein	NA	NA	NA	NA	NA
AYE65182.1|2664199_2665018_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	74.4	1.0e-64
AYE65183.1|2665062_2665485_-|holin	holin family protein	holin	D6R405	Bacillus_phage	73.7	3.3e-48
AYE65184.1|2665529_2666423_-|portal	phage portal protein	portal	NA	NA	NA	NA
AYE65185.1|2666510_2666675_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	2.7e-14
AYE65186.1|2666671_2667007_-|portal	phage portal protein	portal	NA	NA	NA	NA
AYE65187.1|2667016_2668117_-	hypothetical protein	NA	M4ZRP1	Bacillus_phage	56.1	1.7e-19
AYE65188.1|2668119_2668392_-	hypothetical protein	NA	NA	NA	NA	NA
AYE65189.1|2668388_2668967_-	DUF2313 domain-containing protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.8	1.5e-14
AYE65190.1|2668950_2669997_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.5	8.3e-72
AYE65191.1|2669989_2670415_-	DUF2634 domain-containing protein	NA	A0A0A8WJV8	Clostridium_phage	37.1	3.0e-12
AYE65192.1|2670427_2670691_-	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
AYE65193.1|2670687_2671668_-|portal	phage portal protein	portal	H7BV96	unidentified_phage	32.0	2.1e-40
AYE65194.1|2671680_2672340_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.7	4.8e-25
AYE65195.1|2672332_2677090_-	hypothetical protein	NA	A0A1L2JY60	Aeribacillus_phage	47.2	1.3e-44
AYE65196.1|2677092_2677230_-	hypothetical protein	NA	NA	NA	NA	NA
AYE65197.1|2677271_2677721_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	41.1	2.7e-11
AYE65198.1|2677866_2678046_+	type I toxin-antitoxin system toxin TxpA	NA	NA	NA	NA	NA
AYE65199.1|2678425_2678515_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AYE65200.1|2678768_2679212_-|portal	phage portal protein	portal	A0A0K2CNG3	Brevibacillus_phage	45.4	3.2e-25
AYE65201.1|2679214_2680615_-|tail	phage tail sheath protein	tail	S5MNC1	Brevibacillus_phage	39.1	4.1e-74
AYE65202.1|2680615_2680807_-	hypothetical protein	NA	NA	NA	NA	NA
AYE65203.1|2680803_2681241_-|portal	phage portal protein	portal	NA	NA	NA	NA
AYE65204.1|2681253_2681757_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.9	8.3e-38
AYE65205.1|2681753_2682116_-	DUF3599 family protein	NA	A0A249XXE9	Clostridium_phage	39.3	6.9e-10
AYE65206.1|2682112_2682508_-	DUF3199 family protein	NA	NA	NA	NA	NA
AYE65207.1|2682511_2682823_-	hypothetical protein	NA	NA	NA	NA	NA
AYE65208.1|2682833_2683769_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	65.0	8.6e-105
AYE65209.1|2683787_2684756_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.3	7.4e-59
AYE65210.1|2684788_2685442_-	hypothetical protein	NA	NA	NA	NA	NA
AYE65211.1|2685482_2686400_-	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	39.1	2.4e-51
AYE65212.1|2686396_2687929_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	51.9	4.7e-148
AYE65213.1|2687932_2689228_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	63.4	1.1e-155
AYE65214.1|2689220_2689940_-	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	55.9	1.7e-55
AYE65215.1|2690007_2690472_-	hypothetical protein	NA	NA	NA	NA	NA
AYE65216.1|2690615_2691071_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	74.8	2.4e-60
AYE65217.1|2691268_2692198_+	hypothetical protein	NA	NA	NA	NA	NA
AYE65218.1|2692271_2692478_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	71.6	5.5e-20
AYE65219.1|2692559_2692988_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	65.7	5.6e-43
AYE65220.1|2693083_2693233_-	hypothetical protein	NA	NA	NA	NA	NA
AYE65221.1|2693223_2694165_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	52.2	8.0e-58
AYE66791.1|2694046_2694724_-	DNA-binding protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	31.8	1.1e-05
AYE65222.1|2694799_2695654_-	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	79.0	7.1e-122
AYE65223.1|2695656_2696616_-	hypothetical protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	72.9	2.2e-135
AYE65224.1|2696721_2696916_-	hypothetical protein	NA	NA	NA	NA	NA
AYE65225.1|2697045_2697303_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	42.2	6.4e-10
AYE65226.1|2697299_2697869_-	transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	61.0	1.5e-64
AYE65227.1|2697942_2698083_-	hypothetical protein	NA	NA	NA	NA	NA
AYE65228.1|2698112_2698343_-	XRE family transcriptional regulator	NA	A8ATK0	Listeria_phage	53.4	1.1e-08
AYE65229.1|2698519_2698870_+	helix-turn-helix domain-containing protein	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	30.6	2.0e-06
>prophage 8
CP032310	Bacillus subtilis strain WB800N chromosome, complete genome	4214174	3833274	3842621	4214174	bacteriocin,tRNA	Staphylococcus_phage(100.0%)	10	NA	NA
AYE66308.1|3833274_3834945_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
AYE66309.1|3834941_3835370_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
AYE66310.1|3835682_3835814_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
AYE66311.1|3835770_3835923_+|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
AYE66312.1|3837307_3837469_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
AYE66313.1|3837465_3838185_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	7.3e-19
AYE66314.1|3838177_3839488_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
AYE66844.1|3839477_3840638_+|bacteriocin	bacteriocin biosynthesis zinc-dependent peptidase AlbE	bacteriocin	NA	NA	NA	NA
AYE66315.1|3840642_3841923_+	zinc-dependent peptidase	NA	NA	NA	NA	NA
AYE66316.1|3841919_3842621_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
>prophage 9
CP032310	Bacillus subtilis strain WB800N chromosome, complete genome	4214174	3852343	3893612	4214174	coat,tRNA,protease	Enterobacteria_phage(20.0%)	41	NA	NA
AYE66327.1|3852343_3853003_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AYE66328.1|3853111_3853300_+	2-hydroxymuconate tautomerase	NA	NA	NA	NA	NA
AYE66329.1|3853342_3853762_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYE66330.1|3853881_3855798_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	43.2	6.2e-142
AYE66331.1|3856642_3858043_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
AYE66332.1|3858042_3858513_-	transcriptional regulator	NA	NA	NA	NA	NA
AYE66333.1|3858624_3859125_-	YwgA family protein	NA	NA	NA	NA	NA
AYE66334.1|3859160_3860462_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
AYE66335.1|3860623_3860848_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
AYE66336.1|3861062_3861839_+	prespore-specific transcriptional regulator RsfA	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
AYE66337.1|3861982_3862873_-	EamA family transporter	NA	NA	NA	NA	NA
AYE66338.1|3863040_3863886_-	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
AYE66339.1|3863934_3864834_-	transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
AYE66340.1|3864980_3865952_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
AYE66845.1|3866236_3866986_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
AYE66341.1|3867118_3867898_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYE66342.1|3867912_3869112_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AYE66343.1|3869112_3870297_-	MFS transporter	NA	NA	NA	NA	NA
AYE66344.1|3870293_3871712_-	alanine-anticapsin ligase BacD	NA	NA	NA	NA	NA
AYE66345.1|3871730_3872498_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	2.9e-21
AYE66346.1|3872494_3873202_-	bacilysin biosynthesis protein BacB	NA	NA	NA	NA	NA
AYE66347.1|3873191_3873806_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
AYE66348.1|3873957_3875196_-	MFS transporter	NA	NA	NA	NA	NA
AYE66349.1|3875405_3876818_-	amino acid permease	NA	NA	NA	NA	NA
AYE66350.1|3876817_3878518_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
AYE66351.1|3878591_3880139_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYE66352.1|3880365_3881640_-	catabolic NAD-specific glutamate dehydrogenase RocG	NA	NA	NA	NA	NA
AYE66353.1|3881816_3882281_-	hypothetical protein	NA	NA	NA	NA	NA
AYE66354.1|3882604_3883060_-|coat	spore coat polysaccharide biosynthesis protein SpsL	coat	NA	NA	NA	NA
AYE66355.1|3883052_3883904_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.5	4.1e-37
AYE66356.1|3883917_3884865_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
AYE66357.1|3884864_3885605_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	41.9	2.6e-48
AYE66358.1|3885629_3886649_-|coat	spore coat polysaccharide biosynthesis protein SpsG	coat	NA	NA	NA	NA
AYE66359.1|3886651_3887374_-|coat	spore coat polysaccharide biosynthesis protein SpsF	coat	NA	NA	NA	NA
AYE66360.1|3887366_3888488_-|coat	spore coat biosynthesis protein SpsE	coat	NA	NA	NA	NA
AYE66361.1|3888487_3889357_-|coat	spore coat polysaccharide biosynthesis protein SpsD	coat	NA	NA	NA	NA
AYE66362.1|3889357_3890527_-|coat	spore coat polysaccharide biosynthesis protein SpsC	coat	A0A1D8KU11	Synechococcus_phage	26.6	5.5e-16
AYE66363.1|3890547_3891972_-|coat	spore coat polysaccharide biosynthesis protein SpsB	coat	NA	NA	NA	NA
AYE66364.1|3891976_3892747_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	28.6	3.4e-06
AYE66365.1|3892739_3892919_-	hypothetical protein	NA	NA	NA	NA	NA
AYE66366.1|3893066_3893612_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
